Previous Article | Next Article 
J Bacteriol, March 1998, p. 1256-1260, Vol. 180, No. 5
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The spoIIE Locus Is Involved in the
Spo0A-Dependent Switch in the Location of FtsZ Rings in
Bacillus subtilis
Anastasia
Khvorova,
Ling
Zhang,
Michael L.
Higgins, and
Patrick J.
Piggot*
Department of Microbiology and Immunology,
Temple University School of Medicine, Philadelphia, Pennsylvania
19140
Received 22 September 1997/Accepted 16 December 1997
 |
ABSTRACT |
A switch in the location of FtsZ ring structures from medial to
polar is one of the earliest morphological indicators of sporulation in
Bacillus subtilis. This switch can be artificially caused
during vegetative growth by induction of an active form, Sad67, of the transcription regulator, Spo0A (P. A. Levin and R. Losick, Genes Dev. 10:478-488, 1996). We have used immunofluorescence microscopy to
show that the switch in FtsZ ring location during vegetative growth
caused by Sad67 induction is blocked by a spoIIE deletion mutation. The spoIIE mutation also impaired polar FtsZ ring
formation during sporulation. These results suggest that SpoIIE
mediates the Spo0A-directed formation of polar FtsZ rings.
 |
INTRODUCTION |
A central issue in developmental
biology is how the progeny of a single cell division assume dissimilar
fates. An attractive experimental system in which this problem can be
addressed is sporulation in Bacillus subtilis, in which the
formation of an asymmetrically positioned septum partitions the
developing cell into a prespore and a mother cell (12, 25, 26,
30). The smaller compartment, the prespore, becomes the spore,
whereas the larger compartment, the mother cell, participates in the
maturation of the spore but eventually lyses to release the spore when
development is complete. We explore here the mechanism responsible for
the switch from medial division during vegetative growth to asymmetric division at the onset of sporulation.
One of the earliest morphological indicators of the onset of
sporulation is the switch in the location of cell division protein FtsZ
ring structures from mid-cell to near the cell pole (21). Although no direct regulator of septum position in B. subtilis has been identified, activation of the Spo0A
transcription factor (16) is a prerequisite for the
formation of polar FtsZ rings (21). Mutations in
spo0A arrest sporulation at stage 0, prior to the asymmetric
division (26). Spo0A is activated by phosphorylation at the
onset of sporulation (stage 0) through the action of a phosphorelay
(16, 17). Deletions in the amino-terminal region of the
protein cause it to be active even in the absence of phosphorylation (18). Levin and Losick (21) showed that the
expression of one such spo0A mutant allele,
sad-67, during vegetative growth was sufficient to cause the
switch in FtsZ ring location from medial to polar.
Spo0A is the earliest-acting and most pleiotropic sporulation
transcription factor and is directly or indirectly responsible for
activation or repression of a number of B. subtilis genes. It seemed plausible that its effect on septum position was mediated by
some locus expressed early in sporulation. Phosphorylated Spo0A is
known to activate directly transcription of three spo loci that are transcribed before septation (16, 30). Two of them (spoIIA and spoIIG) contain the structural genes
for the first prespore-specific and mother-cell-specific transcription
sigma factors,
F and
E, respectively
(30). However, they are not involved in septation. The third
locus directly activated by Spo0A is spoIIE, and the role of
this locus in septation is explored here.
SpoIIE is a bifunctional protein, which contains multiple
membrane-spanning domains in its N-terminal portion and a cytoplasmic tail in its C terminus (5). The SpoIIE C-terminal domain is a serine protein phosphatase, which plays a key role in the activation of
F (1, 2, 7, 8). The transcription of
F-controlled genes commences shortly after the formation
of the polar septum (14, 32) and is strictly confined to the
prespore by a mechanism operating at the level of the activity of the
F protein (reviewed in reference 30).
SpoIIE is responsible for dephosphorylation (and thereby activation) of
SpoIIAA-P. SpoIIAA is an anti-anti-sigma factor that counteracts the
inhibitory effect of SpoIIAB by binding to the SpoIIAB-
F
complex and by causing the release of free and active
F.
