Previous Article | Next Article ![]()
J Bacteriol, February 1998, p. 885-891, Vol. 180, No. 4
Department of Bacteriology, University of
Wisconsin
Received 5 September 1997/Accepted 6 December 1997
Thiamine pyrophosphate is an essential cofactor that is synthesized
de novo in Salmonella typhimurium. The biochemical steps and gene products involved in the conversion of aminoimidazole ribotide
(AIR), a purine intermediate, to the 4-amino-5-hydroxymethyl-2-methyl pyrimidine (HMP) moiety of thiamine have yet to be elucidated. We have
isolated mutations in a new locus (Escherichia coli open reading frame designation yojK) at 49 min on the S. typhimurium chromosome. Two significant phenotypes associated
with lesions in this locus (apbE) were identified. First,
apbE purF double mutants require thiamine, specifically the
HMP moiety. Second, in the presence of adenine, apbE single
mutants require thiamine, specifically both the HMP and the thiazole
moieties. Together, the phenotypes associated with apbE
mutants suggest that flux through the purine pathway has a role in
regulating synthesis of the thiazole moiety of thiamine and are
consistent with ApbE being involved in the conversion of AIR to HMP.
The product of the apbE gene was found to be a 36-kDa
membrane-associated lipoprotein, making it the second membrane protein
implicated in thiamine synthesis.
An efficient metabolism demands
productive interactions between a number of biochemical pathways of
both high and low carbon flux. Low-flux pathways, such as those
required for vitamin synthesis, provide a sensitive model system for
addressing subtle pathway interactions. Recent work with
Salmonella typhimurium and Escherichia coli has
shown that the synthesis of at least some vitamins, such as cobalamin
(28), pyridoxal phosphate (21, 22), and thiamine (8, 13, 14, 34), is highly regulated and involves input from
multiple pathways involved in other aspects of cell metabolism. Our
interest lies in identifying metabolic connections which influence thiamine synthesis.
The synthesis of thiamine pyrophosphate requires the condensation
of two independently synthesized moieties,
4-amino-5-hydroxymethyl-2-methyl pyrimidine (HMP) and
4-methyl-5-(
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The apbE Gene Encodes a Lipoprotein
Involved in Thiamine Synthesis in Salmonella
typhimurium
Madison, Madison, Wisconsin 53706
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-hydroxyethyl) thiazole (THZ) (Fig.
1). Although the biochemical steps
for the synthesis of HMP from the purine intermediate aminoimidazole
ribotide (AIR) and the independent synthesis of the thiazole moiety
have yet to be fully elucidated, a number of genetic loci that are
required for thiamine synthesis have been identified (17, 23, 31, 33). The majority of these loci have been implicated in synthesis of the thiazole moiety of thiamine or the condensation of HMP and THZ.
A single locus (thiC) that is required for HMP synthesis has
been identified, although recently mutations in three loci which
conditionally affect the synthesis of the pyrimidine moiety have been
identified (3, 26). Analysis of one such locus (apbC) led to a model proposing redundant pathways for the
conversion of AIR to HMP (26). Such a model is consistent
with the growing class of conditional HMP auxotrophs. The role of ThiC
in this conversion is unclear at this point.

View larger version (15K):
[in a new window]
FIG. 1.
Schematic representation of the purine and thiamine
biosynthetic pathways. Some purine gene products are indicated above
the reactions they catalyze. Proposed pathways with an unknown number
of reactions are indicated (shaded arrows). ApbE, RseC (3),
and ApbC (26) are in paratheses to reflect proposed roles in
synthesis of HMP. Abbreviations: PRA, phosphoribosylamine; HMP-PP, HMP
pyrophosphate; THZ-P, thiazole phosphate.
