INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

An efficient metabolism demands productive interactions between a number of biochemical pathways of both high and low carbon flux. Low-flux pathways, such as those required for vitamin synthesis, provide a sensitive model system for addressing subtle pathway interactions. Recent work with Salmonella typhimurium and Escherichia coli has shown that the synthesis of at least some vitamins, such as cobalamin (28), pyridoxal phosphate (21, 22), and thiamine (8, 13, 14, 34), is highly regulated and involves input from multiple pathways involved in other aspects of cell metabolism. Our interest lies in identifying metabolic connections which influence thiamine synthesis.

The synthesis of thiamine pyrophosphate requires the condensation of two independently synthesized moieties, 4-amino-5-hydroxymethyl-2-methyl pyrimidine (HMP) and 4-methyl-5-(-hydroxyethyl) thiazole (THZ) (Fig. 1). Although the biochemical steps for the synthesis of HMP from the purine intermediate aminoimidazole ribotide (AIR) and the independent synthesis of the thiazole moiety have yet to be fully elucidated, a number of genetic loci that are required for thiamine synthesis have been identified (17, 23, 31, 33). The majority of these loci have been implicated in synthesis of the thiazole moiety of thiamine or the condensation of HMP and THZ. A single locus (thiC) that is required for HMP synthesis has been identified, although recently mutations in three loci which conditionally affect the synthesis of the pyrimidine moiety have been identified (3, 26). Analysis of one such locus (apbC) led to a model proposing redundant pathways for the conversion of AIR to HMP (26). Such a model is consistent with the growing class of conditional HMP auxotrophs. The role of ThiC in this conversion is unclear at this point.

View larger version (15K): [in this window] [in a new window]   FIG. 1.   Schematic representation of the purine and thiamine biosynthetic pathways. Some purine gene products are indicated above the reactions they catalyze. Proposed pathways with an unknown number of reactions are indicated (shaded arrows). ApbE, RseC (3), and ApbC (26) are in paratheses to reflect proposed roles in synthesis of HMP. Abbreviations: PRA, phosphoribosylamine; HMP-PP, HMP pyrophosphate; THZ-P, thiazole phosphate.

We report here the identification of a new locus, apbE, which falls in the class of loci conditionally required for the synthesis of HMP. The apbE gene product was found to be a membrane-associated lipoprotein, and mutants with a defect in this locus have a conditional requirement for HMP. Possible explanations for the involvement of a lipoprotein in the biosynthesis of thiamine are discussed.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Strains, media, and chemicals. All strains used in this study are derivatives of S. typhimurium LT2 and are listed with their genotypes in Table 1. MudJ is used throughout this paper to refer to the Mud d1734 insertion element (6), and Tn10d(Tc) refers to the transposition-defective mini-Tn10 described by Way et al. (32). NCE medium supplemented with MgSO₄ (1 mM) (9) and a carbon source (11 mM) was used as minimal medium. Difco nutrient broth (8 g/liter) with NaCl (5 g/liter) added was used as rich medium. Difco BiTek agar was added to a final concentration of 1.5% for solid medium. Unless otherwise stated, the final concentrations of adenine and thiamine were 0.4 mM and 100 nM, respectively. The final concentrations of antibiotics in rich and minimal media, respectively, were as follows (in micrograms per milliliter): tetracycline, 20 and 10; kanamycin, 50 and 125; ampicillin, 30 and 15; and chloramphenicol, 20 and 4. 

Transduction methods. The high-frequency generalized transducing mutant of bacteriophage P22 (HT105/1 int-201) (29) was used in all transductional crosses. The method for transduction and subsequent purification of transductants has been previously described (11).

Isolation of apbE mutants. Insertions causing a thiamine auxotrophy in a purF mutant were isolated by insertion mutagenesis using one of two defective transposons, Tn10d(Tc) or MudJ, as has been described elsewhere (26). After reintroduction of these insertions into DM1936 (purF) and confirmation of an appropriate phenotype, genetic linkage groups were determined. One linkage group contained one MudJ and two Tn10d(Tc) insertions and defined a new locus, which we designated apbE.

