Previous Article | Next Article 
J Bacteriol, March 1998, p. 1110-1118, Vol. 180, No. 5
Department of Biomedical Sciences,
Received 15 August 1997/Accepted 26 December 1997
The majority of isolates of Burkholderia cepacia, an
important opportunistic pathogen associated with cystic fibrosis, can be classified into two types on the basis of flagellin protein size.
Electron microscopic analysis indicates that the flagella of strains
with the larger flagellin type (type I) are wider in diameter.
Flagellin genes representative of both types were cloned and sequenced
to design oligonucleotide primers for PCR amplification of the central
variable domain of B. cepacia flagellin genes. PCR-restriction fragment length polymorphism analysis of amplified B. cepacia flagellin gene products from 16 strains
enabled flagellin type classification on the basis of product size and
revealed considerable differences in sequence, indicating that the
flagellin gene is a useful biomarker for epidemiological and
phylogenetic studies of this organism.
Burkholderia
cepacia (formerly Pseudomonas cepacia; a member
of the rRNA group II pseudomonads) has emerged as an increasingly important opportunistic pathogen, particularly in relation to patients
suffering from cystic fibrosis (CF) (15). Acquisition of
B. cepacia, often occurring after lengthy colonization
with Pseudomonas aeruginosa, can lead to the rapid
deterioration or death of CF patients, and this organism appears to be
transmissible between patients (14). There is considerable
evidence that some strains of B. cepacia are more
virulent than others and that the outcome of colonization by a
particular strain can vary from rapidly fatal septicemia to maintenance
of stable respiratory function (16). A number of factors
have been implicated in the greater virulence of some strains. These
include adhesion to respiratory mucin (31, 32) and the
presence of cable pili (33).
Motility in B. cepacia is by means of polar flagella.
Flagella, each consisting of a flagellin filament, hook, and basal
body, have been implicated as invasive virulence factors for a number of bacteria (28), including P. aeruginosa
(11). Unlike P. aeruginosa, which appears to
sit in microcolonies in the viscid mucus, leading to progressive lung
damage with episodes of acute debilitating exacerbation, some strains
of B. cepacia cause rapidly fatal pneumonia in CF
patients (15), suggesting that they may have the ability to
move through the mucus. Because of their location on the outside of
bacterial cells, flagellins have been targeted in vaccine design. Brett
et al. (4) demonstrated that flagellin-specific antisera
were capable of protecting diabetic rats from challenge with strains of
Burkholderia pseudomallei (another member of
rRNA group II). In a recent study, an O-polysaccharide moiety of
B. pseudomallei was covalently linked to
the flagellin protein from the same strain. O-polysaccharide-flagellin
conjugates elicited a high-level immunoglobulin G response capable of
protecting diabetic rats from challenge with a heterologous strain of
B. pseudomallei (5).
Two distinct flagellin protein molecular mass groups in B. cepacia have been reported by Montie and Stover (23).
In this previous study, type I flagellins were reported as having a
molecular mass of 31 kDa while the molecular mass of type II flagellins was reported as 44 to 46 kDa. This early study, using a limited number
of isolates, suggested that with regard to flagellin, B. cepacia is analogous to another CF pathogen, P. aeruginosa, in which two flagellin antigenic types distinguishable
by protein or gene size are found (43). Several
representatives of the heterologous a-type and homologous b-type
fliC loci of P. aeruginosa (encoding
flagellins) have been sequenced (37). In addition, PCR
amplification of flagellin genes coupled with restriction fragment
length polymorphism (RFLP) analysis can be used as a method for
differentiating between clinical isolates of P. aeruginosa (7, 43). In this paper we report the
development of a similar approach to the study of populations of
B. cepacia and discuss the divergence of a highly
variable gene, the flagellin gene (fliC), within populations
of B. cepacia.
Bacterial strains.
The bacterial strains used in this study,
listed in Table 1, are clinical or
botanical isolates. All clinical isolates of B. cepacia
were initially isolated from CF patients by the use of selective media
(Mast Laboratories, Bootle, United Kingdom). Presumptive identification
was accomplished with the API-20NE system (BioMérieux) and
confirmed by the Central Public Health Laboratory Service, Colindale,
London, United Kingdom, using a range of biochemical and molecular
tests, including 16S rRNA sequencing. Several isolates were identified
as the United Kingdom CF epidemic strain (ET12 lineage
[16]) by electrophoretic typing, whole-protein sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and
pyrolysis mass spectroscopy (8). Environmental isolates of
B. cepacia (6) were kindly supplied by J. Govan, University of Edinburgh. Their identity had been established by
comparisons of 16S rRNA sequences. Strains were maintained on nutrient
agar and grown at 30°C.
Flagellin protein isolation and N-terminal sequencing.
Flagellin proteins were isolated by the procedure described by Brett et
al. (4), using 15% (wt/vol) ammonium sulfate to precipitate
the protein, and analyzed by SDS-PAGE on 10% (wt/vol) polyacrylamide
gels. Bio-Rad low-range standards were used as molecular mass markers.
