Previous Article | Next Article 
J Bacteriol, February 1998, p. 998-1001, Vol. 180, No. 4
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Identification of the Fucose Synthetase Gene in the
Colanic Acid Gene Cluster of Escherichia coli K-12
Kanella
Andrianopoulos,
Lei
Wang, and
Peter R.
Reeves*
Department of Microbiology, The University of
Sydney, Sydney, New South Wales 2006, Australia
Received 23 October 1997/Accepted 10 December 1997
 |
ABSTRACT |
GDP-L-fucose, the substrate for fucosyltransferases
for addition of fucose to polysaccharides or glycoproteins in both
procaryotes and eucaryotes, is made from GDP-D-mannose.
L-Fucose is a component of bacterial surface antigens,
including the extracellular polysaccharide colanic acid produced by
most Escherichia coli strains. We previously sequenced the
E. coli colanic acid gene cluster and identified one of the
GDP-L-fucose biosynthetic pathway genes, gmd.
We report here the identification of the gene (fcl),
located downstream of gmd, encoding the fucose synthetase.
| |
TEXT |
Fucose is quite widely present in
bacterial polysaccharides and eucaryote glycoproteins, and it is known
that GDP-L-fucose is the precursor of such fucose residues
in both bacterial and eucaryote systems. A three-step pathway for
converting GDP-D-mannose to GDP-L-fucose has
been described (Fig. 1) (3).
GDP-mannose dehydratase (GMD) converts GDP-mannose into
GDP-4-keto-6-deoxymannose, the first step of the three-step pathway.
This is followed by epimerase and reductase reaction steps to give
GDP-L-fucose.
Colanic acid (CA) is an extracellular polysaccharide produced by most
Escherichia coli strains, as well as by other species of the
family Enterobacteriaceae (4). It contains
L-fucose, D-glucuronic acid,
D-glucose, D-galactose, and pyruvate (1, 2, 4, 5). We previously sequenced the E. coli K-12 CA gene cluster, which contains 17 genes, and identified some of these
genes (9). GDP-D-mannose is synthesized from
D-mannose-6-phosphate by two enzymes encoded by
manB and manC, which are both found in the K-12
CA gene cluster, and we identified a gene, also located in the K-12 CA
gene cluster, which encodes GMD and named it gmd (9). In this study; we identified a gene which is located in the K-12 CA gene cluster and encodes a protein that carries out both
the epimerase and reductase reaction steps for
GDP-L-fucose synthesis.
Cloning of the potential gene for the last two steps of
GDP-L-fucose synthesis.
The genes for synthesis of a
nucleotide sugar precursor are generally clustered together within the
gene cluster for the particular bacterial polysaccharide
(8). In the CA gene cluster of E. coli K-12,
manC is followed by manB, as is common for this
pair of genes, while gmd and manC are separated
by three open reading frames (ORFs) (Fig.
2), and we therefore looked at these ORFs for the gene(s) encoding the remaining steps in the synthesis of
GDP-L-fucose. One of them, wcaG, encodes a
protein which shares 53% similarity with the human FX protein
(11), which has been shown to carry out the last two steps
to convert GDP-4-keto-6-deoxy-D-mannose to
GDP-L-fucose (Fig. 3).
View larger version (9K):
[in this window]
[in a new window]
|
FIG. 2.
Organization of the GDP-L-fucose
biosynthetic pathway genes of the K-12 CA gene cluster. The potential
Shine-Dalgarno sequence upstream of gmd is shown as a black
dot, and the insert of plasmid pPR1875 is also indicated. The arrows
indicate the direction of transcription.
|
|
View larger version (59K):
[in this window]
[in a new window]
|
FIG. 3.
Alignment of FX protein with amino acid sequences of Fcl
proteins from the E. coli K-12 CA gene cluster (Ec_CA
[WcaG]), the E. coli O157 O-antigen gene cluster (Ec_O157
[Orf8]), and the O-antigen cluster of Y. enterocolitica O8
(Ye_O8 [WbcJ]). Positions where more than 50% of the sequences have
identical amino acids are shaded.
|
|
K-12 CA DNA from positions 8621 to 10722, carrying both
gmd
and
wcaG, was PCR amplified by using
oligonucleotides 861 (5' GAGGAATAATCCATGGCAAAAGTCGC) and
1057 (5' TAAAGGTACCTTACCCCCGAAAGCGGTC).
gmd
starts at position
8633 with the potential Shine-Dalgarno sequence
located from positions
8622 to 8625.