Molecular biology techniques. (i) Identification of apbE. The identity of the apbE locus was determined by converting apbE27::MudJ into either a MudP-P22 or a MudQ-P22 locked-in prophage (5). Standard P22 techniques were used to amplify the nucleotide sequences that flanked the MudP or MudQ insertion (36). Primers specific to the ends of Mud (7) were used to sequence this enriched preparation of chromosomal DNA with a Sequitherm cycle sequencing kit from Epicentre Technologies Corporation (Madison, Wis.). [³²P]ATP had a specific activity of >6,000 Ci/mol (Dupont, Beverly, Mass.). Computational analysis of the sequence was performed by using BLAST (Basic Local Alignment Search Tool) and the GenBank and Swissprot databases (1).

(ii) Cloning and sequencing of apbE. The relative positions of the two Tn10d(Tc) insertions in the apbE gene were determined by PCR amplification with a Thermolyne Temp-Tronic Thermocycler and Vent exonuclease (exo) from New England Biolabs and primers designed from the sequences of Salmonella typhi ompC (primer 1, 5' TATTCCGGCGTACAAATA 3'), S. typhimurium ada (primer 3, 5' GACGGGATCCTTGCGTTTTAATTCTTATCGC 3'), the two loci that flank the apbE locus, and a primer specific to the ends of the Tn10d(Tc) insertion (primer 2, 5' GACAAGATGTGTATCCACCTTAAC 3'). Primers 1 and 3 were then used to amplify the apbE gene from the wild-type (LT2) S. typhimurium chromosome. The resulting 1.15-kb fragment was ligated into pSU19 which had been digested with HincII to yield pApbE1. Plasmids were introduced into strains by electroporation with an E. coli Pulser (Bio-Rad Laboratories, Hercules, Calif.). The sequence of the apbE gene was determined by fluorescent-dye nucleotide sequence analysis performed by the University of WisconsinMadison Biotechnology Sequencing Center with primers specific to the M13 multiple cloning site of pSU19.

(iii) Overexpression and lipoprotein analysis. A 1.15-kb HindIII-EcoRI fragment from pApbE1 that contained the apbE gene was cloned into the pT7-5 overexpression vector so that the apbE gene was in the correct orientation to be transcribed by the T7 promoter (30), yielding the construct pApbE3. The pApbE3 construct was electroporated into E. coli BL21(DE3), which contains an isopropyl--D-thiogalactopyranoside (IPTG)-inducible copy of the T7 RNA polymerase gene. Visualization of the apbE gene product was achieved by [³⁵S]methionine (specific activity, 1,000 Ci/mmol; New England Nuclear, Du Pont Co., Boston, Mass.) labeling of the overexpressed product by the coupled T7 RNA polymerase-T7 promoter method (30). Labeled protein products were analyzed by 0.1% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (15% polyacrylamide) with the MiniProtean electrophoresis system (Bio-Rad Laboratories) and were visualized with a phosphorimager.

Phenotypic characterization. The phenotypes of apbE mutants were assessed by growth curves for liquid and solid media as previously described (26). The growth rate, µ, of liquid cultures was determined by the equation µ = ln(X_T/X₀)/T, where X is A₆₅₀ and T equals time. In the case of solid medium, soft-agar overlays were used and the compounds to be tested were spotted in the following amounts: thiamine, 20 nmol in 2 µl; THZ, 20 nmol in 2 µl; HMP, 20 nmol in 2 µl; and tyrosine, 80 nmol in 5 µl. The plates were incubated overnight at 37°C before growth was scored.