We report here the identification of a new locus, apbE, which falls in the class of loci conditionally required for the synthesis of HMP. The apbE gene product was found to be a membrane-associated lipoprotein, and mutants with a defect in this locus have a conditional requirement for HMP. Possible explanations for the involvement of a lipoprotein in the biosynthesis of thiamine are discussed.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains, media, and chemicals. All strains used in this study are derivatives of S. typhimurium LT2 and are listed with their genotypes in Table 1. MudJ is used throughout this paper to refer to the Mud d1734 insertion element (6), and Tn10d(Tc) refers to the transposition-defective mini-Tn10 described by Way et al. (32). NCE medium supplemented with MgSO4 (1 mM) (9) and a carbon source (11 mM) was used as minimal medium. Difco nutrient broth (8 g/liter) with NaCl (5 g/liter) added was used as rich medium. Difco BiTek agar was added to a final concentration of 1.5% for solid medium. Unless otherwise stated, the final concentrations of adenine and thiamine were 0.4 mM and 100 nM, respectively. The final concentrations of antibiotics in rich and minimal media, respectively, were as follows (in micrograms per milliliter): tetracycline, 20 and 10; kanamycin, 50 and 125; ampicillin, 30 and 15; and chloramphenicol, 20 and 4.
|
Transduction methods. The high-frequency generalized transducing mutant of bacteriophage P22 (HT105/1 int-201) (29) was used in all transductional crosses. The method for transduction and subsequent purification of transductants has been previously described (11).
Isolation of apbE mutants. Insertions causing a thiamine auxotrophy in a purF mutant were isolated by insertion mutagenesis using one of two defective transposons, Tn10d(Tc) or MudJ, as has been described elsewhere (26). After reintroduction of these insertions into DM1936 (purF) and confirmation of an appropriate phenotype, genetic linkage groups were determined. One linkage group contained one MudJ and two Tn10d(Tc) insertions and defined a new locus, which we designated apbE.
Molecular biology techniques. (i) Identification of apbE. The identity of the apbE locus was determined by converting apbE27::MudJ into either a MudP-P22 or a MudQ-P22 locked-in prophage (5). Standard P22 techniques were used to amplify the nucleotide sequences that flanked the MudP or MudQ insertion (36). Primers specific to the ends of Mud (7) were used to sequence this enriched preparation of chromosomal DNA with a Sequitherm cycle sequencing kit from Epicentre Technologies Corporation (Madison, Wis.). [32P]ATP had a specific activity of >6,000 Ci/mol (Dupont, Beverly, Mass.). Computational analysis of the sequence was performed by using BLAST (Basic Local Alignment Search Tool) and the GenBank and Swissprot databases (1).
(ii) Cloning and sequencing of apbE.
The relative
positions of the two Tn10d(Tc) insertions in the
apbE gene were determined by PCR amplification with a
Thermolyne Temp-Tronic Thermocycler and Vent exonuclease
(exo) from New England Biolabs and primers designed from the
sequences of Salmonella typhi ompC (primer 1, 5'
TATTCCGGCGTACAAATA 3'), S. typhimurium ada (primer 3, 5' GACGGGATCCTTGCGTTTTAATTCTTATCGC 3'), the two loci that
flank the apbE locus, and a primer specific to the ends of
the Tn10d(Tc) insertion (primer 2, 5'
GACAAGATGTGTATCCACCTTAAC 3'). Primers 1 and 3 were then used to
amplify the apbE gene from the wild-type (LT2) S. typhimurium chromosome. The resulting 1.15-kb fragment was ligated
into pSU19 which had been digested with HincII to yield
pApbE1. Plasmids were introduced into strains by electroporation with
an E. coli Pulser (Bio-Rad Laboratories, Hercules, Calif.). The sequence of the apbE gene was determined by
fluorescent-dye nucleotide sequence analysis performed by the
University of Wisconsin
Madison Biotechnology Sequencing Center with
primers specific to the M13 multiple cloning site of pSU19.
(iii) Overexpression and lipoprotein analysis.