N-terminal sequencing of B. cepacia E243 flagellin
(MLGINSNINSLVAQQNLNGS) and two trypsin digestion-generated products (IGGGLVQKGQTVGTVT and NQVLQQAGI)
was performed by Mark Wilkinson (University of Liverpool,
Liverpool, United Kingdom).
Cloning of B. cepacia E243 and B. cepacia E242 flagellin genes.
Genomic DNA was extracted from
B. cepacia strains as described previously
(42). The N-terminal sequences of the B. cepacia E243 flagellin and the longer of the two internal amino
acid sequences were used to design degenerate primers, obtained from
Genosys, for PCR amplification of a region of fliC. A
combination of the sense primer BC1 (GTIGCICARCARAAYCTIAAYGG)
and the antisense primer BCR2 (CCNACSGTCTGRCCCTTCTG)
was employed to generate an amplified product of approximately
450 bp. One-microliter aliquots of various dilutions of B. cepacia E243 genomic DNA were used directly in 100-µl volumes
containing 2 U of Taq polymerase (Gibco BRL), 200 nM each
primer (BC1 and BCR2), 1× Taq polymerase buffer, 100 µM each deoxynucleoside triphosphate (dATP, dCTP, dGTP, and dTTP), and 1.5 mM MgCl2. Amplifications were carried out in a MiniCycler (Genetic Research Instrumentation Ltd.) for 30 cycles consisting of
denaturation at 95°C (1 min), annealing at 45°C (1.5 min), and
extension at 72°C (1.5 min) with an additional extension period at
72°C (10 min) following completion of the 30 cycles. At the end of
the amplification, 20-µl samples were subjected to electrophoresis on
a standard 1.0% (wt/vol) agarose gel to confirm the presence of an
amplified product. The 450-bp amplified product was purified by the use
of a gel extraction kit (Qiagen) and cloned by using the LigATor kit (R
& D Systems Europe Ltd.). Both strands of three separate clones were
sequenced by the University of Liverpool DNA Sequencing Service, using
vector and internal sequencing primers. A comparison of this sequence
information with sequences in the database confirmed that the PCR
product was part of the flagellin gene. The 450-bp amplified product
was labeled with digoxigenin-11-2'-dUTP (DIG) (Boehringer Mannheim) by
repeating the PCR with 60 µM DIG in a total reaction volume of 50 µl. The labeled product was used as a probe to identify flagellin
gene-containing clones from B. cepacia E243 and
B. cepacia E242 gene libraries constructed from genomic
DNA of these strains by using the SuperCos 1 Cosmid Vector Kit
(Stratagene) under the conditions recommended by the supplier. The
presence of DIG on colony blots was detected by using anti-DIG-alkaline phosphatase Fab fragments and the chemiluminescent substrate CDP-Star (Boehringer Mannheim) in the procedure recommended by the supplier. Smaller flagellin gene-containing fragments, identified by Southern blot analysis of digested cosmid clones, were subcloned into the plasmid vector pUC19 (Life Technologies Ltd.).
Nucleotide sequencing.
DNA was purified from putative
flagellin gene clones by using Qiagen Mini or Midi kits (Qiagen). Both
strands of the B. cepacia E243 and B. cepacia E242 flagellin genes were sequenced by primer walking at
the University of Liverpool DNA Sequencing Service, using vector and
internal oligonucleotide primers. The nucleotide sequence of the
amplified B. cepacia E197 fliC product was
obtained following cloning with a LigATor cloning kit (R & D Systems
Europe Ltd.). The nucleotide sequences of both strands were obtained for three separate clones.
Computer analyses.
Nucleotide sequence alignments, percent
G+C values, determination of amino acid composition, prediction of
protein masses, and alignment of predicted flagellin proteins with each
other or with other flagellins (retrieved from EMBL, GenBank, or
SwissProt [27]) were carried out with GAP,
COMPOSITION, PEPTIDESORT, PILEUP, CONSENSUS, and FASTA from the GCG
sequence analysis software package (Genetics Computer Group,
University of Wisconsin). Phylogenetic analysis was carried out
by aligning the first 100 N-terminal flagellin residues into a multiple
sequence file by using PILEUP. A tree was subsequently
constructed by using the PHYLIP program. Bootstrap values, indicated on
the tree (see Fig. 5), were derived by using 100 alternatives (values
under 50% were omitted).
PCR amplification of B. cepacia flagellin
genes.
Flagellin gene oligonucleotide primers BC4
(CTGGTCGCACAGCAGAACCTGAAC; N terminal) and BCR12
(ACAG/TGTTCGCGGTTTCCTG; C terminal) were obtained from
Genosys (Cambridge, United Kingdom). Cells taken from a nutrient agar
plate were suspended in sterile distilled water and boiled for 5 min.