In the predivisional sporangium, SpoIIE localizes to both sites of
potential polar division. A septum is formed at one of the poles, and
SpoIIE disappears from the distal pole while persisting at the septum.
Thus, at the time of septation, SpoIIE localizes at the boundary
between the mother cell and the prespore (2, 5, 29). It is
suspected that polar localization of SpoIIE in the sporulation septum
might be the cause of prespore-specific activation of
F.
SpoIIE is also involved in spore septum formation (26).
Barák and Youngman (6) and Feucht et al.
(13) characterized a group of null spoIIE mutants
in which as much as 80% of the cells had no detectable septum
formation after the initiation of sporulation, while about 20% had
aberrant thick septa; formation of these septa was delayed
(13). There is evidence of interaction between SpoIIE and
FtsZ (29), and it seemed possible that SpoIIE mediates the
Spo0A-dependent switch in the FtsZ ring location. Evidence supporting
such a role is presented in this paper.
 |
MATERIALS AND METHODS |
Media.
B. subtilis was grown in modified Schaeffer's
sporulation medium (MSSM), in Luria broth with glucose, and on
Schaeffer's sporulation agar (27). When required,
chloramphenicol at 3 µg/ml, neomycin at 3 µg/ml, and erythromycin
at 1 µg/ml were added.
Strains.
The B. subtilis 168 strain BR151
(trpC2 metB10 lys-3) was used as the parent strain. The
B. subtilis strains used are listed in Table
1. Escherichia coli DH5
(GIBCO-BRL) was used to maintain plasmids.
The spoIIE gene was cloned on a 2.8-kb fragment by PCR into
pBluescript SK+ with the following primers:
TGTAGCATGCAAGCGGGTCTTCCCC and CAAGCGGGTCTTCCCCATGG. A spoIIE disruption was constructed by replacing the
PstI fragment extending from codons 142 to 628 within the
spoIIE open reading frame (5) with a
neo cassette in the opposite orientation and by isolating a
Neor transformant of BR151 in which spoIIE had
been disrupted by double-crossover recombination (strain SL7240).
A 0.67-kb EcoRI-PstI fragment containing the
spoIIE promoter region and extending into the 5' end of the
gene was cloned into the SmaI site of pDH88, a plasmid
designed for placing genes under the control of the Pspac
promoter (15). Integration of the resulting plasmid at
spoIIE by single crossover into BR151 produced a strain (SL7243) in which spoIIE was under the control of
Pspac.
Immunofluorescence microscopy.
Cells were prepared and fixed
for immunofluorescence microscopy essentially as described elsewhere
(21, 32). Briefly, cells were fixed in 30 mM
NaPO4 buffer (pH 7.5) with a final concentration of 2.5%
(vol/vol) paraformaldehyde for 15 min at room temperature and 45 min on
ice prior to being washed in phosphate-buffered saline (PBS).
Localization of FtsZ utilized affinity-purified polyclonal antibodies.
Rabbit antibodies generated against the B. subtilis FtsZ
protein (kindly provided by J. Lutkenhaus) were used in a 1:300
dilution in PBS with 2% bovine serum albumin. Secondary antibodies
coupled to the Cy3 fluorophore were purchased from Jackson
ImmunoResearch (Bar Harbor, Maine). FtsZ structures were visualized as
bands in micrographs of longitudinal cells. These bands were inferred
to represent ring-like structures that circle the rod-shaped organism
(21, 23). Cells were visualized by phase-contrast microscopy
with a yellow conversion filter for daylight color film. Photography
and quantitation of cell types were performed as described previously
(32).
DNA manipulation.
The procedure for transformation of
B. subtilis was described previously (28). Other
DNA manipulations were based on the procedures described by Ausubel et
al. (3). Other methods have been described previously
(27).
 |
RESULTS |
Disruption of spoIIE impairs the switch in FtsZ ring
position caused by expression of sad-67.