A 1.15-kb
HindIII-EcoRI fragment from pApbE1 that
contained the apbE gene was cloned into the pT7-5
overexpression vector so that the apbE gene was in the
correct orientation to be transcribed by the T7 promoter
(30), yielding the construct pApbE3. The pApbE3 construct
was electroporated into E. coli BL21(DE3), which contains an
isopropyl-
-D-thiogalactopyranoside (IPTG)-inducible copy
of the T7 RNA polymerase gene. Visualization of the apbE gene product was achieved by [35S]methionine (specific
activity, 1,000 Ci/mmol; New England Nuclear, Du Pont Co., Boston,
Mass.) labeling of the overexpressed product by the coupled T7 RNA
polymerase-T7 promoter method (30). Labeled protein products
were analyzed by 0.1% sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) (15% polyacrylamide) with the MiniProtean electrophoresis system (Bio-Rad Laboratories) and were visualized with
a phosphorimager.
Phenotypic characterization. The phenotypes of apbE mutants were assessed by growth curves for liquid and solid media as previously described (26). The growth rate, µ, of liquid cultures was determined by the equation µ = ln(XT/X0)/T, where X is A650 and T equals time. In the case of solid medium, soft-agar overlays were used and the compounds to be tested were spotted in the following amounts: thiamine, 20 nmol in 2 µl; THZ, 20 nmol in 2 µl; HMP, 20 nmol in 2 µl; and tyrosine, 80 nmol in 5 µl. The plates were incubated overnight at 37°C before growth was scored.
Nucleotide sequence accession number. The sequence of apbE has been submitted to GenBank with accession no. AF035376.
| |
RESULTS |
|---|
|
|
|---|
Isolation of apbE mutants. In order to define genetic loci involved in the synthesis of HMP, mutant hunts were performed to identify insertions that prevented thiamine synthesis in a purF mutant background when gluconate was used as the sole carbon source. Mutations affecting other branches of thiamine synthesis were eliminated by screening prospective mutants for their ability to grow on a variety of carbon sources when supplemented with adenine and HMP. The carbon sources tested included glucose, gluconate, fructose, and glycerol. A series of mutant hunts identified a number of insertions causing the desired phenotype. Linkage analysis determined that the mutations of three phenotypically similar mutants were transductionally linked. These three insertions [apbE13::Tn10d(Tc), apbE42::Tn10d(Tc), and apbE27::MudJ] defined the apbE locus.
Identification of the apbE locus. In order to identify the locus disrupted by the above insertions, the MudJ insertion in DM764 (apbE27::MudJ) was converted into MudP-P22 and MudQ-P22 derivatives and flanking sequences were amplified as has been described previously (5, 36). The nucleotide sequences adjacent to the MudJ insertion were determined by using primers specific to the ends of MudP and MudQ. When the amino acid sequences predicted from these sequences were compared with available database sequences, similarity to the amino acid sequence of YojK, a hypothetical protein encoded by an open reading frame between ompC and ada at 49 min on the E. coli chromosome, was revealed (Fig. 2).
|
Cloning and sequencing of the apbE locus. To facilitate identification of the role of its gene product in the synthesis of HMP, the nucleotide sequence of the apbE locus in S. typhimurium was determined. The apbE gene from LT2 was amplified with primers 1 and 3 (Fig. 2), and the fragment was ligated into pSU19. The resulting construct, designated pApbE1 (Fig. 2), was electroporated into strains DM763 (purF apbE27::MudJ), DM907 [purF apbE13::Tn10d(Tc)], and DM908 [purF apbE42::Tn10d(Tc)]. In each of the resulting strains, wild-type growth was restored on minimal gluconate medium supplemented with 0.4 mM adenine.
After complementation tests verified that pApbE1 contained the desired fragment, the nucleotide sequence of the entire fragment was determined by dye termination sequencing using primers specific to the M13 multiple cloning site of the parent plasmid, pSU19. Since pApbE1 contained a single gene and complemented all defects caused by the apbE insertions, we concluded that the lesions in this gene were solely responsible for the phenotypes associated with apbE mutations.ApbE is a lipoprotein. To confirm that apbE produced the predicted protein product, we cloned the insert from pApbE1 into pT7-5, resulting in pApbE3, which contained the insert in the correct orientation to express apbE from the T7 promoter. This plasmid and an insertless control were electroporated into E. coli BL21(DE3), which generated strains DM3196 and DM3407, respectively. These two strains were then subjected to a protocol inducing T7-specific expression (30). Following induction in the presence of [35S]methionine, proteins from the crude extracts were resolved by SDS-PAGE and visualized with a phosphorimager. Two insert-specific products of approximately 38 and 36 kDa were revealed, as shown in Fig. 3A, lanes 1 and 2.
|
Evidence for cross-talk between the THZ and HMP pathways.