This lysed suspension (2.5 µl) was used directly in a standard
amplification mixture. Amplifications were carried out in 50-µl
volumes containing 2 U of DynaZyme (Flowgen Instruments Ltd.,
Sittingbourne, Kent, United Kingdom), 200 nM each primer (BC4 and
BCR12), 1× DynaZyme buffer, and 100 µM each deoxynucleoside
triphosphate (dATP, dCTP, dGTP, and dTTP) for 30 cycles consisting of
denaturation at 95°C (1 min), annealing at 60°C (1 min), and
extension at 72°C (2 min).
Restriction digestion of amplified products.
Amplified
product samples (10 µl) were digested with the restriction enzymes
HaeIII and MspI under the conditions recommended by the supplier (Life Technologies Ltd.). These digests were then subjected to electrophoresis on 3% (wt/vol) MetaPhor agarose gels (Flowgen) alongside a PCR size marker (R&D Systems Europe Ltd.; fragment sizes, 50, 150, 300, 500, 750, 1,000, 1,500, and 2,000 bp).
Electron microscopy.
Electron microscopic analysis of
flagella was carried out by procedures described previously
(43). For flagellar width measurements, the widths of three
flagella from one area of a grid were measured three times each. This
was repeated in two additional areas of the grid. Mean width and
standard error (n = 27) were calculated.
Nucleotide sequence accession numbers.
The flagellin gene
sequences for B. cepacia E243, E242, and E197 have been
given GenBank accession no. AF011370, AF011371, and AF011372,
respectively.
Flagellin protein variation in B. cepacia.
SDS-PAGE of flagellin proteins isolated from different strains of
B. cepacia confirmed the presence of two major groups,
based on approximate flagellin sizes: 45-kDa flagellins (type II,
including E243) and 55-kDa flagellins (type I, including E242) (Fig.
1). Flagellin proteins were isolated from
several type I strains and from three type II strains. One strain,
E197, produces a larger flagellin protein (approximately 70 kDa). No
significant size variation within the major groups was observed.
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Variation in Flagellin Genes and Proteins of
Burkholderia cepacia
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
TABLE 1.
Description of B. cepacia strains used in
this study
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
View larger version (94K):
[in a new window]
FIG. 1.
PAGE of B. cepacia flagellins. The
figure shows a 10% (wt/vol) SDS-PAGE gel of flagellin proteins
isolated from strains E197 (lane 2), E195 (lane 3), E245 (lane 4), E244
(lane 5), E243 (lane 6), E242 (lane 7), and E241 (lane 8). Lanes 1 and
9 contain Bio-Rad low-range SDS-PAGE standards; their molecular masses
are indicated on the left.
Electron microscopy. Electron microscopic analysis was used to obtain width measurements for flagella from four strains of B. cepacia. The results obtained for E241 (14.6 ± 0.3 nm), E242 (18.0 ± 0.5 nm), and E243 (14.5 ± 0.3 nm) indicate that the type I flagellum (E242) is significantly wider than the type II flagellum (E241 and E243) (Fig. 2). The flagellar width observed in strain E197 (19.4 ± 0.5 nm) was the largest.
|
DNA sequence analysis of B. cepacia flagellin
genes.
The DIG-labeled flagellin gene probe was used to identify
several hybridizing flagellin gene cosmid clones from clone banks of
both B. cepacia E242 and B. cepacia
E243. A 5-kb SstI fragment of E243 genomic DNA and a 3-kb
SalI fragment of E242 genomic DNA, both identified as
containing the flagellin gene, were subcloned from cosmid clones into
pUC19, and the complete nucleotide sequences of the B. cepacia E242 and B. cepacia E243 flagellin genes
were obtained. The putative transcriptional start site was identified by alignment with other flagellin gene sequences and, following computer-assisted translation to derive a polypeptide
sequence, with the known N-terminal sequence
(MLGINSNINSLVAQQNLNGS). The region immediately upstream from
fliC in B. cepacia E243 was also sequenced
(GenBank accession no. AF011370). The sequence
TAAAGTTN12GCCGAAAT is located upstream from the
transcriptional start site of the B. cepacia E243
flagellin gene, in the same position as an identical sequence
identified as a putative 
F-type promoter in
B. pseudomallei (10).
|
PCR amplification and RFLP analysis of amplified flagellin gene products. Oligonucleotide primers were designed by alignment of Burkholderia flagellin sequences and tested on the 16 B. cepacia isolates. With the exception of strain E197 (1.6-kb product), all strains yielded amplified products of either 1.0 kb (type II) or 1.4 kb (type I). Products could be further distinguished by digestion with restriction enzymes HaeIII and MspI (Fig. 4). The 16 strains of B. cepacia were subdivided into a total of 10 flagellin gene RFLP groups (designated I to X) by this approach (Fig. 4; Table 1).
|
DNA
digested with HindIII and EcoRI (a) or a PCR
marker (b), and amplified DNA from strains representing RFLP groups I
to X (lanes 1 to 10, respectively). The PCR products were undigested
(a) or digested (b) with HaeIII (upper gel) or
MspI (lower gel).