Nucleotide sequence accession number. The sequence of apbE has been submitted to GenBank with accession no. AF035376.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Isolation of apbE mutants. In order to define genetic loci involved in the synthesis of HMP, mutant hunts were performed to identify insertions that prevented thiamine synthesis in a purF mutant background when gluconate was used as the sole carbon source. Mutations affecting other branches of thiamine synthesis were eliminated by screening prospective mutants for their ability to grow on a variety of carbon sources when supplemented with adenine and HMP. The carbon sources tested included glucose, gluconate, fructose, and glycerol. A series of mutant hunts identified a number of insertions causing the desired phenotype. Linkage analysis determined that the mutations of three phenotypically similar mutants were transductionally linked. These three insertions [apbE13::Tn10d(Tc), apbE42::Tn10d(Tc), and apbE27::MudJ] defined the apbE locus.

Identification of the apbE locus. In order to identify the locus disrupted by the above insertions, the MudJ insertion in DM764 (apbE27::MudJ) was converted into MudP-P22 and MudQ-P22 derivatives and flanking sequences were amplified as has been described previously (5, 36). The nucleotide sequences adjacent to the MudJ insertion were determined by using primers specific to the ends of MudP and MudQ. When the amino acid sequences predicted from these sequences were compared with available database sequences, similarity to the amino acid sequence of YojK, a hypothetical protein encoded by an open reading frame between ompC and ada at 49 min on the E. coli chromosome, was revealed (Fig. 2).

View larger version (12K): [in this window] [in a new window]   FIG. 2.   Relative positions of insertions that define the apbE gene. The physical organization of insertions in the apbE gene at 49 min is represented. The amino acid sequence of ApbE adjacent to the MudJ insertion is compared to the amino acid sequence of the E. coli homolog. Primers used in PCR and/or sequencing analysis are indicated (small arrows). The positions of the Tn10d(Tc) insertions were determined by amplification with primer 1 or 3 and primers specific to the ends of the insertion elements. Primers 1 and 3 were used to amplify the gene from the chromosome for cloning and determination of its nucleotide sequence.

Cloning and sequencing of the apbE locus. To facilitate identification of the role of its gene product in the synthesis of HMP, the nucleotide sequence of the apbE locus in S. typhimurium was determined. The apbE gene from LT2 was amplified with primers 1 and 3 (Fig. 2), and the fragment was ligated into pSU19. The resulting construct, designated pApbE1 (Fig. 2), was electroporated into strains DM763 (purF apbE27::MudJ), DM907 [purF apbE13::Tn10d(Tc)], and DM908 [purF apbE42::Tn10d(Tc)]. In each of the resulting strains, wild-type growth was restored on minimal gluconate medium supplemented with 0.4 mM adenine.

ApbE is a lipoprotein. To confirm that apbE produced the predicted protein product, we cloned the insert from pApbE1 into pT7-5, resulting in pApbE3, which contained the insert in the correct orientation to express apbE from the T7 promoter. This plasmid and an insertless control were electroporated into E. coli BL21(DE3), which generated strains DM3196 and DM3407, respectively. These two strains were then subjected to a protocol inducing T7-specific expression (30). Following induction in the presence of [³⁵S]methionine, proteins from the crude extracts were resolved by SDS-PAGE and visualized with a phosphorimager. Two insert-specific products of approximately 38 and 36 kDa were revealed, as shown in Fig. 3A, lanes 1 and 2. 

View larger version (56K): [in this window] [in a new window]   FIG. 3.   apbE encodes a lipoprotein. (A) [35S]methionine-labeled ApbE and inhibition of its processing by globomycin as analyzed by SDS-PAGE (15% polyacrylamide). Lane 1, DM3407(pT7-5); lane 2, DM3196(pApbE3); lane 3, DM3196(pApbE3) plus globomycin (200 µg/ml). (B) Membrane-associated ApbE was specifically labeled with [3H]palmitic acid and analyzed by SDS-PAGE (12% polyacrylamide). Lane 1, DM3196(pApbE3); lane 2, DM3407(pT7-5). Molecular mass standards (in kilodaltons) for each gel are indicated.

Evidence for cross-talk between the THZ and HMP pathways. As expected from the design of the mutant hunts, apbE insertions in a purF2085 background required either thiamine or HMP. A purF apbE strain grew in minimal gluconate medium with adenine at a specific growth rate of <0.1 h¹, compared to 0.6 h¹ for the parent purF strain. When thiamine was added to the medium, the two strains grew equally well (i.e., 0.6 h¹).