The PCR product was directly cloned into pGEM-T to make plasmid
pPR1857, in which
gmd and
wcaG are under the
control of the
T7 phage promoter of the vector. Plasmids pPR1857 and
pGP1-2 (encoding
the T7 RNA polymerase gene [
10]) were
cotransformed into K-12
strain SØ874 (Table
1), which lacks both O-antigen and CA
gene
clusters, to make strain P5470. The expression of both the
gmd and
wcaG genes was confirmed by inducing the
expression of the
T7 RNA polymerase gene and
[
35S]methionine labelling of GMD and WcaG (data not
shown).
wcaG (fcl) encodes the fucose
synthetase.
We assayed the synthesis of GDP-L-fucose
from GDP-D-mannose by the cell lysate of P5470 and
detected the conversion of GDP-D-mannose to
GDP-L-fucose by high-pressure liquid chromatography (HPLC) and thin-layer chromatography (TLC). Cell lysates were prepared as
previously described (9). The reactions were carried out at
37°C for 90 min as described by Tonetti et al. (11), and the incubation mixture contained 50 µM Tris-HCl (pH 8.0), 5 µM MgCl2, 0.2 µM NAD+, 0.2 µM NADPH, 5 µM
ATP, and 10 µM nicotinamide in a total volume of 1 ml with 400 µl
of cell lysate (7.4 mg of protein per ml) and 0.025 µCi of
GDP-[U-14C]mannose as the substrate. The reaction was
stopped by heating for only 20 s at 100°C to reduce the amount
of degradation (6).
HPLC was carried out as described by Martin et al. (
6). A
0.1-ml volume of 1 M sodium perchlorate (pH 4.1) was added to
0.2 ml of
the reaction mixture, which was incubated for 15 min
before the
addition of 0.2 ml of 1 M potassium acetate. The samples
were then
subjected to a freeze-thaw cycle and centrifuged to
achieve complete
precipitation of potassium perchlorate. A 200-µl
volume of the
supernatant was filtered and injected onto a reverse-phase
C
18 octyldecyl silane-224 Spheri-5 (220 by 4.6 mm) column
(Brownlee
Labs) with 0.5 M KH
4PO
4 (pH 4.6) as
the mobile phase at a 0.8-ml/min
flow rate and 25°C. Fractions (0.4 ml) of the eluate were collected,
and the radioactivity was measured in
a MINAXI liquid scintillation
counter. The results are shown in Fig.
4. A reaction mixture without
the cell
lysate but subjected to incubation and 100°C treatment
is shown in
Fig.
4C, and a reaction mixture with
GDP-
L-[
14C]fucose substituted for
GDP-[U-
14C]mannose is shown in Fig.
4D.
GDP-
D-[U-
14C]mannose and
GDP-
L-[U-
14C]fucose were used as standards
for HPLC (data not shown) and
gave the same major peaks as in Fig.
4C
and D, respectively.
View larger version (12K):
[in this window]
[in a new window]
|
FIG. 4.
Identification of 14C-labelled
GDP-L-fucose (peak 3) and GDP-D-mannose (peak
2) by HPLC on a C18 column. A, reaction product obtained by
using the cell lysate of P5282. B, reaction product obtained by using
the cell lysate of P5470. C and D, 14C-labelled
GDP-D-mannose and GDP-L-fucose treated the
same way as in A and B but without addition of the cell lysate. The
data presented is from a representative experiment.
|
|
The conversion of GDP-[U-
14C]mannose (peak 2) to
GDP-
L-[
14C]fucose (peak 3) by the cell
lysate of P5470 is shown in Fig.
4B. Peak
1 represents the chemically
and enzymatically degraded product
of GDP-
D-mannose:
GDP-
D-mannose was degraded to produce a small
amount of
material in peak 1 when no cell lysate was present in
the incubation
mixture (Fig.