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
The N-terminal sequence of the flagellin protein isolated from B. cepacia E243 was identical to the first 17 residues reported for the N-terminal sequence of B. pseudomallei flagellin (4), confirming that the protein is flagellin and indicating a close relationship between the B. cepacia and B. pseudomallei flagellins. This was subsequently confirmed by comparing the predicted flagellin peptide sequences of two B. cepacia strains with the published sequence of the B. pseudomallei flagellin (10). The three Burkholderia flagellin sequences exhibit high levels of homology in the conserved terminal regions but differ considerably in the central region. This is a common feature of flagellin proteins, which are believed to fold into a hairpin-like conformation, with the terminal domains being responsible for defining the basic filament structure lying on the inner surface and the central, variable region being surface exposed (41). The flagellins of B. cepacia E243 (385 residues) and B. pseudomallei (388 residues) are very similar in length, but the N-terminal methionine residue at position 1 in the purified B. cepacia E243 protein is not present in the B. pseudomallei flagellin (10). The flagellins of strains E242 (505 residues) and E197 include extensive areas in the central region that are not represented in the other two Burkholderia flagellins. A comparison of these central regions with other sequences in the database indicated that they show no significant homology to any previously sequenced protein.
A comparison of the B. cepacia E242 and E243 flagellins with database sequences revealed that the most closely related non-Burkholderia flagellin sequences were representatives of the gamma subclass of the class Proteobacteria. This is in agreement with the phylogenetic analysis of B. pseudomallei reported by DeShazer et al. (10). A dendrogram constructed following alignment of the 100 N-terminal amino acid residues of 27 bacterial flagellin proteins, including B. cepacia E243 and representing 26 different genera, is shown in Fig. 5. The figure shows output typical of several approaches, including both distance-matrix and parsimony analysis, taken to construct a dendrogram. The actual position of B. cepacia is not well supported by bootstrap analysis. However, regardless of the approach taken, B. cepacia does not cluster closely to representatives of any other genera. B. cepacia has been assigned to the beta subdivision of the Proteobacteria (24). The only other flagellin sequence available for a representative of the beta subdivision, Bordetella bronchiseptica, is far more closely related to flagellins obtained from gamma-subdivision proteobacteria (1). More flagellin sequence information for other representatives of the beta subdivision is required to resolve this apparent anomaly, but it may be that Burkholderia spp. flagellins are more representative of beta-subdivision proteobacteria as a whole.
|
Our analyses of SDS-PAGE gels of flagellin proteins suggest that either the previously reported type I flagellin molecular mass of 31 kDa (23) is inaccurate or there are strains of a third major type with a considerably smaller flagellin protein. The latter explanation seems unlikely because of our inability to identify any such strains in this study and because of the tendency for flagellins of the same species to exhibit a higher degree of similarity than such a scenario would allow. Montie and Stover (23) reported the presence of double-banded patterns in the gels of 31-kDa flagellin protein preparations, suggesting that the 31-kDa protein band may be degraded protein or an artifact of the isolation procedure rather than complete flagellin.
The presence of two major flagellar types within populations of B. cepacia suggests analogy with P. aeruginosa, whose type a and type b flagellins can be distinguished by flagellin protein and gene size (43). Southern blot analysis of chromosomal DNA from E242 and E243, digested with several different restriction enzymes and hybridized with flagellin gene probes, leads to single hybridizing bands except for those enzymes for which there is a recognition site within the flagellin gene (data not shown). This suggests that, as in P. aeruginosa, individual strains possess the genetic information required for the production of only one flagellin type. There is no evidence for the kind of phase variation exhibited by strains of Salmonella typhimurium, for which switching between flagellar types can be observed in a single strain (35). Flagella are highly immunogenic and have been shown to undergo recombination to generate antigenic variation in a number of bacteria, including Salmonella spp. (36) and Campylobacter spp. (2), which contain multiple flagellin genes within individual strains. In Campylobacter jejuni, recombinational events following the uptake of exogenous DNA by naturally competent cells has been demonstrated (39). Further antigenic variation may be generated by posttranslational modification (18). Such modifications have also been found in P. aeruginosa flagellins in which phosphorylated tyrosines have been observed (19, 20). P. aeruginosa type a flagellins, despite having conserved gene sizes, are heterogeneous in molecular weight, a characteristic that has been attributed in part to posttranslational modification. We found no evidence for similar variation in either type I or type II flagellins of B. cepacia, although the observed discrepancy between predicted molecular weights and those estimated from SDS-PAGE gels suggests that there may be a limited role for posttranslational modification. However, since there are only one to three tyrosine residues evident in the B. cepacia flagellins, any contribution of tyrosine phosphorylation to the molecular weight would be limited. One B. cepacia isolate, E197, produces an unusually large flagellin protein. A similar finding was reported in a study of P. aeruginosa isolates (43), in which one isolate not conforming to the type a or type b flagellin sizes was observed. It is known that considerable variation in the size of the flagellin central domain can occur without detrimental consequences for the function of flagella. In Escherichia coli K-12, the minimally sized functional flagellin comprises only 310 of the normal 497 residues; the remainder can be deleted or altered without loss of function (21). Although the present study included only 3 representative type I strains and 16 strains in all, we have screened approximately 50 other clinical isolates of B. cepacia for flagellin gene size without successfully identifying a strain with a flagellin similar to that found in B. cepacia E197. This suggests that the fliC gene of strain E197 is exceptional. Our screening indicates that the vast majority of clinical isolates of B. cepacia contain type II flagellins, although the significance of this finding is not clear since there are exceptions to this general rule.