A constitutively
active form of Spo0A is known to induce the formation of polar FtsZ
bands during vegetative growth (21). In agreement with this
observation, we found that inducing the expression of the gene,
sad-67, for one such mutant Spo0A protein switched the
pattern of FtsZ assembly from medial to polar within 1 h of
induction from an
isopropyl-
-D-thiogalactopyranoside
(IPTG)-inducible Pspac promoter during vegetative
growth in MSSM. At this time, the FtsZ bands for 90% of cells were
located at cell poles in the induced culture; the corresponding figure
was 1% for the uninduced culture sampled at the same time (Table
2; Fig. 1A
and B; typically, polar bands were not as sharp as medial bands). As
noted by Levin and Losick (21), many cells in the induced
culture had a bipolar rather than a unipolar band pattern (data not
shown). Under the same conditions, FtsZ bands remained located
predominantly at the middle of the cell in the strain containing a
spoIIE deletion-insertion mutation in addition to the
Pspac-sad-67 construction (Table 2; Fig. 1C and
D), with very few cells (0 to 5% in different experiments) exhibiting
a polar FtsZ distribution. Samples taken 1.5 h after induction
gave a very similar result, with spoIIE largely preventing formation of polar FtsZ bands (Table 2). In contrast, the
spoIIE mutation did not prevent formation of polar FtsZ
bands in the 3-h sample (Table 2), which was taken approximately 2 h after the estimated start of sporulation.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Influence of spoIIE deletion on the change in
pattern of FtsZ distribution caused by
Pspac-sad-67 induction
with IPTGa
|
|

View larger version (99K):
[in this window]
[in a new window]
|
FIG. 1.
Immunolocalization of FtsZ. Scale bar, 1 µm. The
photographs are of cells immunostained with affinity-purified
antibodies against the B. subtilis FtsZ protein (A, C, E,
and F) and viewed by phase-contrast microscopy with a yellow filter (B
and D). A secondary antibody conjugated to the red fluorophore Cy3 was
used to visualize FtsZ. Localization of FtsZ in the strains containing
Pspac-sad-67 1 h after IPTG addition during
vegetative growth in spoIIE+ (SL7260) (A and B
[arrows indicate polar FtsZ bands]) and
spoIIE::neo (SL7261) (C and D [arrow
indicates a medial FtsZ band]) backgrounds. FtsZ localization in the
strain containing Pspac-spoIIE without (E
[arrow indicates a medial FtsZ band]) and 30 min after (F [arrows
indicate medial and polar FtsZ bands within a single cell]) IPTG
addition.
|
|
The medium used in the studies discussed above, MSSM, supports
efficient sporulation, and we also tested the effect of
Pspac-sad-67 induction on bacteria grown in
Luria broth, which does not support sporulation. Induction in Luria
broth also caused a switch in the location of the FtsZ band (Table
3), although a longer induction period
was required for the switch than in MSSM (data not shown). This switch
in location was again dependent on spoIIE. The switch was
not affected by disruption of another sporulation locus,
spoIIR (Table 3).
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Comparison of the effect of spoIIE and
spoIIR mutations on the
Pspac-sad-67-induced change in FtsZ
band positiona
|
|
The role of spoIIE in sporulation conditions was examined
further with a spoIIE mutant, SL7240, that did not contain
the Pspac-sad-67 construction. This strain also
formed polar FtsZ bands in sporulation conditions. However, with this
strain, as compared to the isogenic spoIIE+
strain (Fig. 2), their formation was
delayed, and the proportion of bacteria with FtsZ bands was
substantially reduced. Thus, in sporulation conditions, SpoIIE
contributes to but is not essential for the switch to a polar site of
FtsZ ring assembly. However, the spoIIE mutation did not
appear to impede the loss during sporulation of the centrally located
assembly site (Fig. 2), in agreement with a Spo0A-dependent,
SpoIIE-independent mechanism for blocking medial septation.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
The position of FtsZ bands under sporulation conditions
of a spo+ strain and a spoIIE mutant.
Bacteria were grown in MSSM. The start of sporulation was defined as
the end of exponential growth. The pattern of FtsZ localization was
visualized with immunofluorescence microscopy. Results are expressed as
percentages of all cells. Open symbols, cells with medial FtsZ bands;
closed symbols, cells with polar bands (bipolar or unipolar); squares,
spo+ strain (BR151); circles, the isogenic
spoIIE::neo strain (SL7240).
|
|
Expression of SpoIIE during vegetative growth disturbs the pattern
of FtsZ distribution.