View larger version (84K): [in this window] [in a new window]   FIG. 4.   Growth requirements of apbE mutants. Soft-agar overlays were performed on minimal medium supplemented with gluconate and adenine as previously described (12). DM271 (apbE) (A) and DM908 (purF apbE) (B) cells were plated. The following compounds were spotted (20 nmol each): a 2-µl sample of thiamine (B1), a 2-µl sample of HMP, and a 2-µl sample of thiazole (THZ).

1

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

Although the synthesis of thiamine by microorganisms has been studied for several decades, our understanding of the genes, their products, and the biochemistry involved remains incomplete. It is clear that the synthesis of HMP and THZ precedes their condensation and subsequent phosphorylation to thiamine pyrophosphate, but relatively few details about the formation of the two moieties are known.

The contributions of this paper to the understanding of thiamine synthesis in S. typhimurium include the following. (i) A new locus, apbE, whose gene product is involved in synthesis of the pyrimidine moiety of thiamine has been identified. (ii) Phenotypic analysis of apbE mutants suggested that metabolic interactions occur between the HMP and THZ biosynthetic pathways and that this interaction depends on flux through the purine pathway. (iii) The biochemical characterization of the apbE gene product as a lipoprotein suggests that thiamine synthesis may involve other membrane-associated proteins.

The apbE locus is involved in HMP synthesis. Phenotypically, apbE mutants are similar to apbC mutants (26). The thiamine requirement of both purF apbE and purF apbC mutants is satisfied by HMP or thiamine. This phenotypic analysis suggests a role for both of these gene products in thiamine synthesis, specifically in synthesis of the HMP moiety. The role of ApbE (and ApbC) in thiamine synthesis is likely to be complementary and not essential, for the following reasons. First, the HMP requirement caused by insertions in apbE (in either a wild-type or a purF background) can be suppressed with the introduction of a purE mutation. Since PurE is involved in carboxylation of AIR to carboxyaminoimidazole ribotide (24), a purE mutant would be expected to accumulate AIR. The accumulation of AIR allows HMP synthesis to occur independently of ApbE and ApbC, consistent with the possibility of a second mechanism for the conversion of AIR to HMP, a pathway that requires elevated levels of AIR. A conditional role for ApbE (and ApbC) in thiamine synthesis is supported by the finding that insertion mutations in apbE (and apbC) cause a thiamine requirement that is carbon source specific in a wild-type genetic background, whereas insertion mutations in dedicated thiamine biosynthetic genes (i.e., thiE) cause an absolute thiamine requirement.

Metabolic cross-talk between THZ and HMP biosynthetic pathways. The observation that apbE and apbC mutants (purF⁺) required both moieties of thiamine (HMP and thiazole) was surprising, considering the presumed independence of the two biosynthetic pathways (Fig. 1). Because a purF apbE strain no longer required thiazole for growth, it appeared that the coordination of thiazole and HMP synthesis involved flux through the purine pathway. One possible explanation of these phenotypes is that an apbE mutation results in the accumulation of an HMP biosynthetic intermediate that inhibits thiazole synthesis. Less of this intermediate would accumulate when AIR synthesis is reduced by disrupting flux through the purine biosynthetic pathway (with a purF mutation). The observation that exogenously added tyrosine could satisfy the thiazole requirement of apbE mutants may indicate that the point of inhibition in the thiazole biosynthetic pathway is at the step where the -carbon and amino group of tyrosine are incorporated into the forming thiazole ring. In this model, exogenous tyrosine would overcome this inhibition by driving the proposed reaction.

ApbE is a lipoprotein. From the results presented here, we concluded that ApbE is a lipoprotein, and on the basis of sequence conservation, we predicted that it sorts to the inner membrane. However, because overexpression of membrane proteins often results in an accumulation of the protein in the inner membrane (35), conclusive evidence supporting the localization of ApbE in the inner membrane would require the detection of wild-type ApbE by antibody analysis.