4C) or the reaction was stopped immediately
after
addition of the cell lysate (data not shown), while after
incubation
with the cell lysate for 90 min, about twice that amount
of material
was produced (Fig.
4A [note the different scales for
counts per
minute]). A reaction mixture containing a cell lysate
of strain P5282
(SØ874 carrying pGEM-T and pGP1-2) was used as
a control and was
not able to convert GDP-[U-
14C]mannose to
GDP-
L-[
14C]fucose (Fig.
4A).
To further confirm the identity of the reaction product, TLC analysis
of the monosaccharides derived by acid hydrolysis of
the nucleoside
diphosphate sugars was carried out. Aliquots (1
ml) of the reaction
mixture or nucleoside diphosphate sugar standards
were hydrolyzed by
addition of 100 µl of 2 N HCl and incubation
at 100°C for 20 min,
followed by neutralization with 100 µl of
2 N NaOH and desalting with
an Amberlite MB20 column before being
freeze-dried. Samples were then
resuspended in 30 µl of water
and spotted on silica gel 60 TLC plates
which had been pretreated
with 0.1 M
Na
2S
2O
5 and 0.009 M sodium citrate,
pH 4.8, and dried
at 120°C for 30 min. As shown in Fig.
5, the sample from P5470
had both fucose
and mannose while the sample from P5282 had only
mannose.
View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5.
TLC analysis of the 14C-labelled
monosaccharides obtained by acid hydrolysis of the nucleoside
diphosphate sugars in the reaction products of P5282 (A) and P5470 (B).
14C-labelled GDP-D-mannose (C) and
GDP-L-fucose (D) were hydrolyzed and used as standards.
Authentic unlabelled fucose and mannose were also used as standards
(data not shown). TLC was carried out on a Merck silica plate (20 by 20 cm) with a solvent comprising 50 ml of n-butanol, 30 ml of
pyridine, and 20 ml of 0.1 M HCl. The plate was then dried, the
distribution of radioactivity was quantified by using a PhosphorImager
400B (Molecular Dynamics), and the data was analyzed by using the
Molecular Dynamic ImageQuant software package. The plots show relative
pixel values for radioactively labelled sugars obtained from the
PhosphorImager.
|
|
The results show that a clone carrying
gmd and
wcaG confers the ability to synthesize GDP-fucose from
GDP-mannose, and we
conclude that
wcaG encodes an enzyme
which resembles its human
homolog, FX, in being able to catalyze the
two steps required
to convert GDP-4-keto-6-deoxymannose to
GDP-
L-fucose. We therefore
renamed the gene
fcl.
We are aware that we have not demonstrated directly that Fcl carries
out each of the two reactions (reactions 2 and 3 of Fig.
1) and that it
is formally possible that it carries out only one
of the reactions
while the other is carried out by a protein present
in
E. coli K-12 strain SØ874. However, strain SØ874 has a deletion
which extends to
dcd (
7) and so will lack both
O-antigen and
CA clusters, including the
gmd and
fcl genes of the CA gene cluster
and the
manB and
manC genes of both the CA and O-antigen gene
clusters. It
would be remarkable if this strain carried a gene
for just one step of
the five-step pathway for synthesis of GDP-fucose
from
D-mannose-6-phosphate. We feel confident that all four
steps
are encoded in the CA gene cluster and that Fcl must have both
functions.
We know of three sequenced gene clusters for bacterial polysaccharides
which contain fucose, i.e., those for CA, the
E. coli O157
cluster (
11a), and the O-antigen cluster of
Yersinia
enterocolitica O8 (
12). All three clusters contain
manB,
manC,
gmd, and
fcl genes, as judged by sequence similarities (Fig.
3), but no other
genes
are common to all three. This provides strong supporting
evidence for
the assignment of
fcl, and we suggest that
wbcJ
of
Y. enterocolitica O8 should therefore be known as
fcl. The function(s)
of the two remaining genes between
fcl and
manC is unknown, but
it is of interest
that one of them,
wbdQ, is a homolog of
wcaH in
the
E. coli O157 cluster (
11a), where it is again
immediately
after
fcl, but in this case there is no gene
between it and
manC.
| |
ACKNOWLEDGMENTS |
We thank Darryl Nelson and Trevor Duxbury for discussions
and help with HPLC.