Because SpoIIE clearly mediates the effect
of Spo0A on the FtsZ ring position, we suspected that SpoIIE
overexpression might also disturb the pattern of FtsZ distribution. To
this end, we constructed a strain, SL7243, containing spoIIE
under the control of the IPTG-inducible Pspac promoter.
Thirty minutes after induction of spoIIE expression during
exponential growth, multiple FtsZ bands were detected in approximately
15% of the cells (Fig. 1F); induction for 60 min did not significantly
increase this percentage. No cells with multiple FtsZ bands were
detected when IPTG was not added (Fig. 1E). This result fits well with
the report of Barák et al. that the induction of
spoIIE during vegetative growth led to the formation of
multiple septa (4, 5). Interestingly, in all of the cells
with multiple FtsZ bands, the major band was still in the middle of the
cell; the other bands were less intense, but were clearly visible and
usually located at the poles. Thus, induction of SpoIIE during
vegetative growth altered the profile of FtsZ distribution in cells but
did not cause a complete switch of the pattern of FtsZ distribution
from medial to polar. The observed phenotype differs significantly from
the one resulting from induction of an active form of Spo0A, in which
the medial FtsZ band was lost, and some 90% of FtsZ bands were located
at the cell pole (Table 2). It is thought likely that some
Spo0A-induced gene other than spoIIE is required in order to
deactivate the mechanism for the assembly of an FtsZ band at the middle
of the cell. However, the amount of SpoIIE was not determined, so that it is also possible that quantitative (or qualitative) differences in
SpoIIE could account for the loss of the medial FtsZ band in the
Pspac-sad-67 strain and not in the
Pspac-spoIIE strain.
 |
DISCUSSION |
The switch of the site of assembly of FtsZ rings from the midcell
to the cell pole is one of the first detectable morphological events
after the initiation of sporulation (21, 23). Expression of
a constitutively active form of the early sporulation-specific transcriptional factor Spo0A (encoded by sad-67) is
sufficient to induce this switch even during vegetative growth
(21). We have demonstrated here that disruption of
spoIIE under these conditions largely prevented the change
in position of FtsZ band localization during vegetative growth. The
SpoIIE protein is known to have two roles, i.e., one as a phosphatase
for SpoIIAA-P in the process of
F activation
(8) and the other as a determinant of the location and
structure of the sporulation septum (6, 13, 26). Levin and
Losick (21) have shown that mutation in spo0H has
no effect in the sad-67-induced switch in FtsZ ring position
during vegetative growth, and Wu et al. (31) showed that
Spo0H is required for transcription of the operon encoding
F. Thus, we think that the effect of SpoIIE on FtsZ ring
location is a direct manifestation of its role in determining the
location and structure of the sporulation septum and not an indirect
consequence of
F activation.
It had previously been shown that under sporulation conditions,
deletion of spoIIE substantially reduced the frequency of polar septum formation but did not prevent it. We observed that spoIIE deletion had a similar effect on polar FtsZ band
formation (Fig. 2). Moreover, the spoIIE mutant showed a
delay in formation of the polar FtsZ band, which matches well the delay
previously reported for septum formation (13). Our results
indicate that SpoIIE acts at or before the assembly of the FtsZ ring
(FtsZ structures are visualized as bands which are inferred to
represent ring-like structures [21, 23]), that is to
say, in the initial stages of polar septum formation. While SpoIIE is
not essential for the change in FtsZ position in sporulation
conditions, it nevertheless contributes to polar FtsZ ring formation.