Electron microscopic analysis of representative B. cepacia strains indicates that the flagellar widths of the two major flagellin types differ. The difference in width between type I and type II B. cepacia flagella was greater than the flagellar width difference observed between type a and type b flagella in P. aeruginosa (43).
Although amplification of the flagellin gene by PCR was successful for all 16 B. cepacia strains tested, the amount of product obtained varied. The primers employed (BC4 and BCR12) were designed by comparing the flagellin gene sequences of B. cepacia E243 and B. pseudomallei. There is some degeneracy evident when these primer sequences are compared to the flagellin gene sequence of B. cepacia E242. This may account for the differences in concentrations of the flagellin gene amplified products obtained. It is possible that further fliC sequence data could lead to improved primer design, although the variation exhibited by B. cepacia flagellins may make this impossible. The extent of flagellin sequence variation can be seen from the separation of the 16 B. cepacia isolates tested into 10 RFLP groups on the basis of digests generated by two restriction enzymes. Although seven of the isolates analyzed could not be distinguished, three of them correspond to isolates identified previously as being the major United Kingdom epidemic strain or multilocus enzyme electrophoresis type 12, (ET12 [16]), also known as the Edinburgh/ Toronto lineage (38). We are currently investigating the possibility that the remaining isolates could be further differentiated by employing more enzymes. Butler et al. (6) reported the isolation of 12 B. cepacia environmental isolates, none of which displayed the phenotypic properties of a multiresistant CF epidemic strain with which they were compared. Although current evidence suggests that the environment may pose only a low risk as a source of B. cepacia for CF patients, a more detailed analysis of B. cepacia populations is required.
The flagellin gene is a widely applicable and useful genetic marker for studying variation within populations of closely related bacteria (44). Flagellin gene sequences have been used to study diversity in a number of bacteria, including E. coli (34), Salmonella spp. (22), Campylobacter spp. (3), and Helicobacter pylori (12). Flagellin gene sequence comparisons have been used for phylogenetic analysis of bacterial pathogens such as Borrelia burgdorferi (13) and Listeria monocytogenes (30). It has been suggested that B. cepacia may represent at least three distinct species, and the clarification of Burkholderia taxonomy has been identified as an important step toward the ultimate goal of identifying the pathogenic potential of environmental isolates (16). Flagellin gene RFLP analysis, in conjunction with other methods, may provide a rapid and reliable means to distinguish B. cepacia strains with a view to achieving this goal. A study of larger numbers of isolates, including environmental isolates, and the correlation of flagellin gene RFLP groups with B. cepacia genomovars are required to better assess this possibility.
Flagellin gene sequences have also been shown to serve as sensitive and specific targets for PCR detection or identification of Campylobacter coli and C. jejuni (25), Borrelia spp. (29), Salmonella spp. (40), Listeria spp. (17), and Pseudomonas fluorescens (9). By comparing additional flagellin gene sequences, it may be possible to design similar species-, group-, or strain-specific probes for use with B. cepacia.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by an award to C.W. from The Wellcome Trust (grant 044249/PMG/VW) and by the Biotechnology and Biological Sciences Research Council.
We thank Mark Wilkinson, Angela Bardon, and Angela Rosin for carrying out the sequencing reactions and John Govan (Department of Medical Microbiology, University Medical School, Edinburgh, Scotland, United Kingdom) for providing strains. We also thank Colin Clay at Horticulture Research International for his help with the electron microscopy work. This work benefited from the use of the SEQNET facility, Daresbury, United Kingdom.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biomedical Sciences, University of Bradford, Bradford, West Yorkshire BD7 1DP, United Kingdom. Phone: 44 1274 383561. Fax: 44 1274 309742. E-mail: C.Winstanley{at}bradford.ac.uk.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. |
Akerley, B. J., and J. F. Miller.
1993.
Flagellin gene transcription in Bordetella bronchiseptica is regulated by the BvgAS virulence control system.
J. Bacteriol.
175:3468-3479 |
| 2. |
Alm, R. A.,
P. Guerry,
M. E. Power, and T. J. Trust.
1992.
Variation in antigenicity and molecular weight of Campylobacter coli VC167 flagellin in different genetic backgrounds.
J. Bacteriol.
174:4230-4238 |
| 3. |
Alm, R. A.,
P. Guerry, and T. J. Trust.
1993.
Distribution and polymorphism of the flagellin genes from isolates of Campylobacter coli and Campylobacter jejuni.