This work was supported by a grant from the Australian Research
Council.
| |
FOOTNOTES |
*
Corresponding
author. Mailing address: Department of Microbiology, The University of
Sydney, Sydney, New South Wales 2006, Australia. Phone: (612) 9351 2536. Fax: (612) 9351 4571. E-mail: reeves{at}angis.su.oz.au.
| |
REFERENCES |
| 1.
|
Anderson, E. S., and A. H. Rogers.
1963.
Slime polysaccharide of the Enterobacteriaceae.
Nature
198:714-715.
|
| 2.
|
Garegg, P. J.,
B. Lindberg,
T. Onn, and I. W. Sutherland.
1971.
Comparative structural studies on the M-antigen from Salmonella typhimurium, Escherichia coli and Aerobacter cloacae.
Acta Chem. Scand.
25:2103-2108[Medline].
|
| 3.
|
Ginsburg, V.
1961.
Studies of the biosynthesis of guanosine diphosphate L-fucose.
J. Biol. Chem.
236:2389-2393[Free Full Text].
|
| 4.
|
Grant, W. D.,
I. W. Sutherland, and J. F. Wilkinson.
1969.
Exopolysaccharide colanic acid and its occurrence in the Enterobacteriaceae.
J. Bacteriol.
100:1187-1193[Abstract/Free Full Text].
|
| 5.
|
Markovitz, A.
1977.
Genetics and regulation of bacterial capsular polysaccharide synthesis and radiation sensitivity, p. 415-462. In
I. W. Sutherland (ed.), Surface carbohydrates of the prokaryotic cell, vol. I.
Academic Press, Inc., New York, N.Y.
|
| 6.
|
Martin, A.,
D. Ruggiero-Lopez,
P. Broquet,
M. Richard, and P. Louisot.
1989.
High-performance liquid chromatographic study of GDP-mannose and GDP-fucose metabolism.
J. Chromatogr.
497:319-325[Medline].
|
| 7.
|
Neuhard, J., and E. Thomassen.
1976.
Altered deoxyribonucleotide pools in P2 eductants of Escherichia coli K-12 due to deletion of the dcd gene.
J. Bacteriol.
126:999-1001[Abstract/Free Full Text].
|
| 8.
|
Reeves, P. R.
1994.
Biosynthesis and assembly of lipopolysaccharide.
New Compr. Biochem.
27:281-314.
|
| 9.
|
Stevenson, G.,
K. Andrianopoulos,
H. Hobbs, and P. R. Reeves.
1996.
Organization of the Escherichia coli K-12 gene cluster responsible for production of the extracellular polysaccharide colanic acid.
J. Bacteriol.
178:4885-4893[Abstract/Free Full Text].
|
| 10.
|
Tabor, S., and C. C. Richardson.
1985.
A bacteriophage T7 RNA polymerase promoter system for controlled exclusive expression of specific genes.
Proc. Natl. Acad. Sci. USA
82:1074-1078[Abstract/Free Full Text].
|
| 11.
|
Tonetti, M.,
L. Sturla,
A. Bisso,
U. Benatti, and A. De Flora.
1996.
Synthesis of GDP-L-fucose by the human FX protein.
J. Biol. Chem.
271:27274-27279[Abstract/Free Full Text].
|
| 11a.
| Wang, L., and P. R. Reeves. Unpublished data.
|
| 12.
|
Zhang, L.,
J. Radziejewska-Lebrecht,
D. Krajewska-Pietrasik,
P. Toivanen, and M. Skurnik.
1997.
Molecular and chemical characterization of the lipopolysaccharide O-antigen and its role in the virulence of Yersinia enterocolitica serotype O8.
Mol. Microbiol.
23:63-76[Medline].
|
J Bacteriol, February 1998, p. 998-1001, Vol. 180, No. 4
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Miyamoto, Y., Mukai, T., Maeda, Y., Nakata, N., Kai, M., Naka, T., Yano, I., Makino, M.
(2007). Characterization of the Fucosylation Pathway in the Biosynthesis of Glycopeptidolipids from Mycobacterium avium Complex. J. Bacteriol.