We speculate that during the normal sporulation process, there may be
two alternative pathways leading to formation of the polar FtsZ ring,
both of which depend on activation of Spo0A (Fig. 3). One of them requires the
Spo0A-dependent recruitment of SpoIIE, while the second requires some
other factor(s) (X) which functions only under sporulation conditions
and is independent of SpoIIE. The second pathway is, by itself,
inefficient, and the septa formed by this pathway resemble vegetative
septa rather than sporulation septa in structure. Under the artificial
conditions of sad-67 expression during vegetative growth, X
is absent, leaving the SpoIIE-dependent pathway as the only option for
altering the location of FtsZ band assembly by Spo0A activation. The
localization of FtsZ to the middle of vegetative cells is ordinarily
determined by the minCD genes (24). It is not at
present clear how the Spo0A-SpoIIE system interacts with the MinCD
system.

View larger version (7K):
[in this window]
[in a new window]
|
FIG. 3.
Schematic representation of the paths leading to polar
FtsZ ring formation in B. subtilis. Spo0A-P is the active,
phosphorylated form of Spo0A that is made at the start of sporulation.
The Sad67 mutant form of Spo0A is active without phosphorylation and
can substitute for Spo0A-P. The major path from active Spo0A is via
SpoIIE. A minor SpoIIE-independent pathway can also function under
sporulation conditions.
|
|
Since SpoIIE mediates the effect of Spo0A on septum location, one might
expect that SpoIIE overexpression would also affect septum location,
and this has been observed by Barák et al. (4, 5). In
agreement with the observation of Barák et al., we have found
that SpoIIE induction during vegetative growth induced the formation of
FtsZ bands located near the cell poles in approximately 15% of the
cells. We also noted that induction of spoIIE resulted in
approximately 0.3% of the cells being anucleate minicells (data not
shown). The persistence of the medial band as the major FtsZ band in
these cells contrasts with its disappearance when sad-67 was
induced during vegetative growth. This difference is consistent with
the previously postulated role of Spo0A in blocking medial septation
(9).
In contrast to our results and those of Barák et al. (4,
5), those of Levin et al. (22) demonstrated that
expression of spoIIE during vegetative growth from a
xylose-inducible promoter did not cause additional FtsZ bands to
appear. The difference in results from the two sets of experiments most
likely can be explained by the differences in the level of expression
of SpoIIE protein under the weaker xylose-inducible and stronger
Pspac promoters (19). A high level of SpoIIE
expression might be required to induce the additional FtsZ ring
formation because of, for example, competition with a MinCD-dependent
mechanism restricting FtsZ rings to the middle of the cell.
Prior to spore septum formation, SpoIIE localizes in ring-like
structures near cell poles (2, 5, 29). These SpoIIE structures coincide with the FtsZ rings. Levin et al. (22)
showed that the localization of SpoIIE in such structures is dependent on FtsZ, because no ring-like SpoIIE structures were observed in
sporulating cells from which FtsZ protein had been depleted, and
instead SpoIIE seemed to be dispersed throughout the plasma membrane at
the cell poles. We think it possible, nevertheless, that SpoIIE itself
determines the polar location of the ring assembly during sporulation.
SpoIIE and FtsZ may work together in a feedback mechanism, with SpoIIE
determining the position of FtsZ ring assembly (for example, by
providing the sites of initiation of FtsZ polymerization) and FtsZ
determining the macrostructure of the rings with which SpoIIE is
associated. In the absence of FtsZ structures, SpoIIE is unable to
maintain its association with these nucleation sites.
Thus, we consider that SpoIIE either is required for (during vegetative
growth) or facilitates (during sporulation) the Spo0A-mediated formation of polar FtsZ rings. The FtsZ protein is the procaryotic homolog of tubulin, and FtsZ rings are the analogs of eucaryotic microtubules (10, 11). Most microtubules undergo rapid
assembly and disassembly. Eucaryotic cells contain many randomly
oriented microtubules, which are stabilized by binding to structures
such as kinetochores, whereas other microtubules not attached to such structures fall apart (20). It is possible that SpoIIE acts in a similar way to stabilize FtsZ structures at cell poles. SpoIIE involvement in localization and formation of the sporulation septum may
in turn be crucial for coupling asymmetric septum formation with
compartment-specific transcription activation.
 |
ACKNOWLEDGMENTS |
We thank Imro Barák, Alan Grossman, Petra Levin, Richard
Losick, Alexey Wolfson, and the referees for helpful discussions.
