Previous Article | Next Article ![]()
J Bacteriol, February 1998, p. 840-845, Vol. 180, No. 4
Department of Biochemistry and Microbiology,
University of Victoria, Victoria, British Columbia V8W
3P6,1 and
Microtek International
Ltd., Saanichton, British Columbia V8X 3X1,2
Canada
Received 21 August 1997/Accepted 16 December 1997
A Tn10 insertion affecting SEF14 fimbrial synthesis in
Salmonella enteritidis was located 13 bp upstream of a gene
designated fimU. The 77-bp DNA sequence of fimU
from S. enteritidis was identical to that of
fimU encoding tRNAArg (UCU) from
Salmonella typhimurium and 96% identical to that of the
Escherichia coli argU homolog. Furthermore, the open
reading frame adjacent to and overlapping the 3' end of
fimU was similar to the prophage DLP12 integrase gene. The
fimU-encoded transcript comigrated with total cellular tRNA
and was predicted to form a tRNA-like cloverleaf structure containing
the arginine anticodon UCU. Thus, fimU encoded a
tRNAArg specific for the rare codon AGA. fimU
mapped to the SEF21 fim operon located 15 C's from the
sef14 gene cluster. Although fimU was located
within the SEF21 fim gene cluster, the fimU
Tn10 insertion mutant of S. enteritidis was
found to be defective in SEF14 as well as SEF21 (type 1) fimbria
production. SEF17 and SEF18 fimbria production was not affected.
Complementation of this mutant with plasmid-borne fimU
restored normal production of the fimbrins SefA and FimA as well as
their respective fimbriae SEF14 and SEF21. This is the first
description of tRNA simultaneously controlling the production of two
distinct fimbriae.
Regulation of fimbria biosynthesis
in bacteria is multifactorial and complex. In Escherichia
coli, the expression of type 1 fimbriae is transcriptionally
regulated in part by an inversion-dependent, phase-variable mechanism
that involves two site-specific recombinases (17, 24, 27)
and a tRNALeu molecule (32).
tRNALeu, specific for the rare leucine codon UUG,
stimulates type 1 fimbria synthesis by influencing the switch from
phase off to phase on (35). Recently, type 1 fimbria
expression in Salmonella typhimurium has been shown to be
regulated by mechanisms that are different from those controlling type
1 fimbria expression in E. coli (41). However, a
common regulatory theme does exist in that a tRNA, specific for the
rare arginine codons AGA and AGG, is required (40). Swenson
et al. (40) suggest that the amount of tRNAArg
(UCU) available in S. typhimurium may influence the
expression of three genes encoding regulatory proteins of the
fim gene cluster, since in each of these genes there is a
high frequency of rare AGA codons recognized by tRNAArg
(UCU).
Salmonella enteritidis 27655-3b produces at least four
fimbrial types: SEF17 (10), SEF18 (6), SEF21
(type 1 fimbriae) (30), and SEF14 (7, 14).
Although little is known about how the expression of the operons is
regulated, SEF21 and SEF14 fimbriae are produced under similar
environmental conditions (5, 12). Thus, the question arises
as to whether or not their expression is coregulated. In a previous
study, a Tn10 insertion mutant, S. enteritidis
3b-122, was generated which no longer produced SEF14 fimbriae and
carried the transposon outside of sefA, the structural gene
for these fimbriae (14). Further characterization of 3b-122
in this study indicated that this mutant was also defective in type 1 fimbria (SEF21) production, suggesting that the Tn10 interrupted a gene whose product coregulated the expression of both
SEF14 and SEF21 fimbriae. The results of this study show for the first
time that the production of two fimbriae is coregulated by the same
tRNA.
Bacterial strains, plasmids, media, and growth conditions.
S. enteritidis 27655-3b, originally isolated from human
feces, was provided by T. Wadstrom (University of Lund, Lund, Sweden). S. enteritidis 27655-3b-122, a Tn10 insertion
mutant of the parent strain, was constructed by Feutrier et al.
(14). E. coli DH5
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
tRNAArg (fimU) and
Expression of SEF14 and SEF21 in Salmonella
enteritidis
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
and S. enteritidis 3b-122 were used as hosts for pSFA (11), pLU/TA 4-1, and pGEM-T1. To create pLU/TA 4-1, PCR-amplified
fimU was cloned into pGEM-T (Promega Corp.), a TA cloning
vector containing 3'-terminal thymidines. To create pGEM-T1, the
3'-overhanging thymidines of pGEM-T were filled in with dATP and T4 DNA
polymerase prior to ligation (38).