As
expected from the design of the mutant hunts, apbE
insertions in a purF2085 background required either thiamine
or HMP. A purF apbE strain grew in minimal gluconate medium
with adenine at a specific growth rate of <0.1 h
1,
compared to 0.6 h
1 for the parent purF strain.
When thiamine was added to the medium, the two strains grew equally
well (i.e., 0.6 h
1).
|
|
-carbon and amino group to the
thiazole moiety (Fig. 1). Null mutants defective in three of the four
loci implicated in thiazole synthesis (thiG,
thiH, and thiI) were then tested individually for
nutritional correction by tyrosine. Each of these mutants was found to
specifically require thiazole (data not shown). However, consistent
with other similarities to apbE mutants, the thiazole
requirement of apbC mutants could be satisfied by tyrosine.
If ApbE were essential for the formation of HMP, mutants would be
expected to absolutely require the HMP moiety of thiamine, regardless
of the carbon source or any additional requirement (e.g., thiazole). In
addition to the phenotypes described above, we found that a
purE insertion mutation eliminated the HMP requirement of
strain DM908 (purF apbE), as was shown previously for
apbC mutants (26). This result was illustrated by
the specific growth rates of <0.1 and 0.55 h
1 for DM908
(purF apbE) and DM3146 (purF apbE purE),
respectively, on adenine gluconate medium. In the case of
apbC, this suppression was attributed to the accumulation of
AIR, which could then be used by a redundant step(s) for HMP synthesis
(26). Consistent with this scenario was the finding that in
a wild-type (i.e., PurF+) background, a purE
mutation suppressed the HMP requirement of an apbE mutant,
but thiazole was still required for growth. This result was found for
all growth media on which the apbE mutant alone required HMP
and THZ, i.e., fructose as the sole carbon source, or addition of
exogenous adenine (data not shown). The above phenotypes suggested a
regulatory interaction between the biosynthetic pathways for HMP and
THZ and were consistent with the previously proposed model for dual
pathways for the conversion of AIR to HMP (26).
| |
DISCUSSION |
|---|
|
|
|---|
Although the synthesis of thiamine by microorganisms has been studied for several decades, our understanding of the genes, their products, and the biochemistry involved remains incomplete. It is clear that the synthesis of HMP and THZ precedes their condensation and subsequent phosphorylation to thiamine pyrophosphate, but relatively few details about the formation of the two moieties are known.
The contributions of this paper to the understanding of thiamine synthesis in S. typhimurium include the following. (i) A new locus, apbE, whose gene product is involved in synthesis of the pyrimidine moiety of thiamine has been identified. (ii) Phenotypic analysis of apbE mutants suggested that metabolic interactions occur between the HMP and THZ biosynthetic pathways and that this interaction depends on flux through the purine pathway. (iii) The biochemical characterization of the apbE gene product as a lipoprotein suggests that thiamine synthesis may involve other membrane-associated proteins.
The apbE locus is involved in HMP synthesis. Phenotypically, apbE mutants are similar to apbC mutants (26). The thiamine requirement of both purF apbE and purF apbC mutants is satisfied by HMP or thiamine. This phenotypic analysis suggests a role for both of these gene products in thiamine synthesis, specifically in synthesis of the HMP moiety. The role of ApbE (and ApbC) in thiamine synthesis is likely to be complementary and not essential, for the following reasons. First, the HMP requirement caused by insertions in apbE (in either a wild-type or a purF background) can be suppressed with the introduction of a purE mutation. Since PurE is involved in carboxylation of AIR to carboxyaminoimidazole ribotide (24), a purE mutant would be expected to accumulate AIR. The accumulation of AIR allows HMP synthesis to occur independently of ApbE and ApbC, consistent with the possibility of a second mechanism for the conversion of AIR to HMP, a pathway that requires elevated levels of AIR. A conditional role for ApbE (and ApbC) in thiamine synthesis is supported by the finding that insertion mutations in apbE (and apbC) cause a thiamine requirement that is carbon source specific in a wild-type genetic background, whereas insertion mutations in dedicated thiamine biosynthetic genes (i.e., thiE) cause an absolute thiamine requirement.