J. Bacteriol.
175:3051-3057 |
| 4. |
Brett, P. J.,
D. C. W. Mah, and D. E. Woods.
1994.
Isolation and characterization of Pseudomonas pseudomallei flagellin proteins.
Infect. Immun.
62:1914-1919 |
| 5. | Brett, P. J., and D. E. Woods. 1996. Structural and immunological characterization of Burkholderia pseudomallei O-polysaccharide-flagellin protein conjugates. Infect. Immun. 64:2824-2828[Abstract]. |
| 6. | Butler, S. L., C. J. Doherty, J. E. Hughes, J. W. Nelson, and J. R. W. Govan. 1995. Burkholderia cepacia and cystic fibrosis: do natural environments present a potential hazard? J. Clin. Microbiol. 33:1001-1004[Abstract]. |
| 7. |
Cheng, K.,
R. L. Smyth,
J. R. W. Govan,
C. J. Doherty,
C. Winstanley,
N. Denning,
D. P. Heaf,
R. van Seane, and C. A. Hart.
1996.
Spread of a  -lactam-resistant Pseudomonas aeruginosa in a cystic fibrosis clinic.
Lancet
348:639-642[Medline].
|
| 8. |
Corkill, J. E.,
P. R. Sisson,
A. Smyth,
J. Deveney,
R. Freeman,
P. Shears,
D. Heaf, and C. A. Hart.
1994.
Application of pyrolysis mass spectroscopy and SDS-PAGE in the study of the epidemiology of Pseudomonas cepacia in cystic fibrosis.
J. Med. Microbiol.
41:106-111 |
| 9. | Denning, N., J. A. W. Morgan, J. M. Whipps, J. R. Saunders, and C. Winstanley. 1997. The flagellin gene as a stable marker for detection of Pseudomonas fluorescens SBW25. Lett. Appl. Microbiol. 24:198-202[Medline]. |
| 10. |
DeShazer, D.,
P. J. Brett,
R. Carlyon, and D. E. Woods.
1997.
Mutagenesis of Burkholderia pseudomallei with Tn5-OT182: isolation of motility mutants and molecular characterization of the flagellin structural gene.
J. Bacteriol.
179:2116-2125 |
| 11. |
Drake, D., and T. C. Montie.
1988.
Flagella, motility, and invasive virulence of Pseudomonas aeruginosa.
J. Gen. Microbiol.
134:43-52 |
| 12. | Forbes, K. J., Z. Fang, and T. H. Pennington. 1995. Allelic variation in the Helicobacter pylori flagellin genes flaA and flaB: its consequences for strain typing schemes and population structure. Epidemiol. Infect. 114:257-266[Medline]. |
| 13. |
Fukunaga, M., and Y. Koreki.
1996.
A phylogenetic analysis of Borrelia burgdorferi sensu lato isolates associated with Lyme disease in Japan by flagellin gene sequence determination.
Int. J. Syst. Bacteriol.
46:416-421 |
| 14. | Govan, J. R. W., P. H. Brown, J. Maddison, C. Doherty, J. W. Nelson, M. Dodd, A. P. Greening, and K. Webb. 1993. Evidence for transmission of Pseudomonas cepacia by social contact in cystic fibrosis. Lancet 342:15-19[Medline]. |
| 15. |
Govan, J. R. W., and V. Deretic.
1996.
Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.
Microbiol. Rev.
60:539-574 |
| 16. |
Govan, J. R. W.,
J. E. Hughes, and P. Van Damme.
1996.
Burkholderia cepacia medical, taxonomic and ecological issues.
J. Med. Microbiol.
45:395-407 |
| 17. | Gray, D. I., and R. G. Kroll. 1995. Polymerase chain reaction amplification of the flaA gene for the rapid identification of Listeria spp. Lett. Appl. Microbiol. 20:65-68[Medline]. |
| 18. | Guerry, P., P. Doig, R. A. Alm, D. H. Burr, N. Kinsella, and T. J. Trust. 1996. Identification and characterization of genes required for post-translational modification of Campylobacter coli VC167 flagellin. Mol. Microbiol. 19:369-378[Medline]. |
| 19. |
Kelly-Wintenberg, K.,
T. Anderson, and T. C. Montie.
1990.
Phosphorylated tyrosine in the flagellum filament protein of Pseudomonas aeruginosa.
J. Bacteriol.
172:5135-5139 |
| 20. |
Kelly-Wintenberg, K.,
S. L. South, and T. C. Montie.
1993.
Tyrosine phosphate in a- and b-type flagellins of Pseudomonas aeruginosa.
J. Bacteriol.
175:2458-2461 |
| 21. |
Kuwajima, G.
1988.
Construction of a minimum-size functional flagellin of Escherichia coli.
J. Bacteriol.
170:3305-3309 |
| 22. |
Masten, B. J., and T. M. Joys.
1993.
Molecular analyses of the Salmonella g ... flagellar antigen complex.