TABLE 1.
Production of SefA, FimA, AgfA, and SefD fimbrins by
S. enteritidis 3b and S. enteritidis 3b-122
Subcloning Tn10 from S. enteritidis 27655 3b-122.
S. enteritidis 3b-122 chromosomal DNA was isolated
by the method of Alm et al. (1), purified by CsCl
centrifugation (38), and digested with
HindIII. To subclone the Tn10-containing
chromosomal DNA fragment, size fractionated HindIII
fragments (2 to 3 and 3 to 5 kb) were purified from an agarose gel with
Sephaglas (Pharmacia Biotech), ligated to
HindIII-digested and -dephosphorylated cloning vector
pTZ19R, and then introduced into E. coli DH5
by
transformation (38). A total of 2,880 colonies grown on
Hybond N+ membranes (Amersham) were screened by
hybridization to the oligonucleotide probe Tn10 IS10L+R
(5' GCAGAATTGGTAAAGAGA 3'). This probe, complementary to the
sequence located 134 bp inside the insertion sequence of Tn10, was used to identify Tn10-containing
clones. The probe, end labelled with [
-32P]ATP, was
hybridized to the membranes at 45°C in prehybridization buffer
(38) containing 200 µg of herring sperm DNA (Sigma)/ml. Following hybridization, the membranes were washed in 0.2× SSC buffer
(1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) containing 0.1%
sodium dodecyl sulfate (SDS) at 45°C, and the results were recorded
by autoradiography on Kodak BioMax film.
DNA sequencing and computer analyses. The Tn10-positive clones and the three fimU PCR products amplified with primers located outside the fimU gene were sequenced with Sequenase version 2 (United States Biochemicals). The custom oligonucleotide primer Tn10IS10L+R was synthesized on a PCR-MATE EP model 391 DNA synthesizer (Applied Biosystems Inc.). The DNA sequences obtained were analyzed with DNA Strider 1.1 (26). Similarity searches of the National Center for Biotechnology Information (NCBI) databases were conducted with the program BLASTN (2).
PCR amplification of fimU. Custom oligonucleotide primers fimULT (TAATAGCGATACGCAGAATTCAAAAATATCCTACACGGCAGG) and fimULB (CAGATATGCTCACCTAAGCTTTAATCATTTAACGGAACACGG) were designed based on the S. typhimurium chromosomal DNA sequence flanking fimU and were synthesized by Gibco BRL. fimU was PCR amplified from a previously prepared cosmid clone, pPB523 (12), with fimULT and fimULB. To facilitate the cloning of the amplified product, the primers were designed to contain an EcoRI site and a HindIII site, respectively (underlined). Amplification was carried out in a 100-µl reaction volume containing 10 µl of pPB523 (0.01 µg/ml), 25 pmol of each primer, the four deoxynucleotide triphosphates (Boehringer Mannheim) at 0.5 mM each, and 2 U of Taq DNA polymerase (Boehringer Mannheim) in reaction buffer consisting of 50 mM Tris-HCl (pH 8.5), 20 mM KCl, 2.5 mM MgCl2, and 0.5 mg of bovine serum albumin/ml. The Taq enzyme was added after an initial 3-min denaturation step at 95°C (4). Thermocycling was performed in a PTC-100TM Programmable Thermal Controller (MJ Research Inc.) as follows: 1 cycle of 75°C, 1 min; 50°C, 2 min; 74°C, 2 min and 30 cycles of 95°C, 1 min; 50°C, 1 min; 74°C, 2 min, followed by an 8-min elongation at 74°C.
Subcloning PCR-amplified fimU.
PCR-amplified
fimU was purified from a 1% agarose gel with Sephaglas,
ligated to pGEM-T according to the manufacturer's instructions (Promega Corp.), and then transformed into E. coli DH5
(38).
Mapping of fimU on genomic restriction maps of
Salmonella and E. coli strains.