This work was supported by Public Health Service grants GM-43577 (to
P.J.P.) and GM-51335 (to M.L.H.) from the National Institutes of
Health.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Temple University School of Medicine,
Philadelphia, PA 19140. Phone: (215) 707-7927. Fax: (215) 707-7788. E-mail: piggotp{at}astro.ocis.temple.edu.
Present address: Department of Molecular, Cellular and
Developmental Biology, University of Colorado, Boulder, CO.
Present address: Department of Microbiology, SmithKline Beecham,
Collegeville, PA.
 |
REFERENCES |
| 1.
|
Arigoni, F.,
L. Duncan,
S. Alper,
R. Losick, and P. Stragier.
1996.
SpoIIE governs the phosphorylation state of a protein regulating transcription factor F during sporulation in Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
93:3238-3242[Abstract/Free Full Text].
|
| 2.
|
Arigoni, F.,
K. Pogliano,
C. D. Webb,
P. Stragier, and R. Losick.
1995.
Localization of protein implicated in establishment of cell type to sites of asymmetric division.
Science
270:637-640[Abstract/Free Full Text].
|
| 3.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1990.
.
Current protocols in molecular biology.
John Wiley and Sons, New York, N.Y.
|
| 4.
| Barák, I. Personal communication.
|
| 5.
|
Barák, I.,
J. Behari,
G. Olmedo,
P. Guzmán,
D. P. Brown,
E. Castro,
D. Walker,
J. Westpheling, and P. Youngman.
1996.
Structure and function of the Bacillus SpoIIE protein and its localization to sites of sporulation septum assembly.
Mol. Microbiol.
19:1047-1060[Medline].
|
| 6.
|
Barák, I., and P. Youngman.
1996.
SpoIIE mutants of Bacillus subtilis comprise two distinct phenotypic classes consistent with a dual functional role for the spoIIE protein.
J. Bacteriol.
178:4984-4989[Abstract/Free Full Text].
|
| 7.
|
Duncan, L.,
S. Alper,
F. Arigoni,
R. Losick, and P. Stragier.
1995.
Activation of cell-specific transcription by a serine phosphatase at the site of asymmetric division.
Science
270:641-644[Abstract/Free Full Text].
|
| 8.
|
Duncan, L., and R. Losick.
1993.
SpoIIAB is an anti- factor that binds to and inhibits transcription by regulatory protein F from Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
90:2325-2329[Abstract/Free Full Text].
|
| 9.
|
Dunn, G.,
D. M. Torgersen, and J. Mandelstam.
1976.
Order of expression of genes affecting septum location during sporulation of Bacillus subtilis.
J. Bacteriol.
125:776-779[Abstract/Free Full Text].
|
| 10.
|
Erickson, H. P.
1995.
FtsZ, a prokaryotic homolog of tubulin.
Cell
80:367-370[Medline].
|
| 11.
|
Erickson, H. P.,
D. W. Taylor,
K. A. Taylor, and D. Bramhill.
1996.
Bacterial cell division protein FtsZ assembles into protofilament sheets and minirings, structural homologs of tubulin polymers.
Proc. Natl. Acad. Sci. USA
93:519-523[Abstract/Free Full Text].
|
| 12.
|
Errington, J.
1993.
Bacillus subtilis sporulation: regulation of gene expression and control of morphogenesis.
Microbiol. Rev.
57:1-33[Abstract/Free Full Text].
|
| 13.
|
Feucht, A.,
T. Magnin,
M. D. Yudkin, and J. Errington.
1996.
Bifunctional protein required for asymmetric cell division and cell-specific transcription in Bacillus subtilis.
Genes Dev.
10:794-803[Abstract/Free Full Text].
|
| 14.
|
Harry, E. J.,
K. Pogliano, and R. Losick.
1995.
Use of immunofluorescence to visualize cell-specific gene expression during sporulation in Bacillus subtilis.
J. Bacteriol.
177:3386-3393[Abstract/Free Full Text].
|
| 15.
|
Henner, D.
1990.