We presume that the growth conditions that alter the thiamine requirement of the apbE mutant strains, i.e., adenine and the carbon source, so by affecting the function of one of the pathways for the conversion of AIR to HMP. The mechanism and target for such regulation are not yet understood. In addition, the placement of ThiC in the context of the two-pathway model is not clear. We suggest that ThiC serves a nonredundant role in the latter part of the pathway, and experiments to address this prediction are under way.Metabolic cross-talk between THZ and HMP biosynthetic
pathways.
The observation that apbE and apbC
mutants (purF+) required both moieties of
thiamine (HMP and thiazole) was surprising, considering the presumed
independence of the two biosynthetic pathways (Fig. 1). Because a
purF apbE strain no longer required thiazole for growth, it
appeared that the coordination of thiazole and HMP synthesis involved
flux through the purine pathway. One possible explanation of these
phenotypes is that an apbE mutation results in the
accumulation of an HMP biosynthetic intermediate that inhibits thiazole
synthesis. Less of this intermediate would accumulate when AIR
synthesis is reduced by disrupting flux through the purine biosynthetic
pathway (with a purF mutation). The observation that exogenously added tyrosine could satisfy the thiazole requirement of
apbE mutants may indicate that the point of inhibition in
the thiazole biosynthetic pathway is at the step where the
-carbon and amino group of tyrosine are incorporated into the forming thiazole
ring. In this model, exogenous tyrosine would overcome this inhibition
by driving the proposed reaction.
ApbE is a lipoprotein. From the results presented here, we concluded that ApbE is a lipoprotein, and on the basis of sequence conservation, we predicted that it sorts to the inner membrane. However, because overexpression of membrane proteins often results in an accumulation of the protein in the inner membrane (35), conclusive evidence supporting the localization of ApbE in the inner membrane would require the detection of wild-type ApbE by antibody analysis.
The identification of the apbE gene product as a lipoprotein complicates the assignment of a role for ApbE in HMP synthesis. Although biochemical steps for the conversion of AIR to HMP have been proposed, there are no functions obviously attributable to any of the gene products implicated in this pathway. Comparisons of the ApbE sequence with available sequences revealed that the C-terminal two-thirds of RnfF from Rhodobacter capsulatus is highly similar to ApbE (30% identical and 50% similar). This finding may provide a clue to the function of ApbE in S. typhimurium. The RnfF protein in R. capsulatus has been implicated as a membrane anchor that supports a protein complex that might use a chemical gradient to drive a reverse electron flux from some unknown substrate (perhaps NADH) to ferredoxins serving as electron donors to nitrogenase (20). Interestingly, the N-terminal 177 amino acids of RnfF show homology (28% identity and 52% similarity) to RseC, an inner membrane protein that is a regulator of E
E activity in E. coli (10). The
similarity of RseC to RnfF is particularly intriguing since RseC has
also been implicated in the synthesis of HMP in S. typhimurium (3). The similarity of both RseC and ApbE
to RnfF offers the possibility that RseC and ApbE might be associated
in a membrane-bound complex and, together with other, unknown proteins,
contribute to the synthesis of the pyrimidine ring of thiamine. In
addition, the recent finding that ApbE is involved in cell aggregation
and pattern formation indicates that ApbE may be multifunctional,
perhaps suggesting additional interactions between quorum sensing and
control of metabolism (4). Future work will determine if
there exists a membrane complex that is involved in thiamine synthesis.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by Hatch grant WIS3734 from the U.S. Department of Agriculture and by NIH grant GM47296 to D.M.D.