The
fimU gene was mapped as previously described for the four
fimbrin genes sefA, agfA, fimA, and
sefD (8). The fimU probe, prepared by
running EcoRI- and HindIII-digested pLU/TA
4-1 on a 1% agarose gel and purifying the fragment with Sephaglas, was labelled with [
32P]dATP (Pharmacia Biotech) by nick
translation. The radiolabelled fimU probe was hybridized to
nitrocellulose blots containing XbaI- and
BlnI-digested E. coli, S. typhimurium,
and S. enteritidis genomic DNA separated by pulsed field gel
electrophoresis (blots were provided by K. Sanderson and S.-L. Liu; see
reference 8).
RNA extraction and Northern blot analysis.
Total RNA was
prepared from S. enteritidis 3b, 3b-122, 3b-122 pGEM-T1, and
3b-122 pLU/TA 4-1 grown statically in LB or CFA broth at 37°C for
45 h by a modification of the procedure of McCormick et al.
(28) as described in Clouthier et al. (7). For
fimU transcript analysis, the RNA was separated on a 10%
polyacrylamide gel containing 8 M urea and transferred onto Hybond
N+ membranes (Amersham) with transfer buffer (0.025 M
phosphate buffer [pH 6.5]) and an LKB Pharmacia semidry blotting
apparatus. For sefA transcript analysis, the electrophoretic
separation of total cellular RNA and its subsequent transfer to Hybond
N+ membranes (Amersham) were performed as described in
Fourney et al. (15). The fimU- and
sefA-specific probes used for Northern blot analysis were
gel purified from EcoRI and HindIII digests of pLU/TA 4-1 and pSFA, respectively, with Sephaglas. The probes were
labelled with [
32P]dATP (Pharmacia Biotech) by nick
translation and hybridized to the blots at 65°C for 18 h in the
presence of 200 µg of herring sperm DNA (Sigma)/ml. The membranes
were washed at high stringency (0.2× SSC buffer-0.1% SDS, 65°C),
and the results were recorded on Kodak BioMax or X-Omat AR5 film.
SDS-PAGE and Western blot analysis. Whole-cell lysates of S. enteritidis 3b or clones of this strain were screened for the presence of four fimbrial types. SEF14, 18, and 21 were solubilized from whole cells with SDS-polyacrylamide gel electrophoresis (PAGE) sample buffer supplemented with 0.2 M glycine (pH 2, 100°C, 10 min), whereas SEF17 fimbriae were solubilized from whole cells with formic acid according to the method of Collinson et al. (9, 10). A portion of each culture (1 OD630 unit) was resuspended in 200 µl of sample buffer, and 10 µl (0.01 OD630 unit) was loaded per lane. Proteins in these samples were separated by SDS-PAGE, electrophoretically transferred to nitrocellulose, and screened with rabbit polyclonal anti-SEF14 (7), SEF17 (10), SEF18 (6), or SEF21 immune serum (30). Immunoreactive proteins were detected with goat anti-rabbit immunoglobulin G-alkaline phosphatase conjugates (Cedarlane) and visualized with 5-bromo-4-chloro-3-indolylphosphate and Nitro Blue Tetrazolium (Sigma).
Electron microscopy. SEF14 and SEF21 fimbriae on S. enteritidis 3b, 3b-122, 3b-122 pGEM-T1, and 3b-122 pLU/TA 4-1 were immunogold labelled with SEF14- or SEF21-specific rabbit polyclonal immune sera followed by incubation with protein A-15-nm-diameter gold particles (Cedarlane). Negative staining was performed as described previously (10).
Nucleotide sequence accession number. The nucleotide sequence reported herein for fimU has been submitted to GenBank and has been given the accession number AF013136.
| |
RESULTS |
|---|
|
|
|---|
Fimbria production in S. enteritidis 3b-122. Production of SEF14, -17, -18, and -21 fimbriae by the S. enteritidis Tn10 mutant 3b-122 grown under various growth conditions was assessed by Western blotting with fimbria-specific antisera, and the results were compared to those obtained with the wild-type strain S. enteritidis 3b. The Tn10 mutation in 3b-122 had a pronounced effect on SEF14 and SEF21 production but little or no effect on SEF17 and SEF18 production (Table 1). As previously reported, SEF14 fimbriae were not expressed by 3b-122 grown in static CFA broth at 37°C (Table 1). Further characterization in this study, however, showed that 3b-122 lost SEF14 expression under all the growth conditions in which 3b was SEF14 positive (Table 1). In addition to the SEF14-negative phenotype, 3b-122 was also defective for type 1 fimbria (SEF21) production. The wild-type strain produced FimA under all growth conditions tested, whereas 3b-122 only produced FimA in CFA broth cultures. Thus, the result of the Tn10 insertion was the complete loss of SEF14 expression under all growth conditions and selective loss of SEF21 expression under certain growth conditions. The altered production of SEF14 and SEF21 fimbriae in the Tn10 insertion mutant relative to the wild-type expression patterns suggested that the transposon insertion interrupted a gene whose product was required for both SEF14 and SEF21 fimbria expression.