Inducible expression of regulatory genes in Bacillus subtilis.
Methods Enzymol.
185:223-228[Medline].
|
| 16.
|
Hoch, J. A.
1993.
Regulation of the phosphorelay and the initiation of sporulation in Bacillus subtilis.
Annu. Rev. Microbiol.
47:441-465[Medline].
|
| 17.
|
Hoch, J. A.
1995.
Control of cellular development in sporulating bacteria by the phosphorelay two-component signal transduction system, p. 129-144. In
J. A. Hoch, and T. J. Silhavy (ed.), Two-component signal transduction.
American Society for Microbiology, Washington, D.C.
|
| 18.
|
Ireton, K.,
D. Z. Rudner,
K. J. Siranosian, and A. D. Grossman.
1993.
Integration of multiple developmental signals in Bacillus subtilis through the Spo0A transcription factor.
Genes Dev.
7:283-294[Abstract/Free Full Text].
|
| 19.
|
Kim, L.,
A. Mork, and W. Schumann.
1996.
A xylose-inducible Bacillus subtilis integration vector and its application.
Gene
181:71-76[Medline].
|
| 20.
|
Kirschner, M., and T. Mitchison.
1986.
Beyond self-assembly: from microtubules to morphogenesis.
Cell
45:329-342[Medline].
|
| 21.
|
Levin, P. A., and R. Losick.
1996.
Transcription factor Spo0A switches the localization of the cell division protein FtsZ from a medial to a bipolar pattern in Bacillus subtilis.
Genes Dev.
10:478-488[Abstract/Free Full Text].
|
| 22.
|
Levin, P. A.,
R. Losick,
P. Stragier, and F. Arigoni.
1997.
Localization of the sporulation protein SpoIIE in Bacillus subtilis is dependent upon the cell division protein FtsZ.
Mol. Microbiol.
25:839-846[Medline].
|
| 23.
|
Lutkenhaus, J.
1993.
FtsZ ring in bacterial cytokinesis.
Mol. Microbiol.
9:403-409[Medline].
|
| 24.
|
Lutkenhaus, J., and A. Mukherjee.
1996.
Cell division, p. 1615-1626. In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 2.
ASM Press, Washington, D.C.
|
| 25.
|
Piggot, P. J.,
J. E. Bylund, and M. L. Higgins.
1994.
Morphogenesis and gene expression during sporulation, p. 113-137. In
P. J. Piggot, C. P. Moran, Jr., and P. Youngman (ed.), Regulation of bacterial differentiation.
American Society for Microbiology, Washington, D.C.
|
| 26.
|
Piggot, P. J., and J. G. Coote.
1976.
Genetic aspects of bacterial endospore formation.
Bacteriol. Rev.
40:908-962[Free Full Text].
|
| 27.
|
Piggot, P. J., and C. A. M. Curtis.
1987.
Analysis of the regulation of gene expression during Bacillus subtilis sporulation by manipulation of the copy number of spo-lacZ fusions.
J. Bacteriol.
169:1260-1266[Abstract/Free Full Text].
|
| 28.
|
Piggot, P. J.,
C. A. M. Curtis, and H. de Lencastre.
1984.
Use of integrational plasmid vectors to demonstrate the polycistronic nature of a transcriptional unit (spoIIA) required for sporulation of Bacillus subtilis.
J. Gen. Microbiol.
130:2123-2136[Medline].
|
| 29.
|
Pogliano, K.,
A. M. Hofmeister, and R. Losick.
1997.
Disappearance of the E transcription factor from the forespore and the SpoIIE phosphatase from the mother cell contributes to the establishment of cell-specific gene expression during sporulation in Bacillus subtilis.
J. Bacteriol.
179:3331-3341[Abstract/Free Full Text].
|
| 30.
|
Stragier, P., and R. Losick.
1996.
Molecular genetics of sporulation in Bacillus subtilis.
Annu. Rev. Genet.
30:297-341[Medline].
|
| 31.
|
Wu, J.-J.,
P. J. Piggot,
K. M. Tatti, and C. P. Moran, Jr.
1991.
Transcription of the Bacillus subtilis spoIIA locus.