189: 5515-5522
[Abstract]
[Full Text]
-
Coyne, M. J., Reinap, B., Lee, M. M., Comstock, L. E.
(2005). Human Symbionts Use a Host-Like Pathway for Surface Fucosylation. Science
307: 1778-1781
[Abstract]
[Full Text]
-
Eckstein, T. M., Belisle, J. T., Inamine, J. M.
(2003). Proposed pathway for the biosynthesis of serovar-specific glycopeptidolipids in Mycobacterium avium serovar 2. Microbiology
149: 2797-2807
[Abstract]
[Full Text]
-
Sampaio, M.-M., Santos, H., Boos, W.
(2003). Synthesis of GDP-Mannose and Mannosylglycerate from Labeled Mannose by Genetically Engineered Escherichia coli without Loss of Specific Isotopic Enrichment. Appl. Environ. Microbiol.
69: 233-240
[Abstract]
[Full Text]
-
Struve, C., Forestier, C., Krogfelt, K. A.
(2003). Application of a novel multi-screening signature-tagged mutagenesis assay for identification of Klebsiella pneumoniae genes essential in colonization and infection. Microbiology
149: 167-176
[Abstract]
[Full Text]
-
Jiang, S.-M., Wang, L., Reeves, P. R.
(2001). Molecular Characterization of Streptococcus pneumoniae Type 4, 6B, 8, and 18C Capsular Polysaccharide Gene Clusters. Infect. Immun.
69: 1244-1255
[Abstract]
[Full Text]
-
Coyne, M. J., Kalka-Moll, W., Tzianabos, A. O., Kasper, D. L., Comstock, L. E.
(2000). Bacteroides fragilis NCTC9343 Produces at Least Three Distinct Capsular Polysaccharides: Cloning, Characterization, and Reassignment of Polysaccharide B and C Biosynthesis Loci. Infect. Immun.
68: 6176-6181
[Abstract]
[Full Text]
-
Tarr, P. I., Schoening, L. M., Yea, Y.-L., Ward, T. R., Jelacic, S., Whittam, T. S.
(2000). Acquisition of the rfb-gnd Cluster in Evolution of Escherichia coli O55 and O157. J. Bacteriol.
182: 6183-6191
[Abstract]
[Full Text]
-
Mattila, P., Rabina, J., Hortling, S., Helin, J., Renkonen, R.
(2000). Functional expression of Escherichia coli enzymes synthesizing GDP-L-fucose from inherent GDP-D-mannose in Saccharomyces cerevisiae. Glycobiology
10: 1041-1047
[Abstract]
[Full Text]
-
Wang, L., Reeves, P. R.
(2000). The Escherichia coli O111 and Salmonella enterica O35 Gene Clusters: Gene Clusters Encoding the Same Colitose-Containing O Antigen Are Highly Conserved. J. Bacteriol.
182: 5256-5261
[Abstract]
[Full Text]
-
Albermann, C., Distler, J., Piepersberg, W.
(2000). Preparative synthesis of GDP-{beta}-L-fucose by recombinant enzymes from enterobacterial sources. Glycobiology
10: 875-881
[Abstract]
[Full Text]
-
Comstock, L. E., Coyne, M. J., Tzianabos, A. O., Pantosti, A., Onderdonk, A. B., Kasper, D. L.
(1999). Analysis of a Capsular Polysaccharide Biosynthesis Locus of Bacteroides fragilis. Infect. Immun.
67: 3525-3532
[Abstract]
[Full Text]
-
Wang, L., Curd, H., Qu, W., Reeves, P. R.
(1998). Sequencing of Escherichia coli O111 O-Antigen Gene Cluster and Identification of O111-Specific Genes. J. Clin. Microbiol.
36: 3182-3187
[Abstract]
[Full Text]
-
Berlyn, M. K. B.
(1998). Linkage Map of Escherichia coli K-12, Edition 10: The Traditional Map. Microbiol. Mol. Biol. Rev.
62: 814-984
[Abstract]
[Full Text]
-
Wang, L., Reeves, P. R.
(1998). Organization of Escherichia coli O157 O Antigen Gene Cluster and Identification of Its Specific Genes. Infect. Immun.
66: 3545-3551
[Abstract]
[Full Text]
Top
Abstract
Text