Identification of the Tn10 insertion site in S. enteritidis 3b-122. To determine the Tn10 insertion site, HindIII fragments of 3b-122 chromosomal DNA were subcloned into pTZ19. Clones containing Tn10 were identified with the probe IS10L+R, which hybridized within the insertion sequence located at either end of the transposon (Fig. 1A). Of the 17 Tn10-positive clones identified, 3 were subjected to DNA sequence analysis. Comparison of the 3b-122 DNA sequence flanking Tn10 to sequences listed in the NCBI databases revealed that the sequence was 99% identical to that of the region located between fimW and fimU of the S. typhimurium type 1 fimbrial gene cluster. Thus, on the basis of DNA sequence comparison, Tn10 was inserted 13 bp upstream of the predicted start site of the gene, which will hereafter be referred to as fimU (Fig. 1A and B).
|
DNA sequence analysis of fimU subcloned from S. enteritidis 3b. By using primers fimULT and fimULB designed from the sequence flanking the fimU gene in S. typhimurium, a 490-bp fragment was PCR amplified from the cosmid clone pPB523-G containing 35 kb of S. enteritidis 3b DNA (Fig. 1B). The fimU PCR product was subcloned into vector pGEM-T (Fig. 1B). Nucleotide sequence analysis of three clones revealed a potential promoter, but a putative translated protein could not be detected by open reading frame analysis. Comparison of the DNA sequence downstream of the potential promoter to sequences listed in the NCBI databases showed that the sequence was identical to that of fimU of S. typhimurium (Fig. 1C and 2B) and 96% similar to that of argU/dnaY of E. coli (Fig. 2A). These genes encode arginine-specific tRNAs that recognize the rare AGA codon. The nucleotide sequence of fimU from S. enteritidis 3b contained 4 inverted repeats, which were predicted to fold the sequence into the characteristic tRNA-like cloverleaf structure (Fig. 2B) with UCU in the expected tRNA anticodon position. Together, these data suggested that fimU from S. enteritidis 3b encoded an arginine-specific tRNA.
|
Mapping fimU on the S. enteritidis 3b genome. Like fimA, fimU was localized to chromosomal XbaI and BlnI fragments in the 98.5- to 13.0-C's region of the chromosome in both Salmonella serovars. By using a series of S. typhimurium and S. enteritidis Tn10 mutants the fimU gene was more precisely mapped to between purE884::Tn10 at 12.6 C's and the first XbaI restriction site at 13.6 C's in S. enteritidis or 13.0 C's in S. typhimurium. Thus, fimU mapped to the same region shown previously to contain the fimA gene in the fim gene cluster.
Analysis of fimU transcription. To determine if the fimU transcript was the same size as tRNA, a fimU-specific probe was hybridized to a blot containing total RNA isolated from S. enteritidis 3b, 3b-122, 3b-122 pGEM-T1, or 3b-122 pLU/TA 4-1 grown under conditions optimal for type 1 fimbria (SEF21) production in S. enteritidis 3b (static LB broth, 48 h, 37°C). The fimU-specific probe hybridized to a transcript that was present in total RNA from 3b and 3b-122 pLU/TA 4-1 (Fig. 3). The fimU transcript was consistently difficult to detect on Northern blots of 3b RNA even with excessive amounts of RNA loaded on the gels (25 µg [Fig. 3, lanes 1 to 4] and 50 µg [Fig. 3, lanes 5 to 8]) and extended exposure of the blots to X-ray film. Although the transcript was not found in RNA prepared from 3b-122, trace levels were evident in 3b-122 carrying the vector pGEM-T (Fig. 3), but the transcript was even more difficult to detect than its counterpart in 3b. The transcript detected with the fimU-specific probe comigrated with tRNA, suggesting that the product of fimU from S. enteritidis was indeed a tRNA molecule.