J. Bacteriol.
175:5359-5365 |
| 23. |
Montie, T. C., and G. B. Stover.
1983.
Isolation and characterization of flagellar preparations from Pseudomonas species.
J. Clin. Microbiol.
18:452-456 |
| 24. |
Olsen, G. J.,
C. R. Woese, and R. Overbeek.
1994.
The winds of (evolutionary) change: breathing new life into microbiology.
J. Bacteriol.
176:1-6 |
| 25. |
Oyofo, B. A., and D. M. Rollins.
1993.
Efficacy of filter types for detecting Campylobacter jejuni and Campylobacter coli in environmental water samples by polymerase chain reaction.
Appl. Environ. Microbiol.
59:4090-4095 |
| 26. | Palleroni, N. J. 1984. Genus I. Pseudomonas Migula 1894, p. 141-199. In N. R. Kreig, and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 1. The Williams & Wilkins Co., Baltimore, Md. |
| 27. |
Pearson, W. R., and D. J. Lipman.
1988.
Improved tools for biological sequence comparison.
Proc. Natl. Acad. Sci. USA
85:2444-2448 |
| 28. | Penn, C. W., and C. J. Luke. 1992. Bacterial flagellar diversity and significance in pathogenesis. FEMS Microbiol. Lett. 100:331-336. |
| 29. |
Picken, R. N.
1992.
Polymerase chain reaction primers and probes derived from flagellin gene sequences for specific detection of the agents of Lyme disease and North American relapsing fever.
J. Clin. Microbiol.
30:99-114 |
| 30. | Rasmussen, O. F., P. Skouboe, L. Dons, L. Rossen, and J. E. Olsen. 1995. Listeria monocytogenes exists in at least three evolutionary lines: evidence from flagellin, invasive associated protein and listeriolysin O genes. Microbiology 141:2043-2061. |
| 31. | Sajjan, U. S., M. Corey, M. A. Karmali, and J. F. Forstner. 1992. Binding of Pseudomonas cepacia to normal human intestinal mucin and respiratory mucin from patients with cystic fibrosis. J. Clin. Invest. 89:648-656. |
| 32. |
Sajjan, U. S., and J. F. Forstner.
1992.
Identification of the mucin-binding adhesin of Pseudomonas cepacia isolated from patients with cystic fibrosis.
Infect. Immun.
60:1434-1440 |
| 33. |
Sajjan, U. S.,
L. Sun,
R. Goldstein, and J. F. Forstner.
1995.
Cable (Cb1) type II pili of cystic fibrosis-associated Burkholderia (Pseudomonas) cepacia: nucleotide sequence of the cblA major subunit pilin gene and novel morphology of the assembled appendage fibers.
J. Bacteriol.
177:1030-1038 |
| 34. |
Schoenhals, G., and C. Whitfield.
1993.
Comparative analysis of flagellin sequences from Escherichia coli strains possessing serologically distinct flagellar filaments with a shared complex surface pattern.
J. Bacteriol.
175:5395-5402 |
| 35. | Silverman, M., and M. Simon. 1980. Phase variation: genetic analysis of switching mutants. Cell 19:845-854[Medline]. |
| 36. |
Smith, N. H.,
P. Beltran, and R. K. Selander.
1990.
Recombination of Salmonella phase 1 flagellin genes generates new serovars.
J. Bacteriol.
172:2209-2216 |
| 37. | Spangenberg, C., T. Heuer, C. Bürger, and B. Tümmler. 1996. Genetic diversity of flagellins of Pseudomonas aeruginosa. FEBS Lett. 396:213-217[Medline]. |
| 38. |
Sun, L.,
R.-Z. Jiang,
S. Steinbach,
A. Holmes,
C. Campanelli,
J. Forstner,
U. Sajjan,
Y. Tan,
M. Riley, and R. Goldstein.
1995.
The emergence of a highly transmissible lineage of cbl Pseudomonas (Burkholderia) cepacia causing CF centre epidemics in North America and Britain.
Nat. Med.
1:661-666[Medline].
|
| 39. |
Wassenaar, T. M.,
B. N. Fry, and B. A. M. van der Zeijst.
1995.
Variation of the flagellin gene locus of Campylobacter jejuni by recombination and horizontal gene transfer.
Microbiology
141:95-101 |
| 40. |
Way, J. S.,
K. L. Josephson,
S. D. Pillai,
M. Abbaszadegan,
C. P. Gerba, and I. L. Pepper.
1993.
Specific detection of Salmonella spp. by multiplex polymerase chain reaction.
Appl. Environ. Microbiol.
59:1473-1479 |
| 41. | Wilson, D. R., and T. J. Beveridge. 1993. Bacterial flagellar filaments and their component flagellins. Can. J. Microbiol. 39:451-472[Medline]. |
| 42. | Winstanley, C., J. P. Carter, M. Seasman, J. A. W. Morgan, R. W. Pickup, and J. R. Saunders. 1993. A comparison of the survival of stable and unstable chromosomally located xylE marker cassettes as an indicator of cell division within populations of Pseudomonas putida released into lake water and soil. Microb. Releases 2:97-107. |
| 43. |
Winstanley, C.,
M. A. Coulson,
B. Wepner,
J. A. W. Morgan, and C. A. Hart.
1996.