We thank Leslie Petersen for the preliminary characterization of the HMP and THZ requirements of apbE and apbC mutants and Masatoshi Inukai at Sankyo Co., Ltd., Tokyo, Japan, for providing globomycin.
| |
FOOTNOTES |
|---|
*
Corresponding author. Mailing address: University of
Wisconsin
Madison, 1550 Linden Dr., Madison, WI 53706. Phone: (608)
265-4630. Fax: (608) 262-9685. E-mail:
Downs{at}macc.wisc.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline]. |
| 2. | Bartolomé, B., Y. Jubete, E. Martínez, and F. de la Cruz. 1991. Construction and properties of a family of pACYC184-derived cloning vectors compatible with pBR322 and its derivatives. Gene 102:75-78[Medline]. |
| 3. |
Beck, B.,
L. Connolly,
A. De Las Peñas, and D. Downs.
1997.
Evidence that rseC, a gene in the rpoE cluster, has a role in thiamine synthesis in Salmonella typhimurium.
J. Bacteriol.
179:6504-6508 |
| 4. | Beck, G., Y. Blat, and M. Eisenbach. 1997. Personal communication. |
| 5. |
Benson, N. P., and B. S. Goldman.
1992.
Rapid mapping in Salmonella typhimurium with Mud-P22 prophages.
J. Bacteriol.
174:1673-1681 |
| 6. |
Castilho, B. A.,
P. Olfson, and M. J. Casadaban.
1984.
Plasmid insertion mutagenesis and lac gene fusion with mini Mu bacteriophage transposons.
J. Bacteriol.
158:488-495 |
| 7. |
Chen, P.,
M. Ailion,
N. Weyland, and J. Roth.
1995.
The end of the cob operon: evidence that the last gene (cobT) catalyzes synthesis of the lower ligand of vitamin B12, dimethylbenzimidazole.
J. Bacteriol.
177:1461-1469 |
| 8. | Christian, T., and D. M. Downs. Unpublished data. |
| 9. | Davis, R. W., D. Botstein, and J. R. Roth. 1980. . Advanced bacterial genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 10. |
De Las Peñas, A.,
L. Connolly, and C. A. Gross.
1997.
The E-mediated response to extracytoplasmic stress in Escherichia coli is transduced by RseA and RseB, two negative regulators of sE.
Mol. Microbiol.
24:373-385[Medline].
|
| 11. |
Downs, D. M.
1992.
Evidence for a new, oxygen-regulated biosynthetic pathway for the pyrimidine moiety of thiamine in Salmonella typhimurium.
J. Bacteriol.
174:1515-1521 |
| 12. |
Downs, D. M., and J. R. Roth.
1991.
Synthesis of thiamine in Salmonella typhimurium independent of the purF function.
J. Bacteriol.
173:6597-6604 |
| 13. |
Enos-Berlage, J. L., and D. M. Downs.
1996.
Involvement of the oxidative pentose phosphate pathway in thiamine biosynthesis in Salmonella typhimurium.
J. Bacteriol.
178:1476-1479 |
| 14. |
Enos-Berlage, J. L., and D. M. Downs.
1997.
Mutations in sdh (succinate dehydrogenase genes) alter the thiamine requirement of Salmonella typhimurium.
J. Bacteriol.
179:3989-3996 |
| 15. |
Fernandez, D.,
T. T. Dang,
G. M. Spudich,
X. Zhou,
B. R. Berger, and P. J. Christie.
1996.
The Agrobacterium tumefaciens virB7 gene product, a proposed component of the T-complex transport apparatus, is a membrane-associated lipoprotein exposed at the periplasmic surface.
J. Bacteriol.
178:3156-3167 |
| 16. | Hayashi, S., and H. Wu. 1990. Lipoproteins in bacteria. J. Bioenerget. Biomembranes 22:451-471[Medline]. |
| 17. |
Imamura, N., and H. Nakayama.
1982.
thiK and thiL loci of Escherichia coli.