|
Complementation of fimbrin expression and fimbria assembly in 3b-122. Fimbria expression was examined in S. enteritidis 3b, 3b-122, 3b-122 pGEM-T1, and 3b-122 LU/TA 4-1 grown under conditions that promoted production of both SEF14 and SEF21 by the wild-type strain (static CFA broth, 48 h, 37°C). Western blot analysis of whole-cell lysates using SEF14- or SEF21-specific antisera showed that complementation of the insertion mutation in 3b-122 with pLU/TA 4-1 restored SEF14 and SEF21 fimbria expression (Fig. 4). Thus fimU affected the production of two fimbrins encoded by genes located on two different gene clusters.
|
|
|
Analysis of sefA transcription. The effect of tRNAArg (UCU) on sefA transcript production was analyzed by hybridizing a sefA-specific probe to a blot containing total cellular RNA isolated from S. enteritidis 3b, 3b-122, 3b-122 pGEM-T1, or 3b-122 LU/TA 4-1 grown under conditions optimal for SEF14 production in 3b (static CFA broth, 48 h, 37°C). The sefA-specific probe hybridized to a 660-base transcript that was present in RNA from 3b and 3b-122 pLU/TA 4-1 but absent from RNA from 3b-122 and 3b-122 pGEM-T1 (Fig. 6). The strains expressing the sefA transcript corresponded to those carrying a functional fimU gene, suggesting that fimU was required for expression of sefA.
|
| |
DISCUSSION |
|---|
|
|
|---|
fimU, located in the fim (sef21)
operon of S. enteritidis 3b, encodes an arginine-specific
tRNA that is required for expression of not only SEF21 fimbriae (type
1) but also SEF14 fimbriae. The product of fimU in 3b is a
tRNA, since Northern blot analysis of RNA from 3b and 3b-122 pLU/TA 4-1 demonstrates that the fimU transcript comigrates on
polyacrylamide gels with tRNA. Furthermore, the 77-nucleotide sequence
of the fimU gene of 3b is identical to that of
fimU of S. typhimurium (39) and shares
extensive homology with that of argU encoding
tRNAArg (UCU) from E. coli (18). The
fimU-encoded transcript from 3b can be folded into a typical
tRNA cloverleaf structure containing the 3'-terminal sequence CCA as
well as the invariant or semivariant nucleotides common to tRNA
molecules (19, 34). Finally, the DNA sequence 5' to the
fimU gene contains features common to the promoters of tRNA
operons including the consensus E. coli
10 and
35
promoter elements (16, 21) and a G+C-rich discriminator sequence (16, 42, 43). The regulatory mechanisms controlling fimU expression are unknown. Recently, however, the
integration and excision of plasmids, phage, and pathogenicity islands
into and out of the chromosomes at tRNA loci have been shown to affect tRNA gene expression (20, 33). As shown with the E. coli tRNA gene argU (25), the open reading
frame adjacent to and overlapping fimU is a homolog of the
integrase gene (int) from the defective lambdoid prophage
DLP12. Integration of prophage DLP12 at this site prevents
cotranscription of the int gene with fimU, which may contribute to the regulation of fimU expression in
S. enteritidis 3b.
The influence of tRNAArg (UCU) encoded by fimU on SEF14 and SEF21 fimbria production is evident in the Tn10 insertion mutant S. enteritidis 3b-122. The transposon, inserted between the predicted promoter and the 5' end of the mature fimU transcript, disrupts transcription of fimU and thus tRNAArg (UCU) production. This mutation results in the loss of SefA production and selective loss of FimA production, i.e., the subunits of SEF14 and SEF21 (type 1) fimbriae, respectively. Thus, in S. enteritidis 3b, tRNAArg (UCU) is required for SEF14 production and enhances type 1 fimbria (SEF21) production. In E. coli, cross-talk has also been reported to occur between adhesin gene clusters (29), and tRNA molecules have been shown to play a key role in global regulatory cascades (20). However, this is the first study to show that a tRNA-specific locus found on one fimbrial operon influences the production of two fimbrins whose operons are separated by 15 C's on the chromosome.