Gene
101:113-116[Medline].
|
| 32.
|
Zhang, L.,
M. L. Higgins,
P. J. Piggot, and M. L. Karow.
1996.
Analysis of the role of prespore gene expression in the compartmentalization of mother cell-specific gene expression during sporulation of Bacillus subtilis.
J. Bacteriol.
178:2813-2817[Abstract/Free Full Text].
|
J Bacteriol, March 1998, p. 1256-1260, Vol. 180, No. 5
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Campo, N., Marquis, K. A., Rudner, D. Z.
(2008). SpoIIQ Anchors Membrane Proteins on Both Sides of the Sporulation Septum in Bacillus subtilis. J. Biol. Chem.
283: 4975-4982
[Abstract]
[Full Text]
-
Thompson, L. S., Beech, P. L., Real, G., Henriques, A. O., Harry, E. J.
(2006). Requirement for the Cell Division Protein DivIB in Polar Cell Division and Engulfment during Sporulation in Bacillus subtilis. J. Bacteriol.
188: 7677-7685
[Abstract]
[Full Text]
-
Feucht, A., Errington, J.
(2005). ftsZ mutations affecting cell division frequency, placement and morphology in Bacillus subtilis. Microbiology
151: 2053-2064
[Abstract]
[Full Text]
-
Carniol, K., Ben-Yehuda, S., King, N., Losick, R.
(2005). Genetic Dissection of the Sporulation Protein SpoIIE and Its Role in Asymmetric Division in Bacillus subtilis. J. Bacteriol.
187: 3511-3520
[Abstract]
[Full Text]
-
Hilbert, D. W., Piggot, P. J.
(2004). Compartmentalization of Gene Expression during Bacillus subtilis Spore Formation. Microbiol. Mol. Biol. Rev.
68: 234-262
[Abstract]
[Full Text]
-
Errington, J., Daniel, R. A., Scheffers, D.-J.
(2003). Cytokinesis in Bacteria. Microbiol. Mol. Biol. Rev.
67: 52-65
[Abstract]
[Full Text]
-
Hilbert, D. W., Piggot, P. J.
(2003). Novel spoIIE Mutation That Causes Uncompartmentalized {sigma}F Activation in Bacillus subtilis. J. Bacteriol.
185: 1590-1598
[Abstract]
[Full Text]
-
Graumann, P. L., Losick, R.
(2001). Coupling of Asymmetric Division to Polar Placement of Replication Origin Regions in Bacillus subtilis. J. Bacteriol.
183: 4052-4060
[Abstract]
[Full Text]
-
Kuhn, I., Peng, L., Bedu, S., Zhang, C.-C.
(2000). Developmental Regulation of the Cell Division Protein FtsZ in Anabaena sp. Strain PCC 7120, a Cyanobacterium Capable of Terminal Differentiation. J. Bacteriol.
182: 4640-4643
[Abstract]
[Full Text]
-
Sciochetti, S. A., Piggot, P. J., Sherratt, D. J., Blakely, G.
(1999). The ripX Locus of Bacillus subtilis Encodes a Site-Specific Recombinase Involved in Proper Chromosome Partitioning. J. Bacteriol.
181: 6053-6062
[Abstract]
[Full Text]
-
Matsuno, K., Blais, T., Serio, A. W., Conway, T., Henkin, T. M., Sonenshein, A. L.
(1999). Metabolic Imbalance and Sporulation in an Isocitrate Dehydrogenase Mutant of Bacillus subtilis. J. Bacteriol.
181: 3382-3391
[Abstract]
[Full Text]
-
King, N., Dreesen, O., Stragier, P., Pogliano, K., Losick, R.
(1999). Septation, dephosphorylation, and the activation of sigma F during sporulation in Bacillus subtilis. Genes Dev.
13: 1156-1167
[Abstract]
[Full Text]
-
Barák, I., Prepiak, P., Schmeisser, F.
(1998). MinCD Proteins Control the Septation Process during Sporulation of Bacillus subtilis. J. Bacteriol.
180: 5327-5333
[Abstract]
[Full Text]