J. Bacteriol.
151:708-717 |
| 18. | Inukai, M., M. Takeuchi, K. Shimizu, and M. Arau. 1978. Mechanism of action of globomycin. J. Antibiot. 31:1203-1205[Medline]. |
| 19. |
Jung, J. U.,
C. Guttierrez, and M. R. Villarejo.
1989.
Sequence of an osmotically inducible lipoprotein gene.
J. Bacteriol.
171:511-520 |
| 20. | Klipp, W. 1997. Personal communication. |
| 21. |
Lam, H. M., and M. E. Winkler.
1990.
Metabolic relationships between pyridoxine (vitamin B6) and serine biosynthesis in Escherichia coli K-12.
J. Bacteriol.
172:6518-6528 |
| 22. |
Man, T. K.,
G. Zhao, and M. E. Winkler.
1996.
Isolation of a pdxJ point mutation that bypasses the requirement for the PdxH oxidase in pyridoxal 5'-phosphate coenzyme biosythesis in Escherichia coli K-12.
J. Bacteriol.
178:2445-2449 |
| 23. |
Mizote, T., and H. Nakayama.
1989.
The thiM locus and its relation to phosphorylation of hydroxethylthiazole in Escherichia coli.
J. Bacteriol.
171:3228-3232 |
| 24. | Mueller, E. J., E. Meyer, J. Rudolf, V. J. Davisson, and J. Stubbe. 1994. N-5-Carboxyaminoimidazole ribonucleotide: evidence for a new intermediate and two new enzymatic activities in the de novo purine biosynthetic pathway of Escherichia coli. Biochemistry 33:2269-2278[Medline]. |
| 25. | Petersen, L. 1996. Unpublished results. |
| 26. |
Petersen, L., and D. M. Downs.
1996.
Mutations in apbC (mrp) prevent function of the alternative pyrimidine biosynthetic pathway in Salmonella typhimurium.
J. Bacteriol.
178:5676-5682 |
| 27. |
Pugsley, A. P.
1993.
The complete general secretory pathway in gram-negative bacteria.
Microbiol. Rev.
57:50-108 |
| 28. | Rondon, M. R., J. R. Trzebiatowski, and J. C. Escalante-Semerena. 1997. Biochemistry and molecular genetics of cobalamin biosynthesis. Prog. Nucleic Acid Res. Mol. Biol. 56:347-384[Medline]. |
| 29. | Schmieger, H. 1972. Phage P22 mutants with increased or decreased transduction abilities. Mol. Gen. Genet. 119:75-88[Medline]. |
| 30. | Tabor, S. 1990. Expression using the T7 RNA polymerase/promoter system, p. 16.2.1-16.2.11. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. Wiley, New York, N.Y. |
| 31. |
Vander Horn, P. B.,
A. D. Backstrom,
V. Stewart, and T. P. Begley.
1993.
Structural genes for thiamine biosynthetic enzymes (thiCEFGH) in Escherichia coli K-12.
J. Bacteriol.
175:982-992 |
| 32. | Way, J. C., M. A. Davis, D. Morisato, D. E. Roberts, and N. Kleckner. 1984. New Tn10 derivatives for transposon mutagenesis and for construction of lacZ operon fusions by transposition. Gene 32:369-379[Medline]. |
| 33. |
Webb, E.,
K. Claas, and D. Downs.
1997.
Characterization of thiI, a new gene involved in thiazole biosynthesis in Salmonella typhimurium.
J. Bacteriol.
179:4399-4402 |
| 34. |
Webb, E.,
F. Febres, and D. M. Downs.
1996.
Thiamine pyrophosphate negatively regulates transcription of some thi genes of Salmonella typhimurium.
J. Bacteriol.
178:2533-2538 |
| 35. | Yamaguchi, K., F. Yu, and M. Inouye. 1988. A single amino acid determinant of the membrane localization of lipoproteins in E. coli. Cell 53:423-432[Medline]. |
| 36. |
Youderian, P.,
P. Sugiono,
K. L. Brewer,
N. P. Higgins, and T. Elliot.
1988.
Packaging specific segments of the Salmonella chromosome with locked-in Mud-P22 prophages.
Genetics
118:581-592 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»