tRNAArg (UCU) encoded by fimU is required for transcription of sefA, the gene encoding the subunit of SEF14 fimbriae in S. enteritidis 3b. The regulatory mechanism is unknown, but a direct correlation between the abundance of tRNAs and the occurrence of the respective codons in protein genes (22, 23) has been suggested to control the translation of genes containing rare codons (3, 37). Since AGA, the codon recognized by the tRNAArg (UCU) species encoded by fimU, is one of the least-used codons for arginine, then perhaps the limited availability of charged tRNAs for this minor codon controls the level of translation of the sefA transcript or of a transcript whose protein product is involved in the regulation of sefA transcription. sefA contains neither of the rare arginine codons AGA or AGG recognized by tRNAArg (UCU), indicating that fimU expression would not have a direct effect on the translation of sefA mRNA. However, sefE, the gene encoding the putative AraC-like transcriptional activator of the sef14 gene cluster, contains 13 arginine codons, including 9 AGA codons and 1 AGG codon (5). Perhaps the tRNAArg (UCU) encoded by fimU regulates translation of sefE, which would in turn affect transcription of sefA and the downstream genes.
With the exception of the gene fimA encoding the subunit of SEF21 fimbriae (12), the remainder of the sef21 gene cluster has not been characterized in S. enteritidis 3b. Thus, the mechanism for regulation of type 1 fimbria synthesis by fimU remains to be determined. However, type 1 fimbria (SEF21) production is optimal when S. enteritidis 3b is grown at 37°C in a static broth culture but suboptimal when the cells are grown at lower temperatures (21 to 30°C) in shaking broth culture or on solid medium (12). Similarly, expression of SEF14 fimbriae by S. enteritidis 3b is environmentally controlled by temperature, medium composition, and aeration, and is optimal at 37°C in static, aerobic CFA broth (5). Thus, the coregulation of SefA and FimA fimbrin production by fimU-encoded tRNAArg (UCU) results in the corresponding fimbriae being expressed under similar environmental conditions, which may give the bacteria a competitive advantage for survival.
| |
ACKNOWLEDGMENTS |
|---|
This project was supported by operating grants to W.W.K. provided by the Natural Sciences and Engineering Research Council of Canada (NSERC) and the Canadian Bacterial Diseases Network. S.C.C. was the recipient of an Industrial Postdoctoral Fellowship from NSERC, and A.P.W. was the recipient of a Graduate Research Engineering and Technology Award scholarship from the Science Council of British Columbia and a Graduate Research scholarship from NSERC.
We thank S. Lee for helpful discussions on tRNA.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry and Microbiology, University of Victoria, Victoria, B.C. V8W 3P6, Canada. Phone: (250) 721 7078. Fax: (250) 721 8882. E-mail: wkay{at}uvic.ca.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Alm, R. A.,
P. Guerry, and T. J. Trust.
1993.
Distribution and polymorphism of the flagellin genes among isolates of Campylobacter coli and Campylobacter jejuni.
J. Bacteriol.
175:3051-3057 |
| 2. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline]. |
| 3. |
Chen, G.-F., and M. Inouye.
1994.
Role of the AGA/AGG codons, the rarest codons in global gene expression in Escherichia coli.
Genes Dev.
8:2641-2652 |
| 4. |
Chou, Q.,
M. Russell,
D. E. Birch,
J. Raymond, and W. Bloch.
1992.
Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplification.
Nucleic Acids Res.
20:1717-1723 |
| 5. | Clouthier, S. C. 1995. . Ph.D. thesis. University of Victoria, Victoria, Canada. |
| 6. | Clouthier, S. C., S. K. Collinson, and W. W. Kay. 1994. Unique fimbriae-like structures encoded by sefD of the SEF14 fimbrial gene cluster of Salmonella enteritidis. Mol. Microbiol. 12:893-903[Medline]. |
| 7. |
Clouthier, S. C.,
K.-H. Müller,
J. L. Doran,
S. K. Collinson, and W. W. Kay.
1993.
Characterization of three fimbrial genes, sefABC, of Salmonella enteritidis.