Flagellin gene and protein variation amongst clinical isolates of Pseudomonas aeruginosa.
Microbiology
142:2145-2151 |
| 44. |
Winstanley, C., and J. A. W. Morgan.
1997.
The bacterial flagellin gene as a biomarker for detection, population genetics and epidemiological analysis.
Microbiology
143:3071-3084 |
J Bacteriol, March 1998, p. 1110-1118, Vol. 180, No. 5
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chung, J. W., Speert, D. P.
(2007). Proteomic identification and characterization of bacterial factors associated with Burkholderia cenocepacia survival in a murine host. Microbiology
153: 206-214
[Abstract] [Full Text] -
Urban, T. A., Griffith, A., Torok, A. M., Smolkin, M. E., Burns, J. L., Goldberg, J. B.
(2004). Contribution of Burkholderia cenocepacia Flagella to Infectivity and Inflammation. Infect. Immun.
72: 5126-5134
[Abstract] [Full Text] -
Schonfeld, J., Heuer, H., van Elsas, J. D., Smalla, K.
(2003). Specific and Sensitive Detection of Ralstonia solanacearum in Soil on the Basis of PCR Amplification of fliC Fragments. Appl. Environ. Microbiol.
69: 7248-7256
[Abstract] [Full Text] -
Detsika, M. G., Corkill, J. E., Magalhaes, M., Glendinning, K. J., Hart, C. A., Winstanley, C.
(2003). Molecular Typing of, and Distribution of Genetic Markers among, Burkholderia cepacia Complex Isolates from Brazil. J. Clin. Microbiol.
41: 4148-4153
[Abstract] [Full Text] -
Tomich, M., Herfst, C. A., Golden, J. W., Mohr, C. D.
(2002). Role of Flagella in Host Cell Invasion by Burkholderia cepacia. Infect. Immun.
70: 1799-1806
[Abstract] [Full Text] -
Hart, C A., Winstanley, C.
(2002). Persistent and aggressive bacteria in the lungs of cystic fibrosis children. Br Med Bull
61: 81-96
[Abstract] [Full Text] -
Scharf, B., Schuster-Wolff-Buhring, H., Rachel, R., Schmitt, R.
(2001). Mutational Analysis of the Rhizobium lupini H13-3 and Sinorhizobium meliloti Flagellin Genes: Importance of Flagellin A for Flagellar Filament Structure and Transcriptional Regulation. J. Bacteriol.
183: 5334-5342
[Abstract] [Full Text] -
WINSTANLEY, C., DETSIKA, M. G., GLENDINNING, K. J., PARSONS, Y. N., HART, C. A.
(2001). Flagellin gene PCR-RFLP analysis of a panel of strains from the Burkholderia cepacia complex. J Med Microbiol
50: 728-731
[Abstract] [Full Text] -
WINSTANLEY, C., SHINA, A., DAWSON, S., GASKELL, R.M., HART, C.A.
(2001). Variation in Bordetella bronchiseptica flaA does not correlate with typing by macro-restriction analysis by pulsed-field gel electrophoresis. J Med Microbiol
50: 255-260
[Abstract] [Full Text] -
Tasteyre, A., Karjalainen, T., Avesani, V., Delmée, M., Collignon, A., Bourlioux, P., Barc, M.-C.
(2000). Phenotypic and Genotypic Diversity of the Flagellin Gene (fliC) among Clostridium difficile Isolates from Different Serogroups. J. Clin. Microbiol.
38: 3179-3186
[Abstract] [Full Text] -
Brisse, S., Verduin, C. M., Milatovic, D., Fluit, A., Verhoef, J., Laevens, S., Vandamme, P., Tümmler, B., Verbrugh, H. A., van Belkum, A.
(2000). Distinguishing Species of the Burkholderia cepacia Complex and Burkholderia gladioli by Automated Ribotyping. J. Clin. Microbiol.
38: 1876-1884
[Abstract] [Full Text] -
Winstanley, C., Hart, C. A.
(2000). Presence of Type III Secretion Genes in Burkholderia pseudomallei Correlates with Ara- Phenotypes. J. Clin. Microbiol.
38: 883-885
[Abstract] [Full Text] -
van Pelt, C., Verduin, C. M., Goessens, W. H. F., Vos, M. C., Tümmler, B., Segonds, C., Reubsaet, F., Verbrugh, H., van Belkum, A.
(1999). Identification of Burkholderia spp. in the Clinical Microbiology Laboratory: Comparison of Conventional and Molecular Methods. J. Clin. Microbiol.
37: 2158-2164
[Abstract] [Full Text] -
HART, C A, WINSTANLEY, C
(1999). Pseudomonas and all that. Arch. Dis. Child.
81: 2-4
[Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»