J. Bacteriol.
175:2523-2533 |
| 8. | Collinson, S. K., S.-L. Liu, S. C. Clouthier, P. A. Banser, J. L. Doran, K. E. Sanderson, and W. W. Kay. 1996. The location of four fimbrin-encoding genes, agfA, fimA, sefA, and sefD, on the Salmonella enteritidis and/or S. typhimurium XbaI-BlnI genomic restriction maps. Gene 169:75-80[Medline]. |
| 9. |
Collinson, S. K.,
P. C. Doig,
J. L. Doran,
S. C. Clouthier,
T. J. Trust, and W. W. Kay.
1993.
Thin aggregative fimbriae mediate binding of Salmonella enteritidis to fibronectin.
J. Bacteriol.
175:12-18 |
| 10. |
Collinson, S. K.,
L. Emödy,
K.-H. Müller,
T. J. Trust, and W. W. Kay.
1991.
Purification and characterization of thin, aggregative fimbriae from Salmonella enteritidis.
J. Bacteriol.
173:4773-4781 |
| 11. | Doran, J. L., S. K. Collinson, S. C. Clouthier, T. A. Cebula, W. H. Koch, J. Burian, P. A. Banser, E. C. D. Todd, and W. W. Kay. 1996. Diagnostic potential of sefA DNA probes to Salmonella enteritidis and certain other O-serogroup D1 Salmonella serovars. Mol. Cell. Probes 10:233-246[Medline]. |
| 12. | Doran, J. L., S. K. Collinson, C. M. Kay, P. A. Banser, J. Burian, C. K. Munro, S. H. Lee, J. M. Somers, E. C. D. Todd, and W. W. Kay. 1994. fimA and tct based DNA diagnostics for Salmonella. Mol. Cell. Probes 8:291-310[Medline]. |
| 13. |
Evans, D. G.,
D. J. Evans, Jr., and W. Tjoa.
1977.
Hemagglutination of human group A erythrocytes by enterotoxigenic Escherichia coli isolated from adults with diarrhea: correlation with colonization factor.
Infect. Immun.
18:330-337 |
| 14. |
Feutrier, J.,
W. W. Kay, and T. J. Trust.
1986.
Purification and characterization of fimbriae from Salmonella enteritidis.
J. Bacteriol.
168:221-227 |
| 15. | Fourney, R. M., J. Miyakoshi, R. S. Kay III, and M. C. Paterson. 1992. Northern blotting: efficient RNA staining and transfer. Focus 10:5-7. |
| 16. |
Fournier, M. J., and H. Ozeki.
1985.
Structure and organization of the transfer ribonucleic acid genes of Escherichia coli K-12.
Microbiol. Rev.
49:379-397 |
| 17. | Gally, D. L., J. Leathart, and I. C. Blomfield. 1996. Interaction of FimB and FimE with the fim switch that controls the phase variation of type 1 fimbriae in Escherichia coli K-12. Mol. Microbiol. 21:725-738[Medline]. |
| 18. | Garcia, G. M., P. K. Mar, D. A. Mullin, J. R. Walker, and N. E. Prather. 1986. The E. coli dnaY gene encodes an arginine transfer RNA. Cell 45:453-459[Medline]. |
| 19. |
Gauss, D. H., and M. Sprinzl.
1983.
Compilation of tRNA sequences.
Nucleic Acids Res.
11:1-53 |
| 20. | Hacker, J., G. Blum-Oehler, I. Mühldorfer, and H. Tschäpe. 1997. Pathogenicity islands of virulent bacteria: structure, function and impact on microbial evolution. Mol. Microbiol. 23:1089-1097[Medline]. |
| 21. |
Hawley, D. K., and W. R. McClure.
1983.
Compilation and analysis of Escherichia coli promoter DNA sequences.
Nucleic Acids Res.
11:2237-2255 |
| 22. | Ikemura, T. 1981. Correlation between the abundance of Escherichia coli transfer RNAs and the occurrence of the respective codons in its protein genes: a proposal for synonymous codon choice that is optimal for the E. coli translational system. J. Mol. Biol. 151:389-409[Medline]. |
| 23. | Ikemura, T. 1981. Correlation between the abundance of Escherichia coli transfer RNAs and the occurrence of the respective codons in its protein genes. J. Mol. Biol. 146:1-21[Medline]. |
| 24. | Klemm, P. 1986. Two regulatory fim genes, fimB and fimE, control the phase variation of type 1 fimbriae in Escherichia coli. EMBO J. 5:1389-1393[Medline]. |
| 25. |
Lindsey, D. F.,
D. A. Mullin, and J. R. Walker.
1989.
Characterization of the cryptic lambdoid prophage DLP12 of Escherichia coli and overlap of the DLP12 integrase gene with the tRNA gene argU.
J. Bacteriol.
171:6197-6205 |
| 26. |
Marck, C.
1988.
"DNA Strider": a "C" program for the fast analysis of DNA and protein sequences on the Apple Macintosh family of computers.
Nucleic Acids Res.
16:1829-1836 |
| 27. |
McClain, M. S.,
I. C. Blomfield, and B. I. Eisenstein.
1991.
Roles of fimB and fimE in site-specific DNA inversion associated with phase variation of type 1 fimbriae in Escherichia coli.
J. Bacteriol.
173:5308-5314 |
| 28. |
McCormick, J. R.,
J. M. Zengel, and L. Lindahl.
1991.
Intermediates in the degradation of mRNA from the lactose operon of Escherichia coli.
Nucleic Acids Res.
19:2767-2776 |
| 29. | Morschhauser, J., V. Vetter, L. Emody, and J. Hacker. 1994. Adhesin regulatory genes within large, unstable DNA regions of pathogenic Escherichia coli: cross-talk between different adhesin gene clusters. Mol. Microbiol. 11:555-566[Medline]. |
| 30. |
Müller, K.-H.,
S. K. Collinson,
T. J. Trust, and W. W. Kay.
1991.
Type 1 fimbriae of Salmonella enteritidis.
J. Bacteriol.
173:4765-4772 |
| 31. | Mullin, D. A., G. M. Garcia, and J. R. Walker. 1984. An E. coli DNA fragment 118 base pairs in length provides dnaY+ complementing activity. Cell 37:669-674[Medline]. |
| 32. |
Newman, J. V.,
R. L. Burghoff,
L. Pallesen,
K. A. Krogfelt,
C. S. Kristensen,
D. C. Laux, and P. S. Cohen.
1994.
Stimulation of Escherichia coli F-18Col type-1 fimbriae synthesis by leuX.
FEMS Microbiol. Lett.
122:281-287[Medline].
|
| 33. |
Reiter, W.-D.,
P. Palm, and S. Yeats.
1989.
Transfer RNA genes frequently serve as integration sites for prokaryotic genetic elements.
Nucleic Acids Res.
17:1907-1914 |
| 34. | Rich, A., and U. L. RajBhandary. 1976. Transfer RNA: molecular structure, sequence, and properties. Annu. Rev. Biochem. 45:805-860[Medline]. |
| 35. | Ritter, A., D. L. Gally, P. B. Olsen, U. Dobrindt, A. Friedrich, P. Klemm, and J. Hacker. 1997. The Pai-associated leuX specific tRNALeu affects type 1 fimbriation in pathogenic Escherichia coli by control of FimB recombinase expression. Mol. Microbiol. 25:871-882[Medline]. |
| 36. | Rosner, J. L. 1972. Formation, induction and curing of bacteriophage P1 lysogens. Virology 48:679[Medline]. |
| 37. | Saier, M. H., Jr. 1995. Differential codon usage: a safeguard against inappropriate expression of specialized genes? FEBS Lett. 362:1-4[Medline]. |
| 38. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. . Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 39. | Swenson, D. L., and S. Clegg. 1994. Salmonella fimbriae, p. 105-113. In P. Klemm (ed.), Fimbriae: adhesion, biogenesis, genetics and vaccines. CRC Press, London, United Kingdom. |
| 40. | Swenson, D. L., K.-J. Kim, E. W. Six, and S. Clegg. 1994. The gene fimU affects expression of Salmonella typhimurium type 1 fimbriae and is related to the Escherichia coli tRNA gene argU. Mol. Gen. Genet. 244:216-218[Medline]. |
| 41. |
Swenson, D. L., and S. Clegg.
1992.
Identification of ancillary fim genes affecting fimA expression in Salmonella typhimurium.
J. Bacteriol.
174:7697-7704 |
| 42. |
Travers, A. A.
1984.
Conserved features of coordinately regulated E. coli promoters.
Nucleic Acids Res.
12:2605-2618 |
| 43. |
Travers, A. A.
1980.
Promoter sequence for stringent control of bacterial ribonucleic acid synthesis.
J. Bacteriol.
141:973-976 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»