Previous Article | Next Article 
J Bacteriol, March 1998, p. 1296-1304, Vol. 180, No. 5
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Localization of Cell Division Protein FtsK to the
Escherichia coli Septum and Identification of a
Potential N-Terminal Targeting Domain
Xuan-chuan
Yu,
Anthony H.
Tran,
Qin
Sun, and
William
Margolin*
Department of Microbiology and Molecular
Genetics, University of Texas Medical School, Houston, Texas 77030
Received 29 September 1997/Accepted 16 December 1997
 |
ABSTRACT |
Escherichia coli cell division protein FtsK is a
homolog of Bacillus subtilis SpoIIIE and appears to act
late in the septation process. To determine whether FtsK localizes to
the septum, we fused three N-terminal segments of FtsK to green
fluorescent protein (GFP) and expressed them in E. coli
cells. All three segments were sufficient to target GFP to the septum,
suggesting that as little as the first 15% of the protein is a
septum-targeting domain. Localized fluorescence was detectable only in
cells containing a visible midcell constriction, suggesting that FtsK
targeting normally occurs only at a late stage of septation. The
largest two FtsK-GFP fusions were able at least partially to complement the ftsK44 mutation in trans, suggesting that
the N- and C-terminal domains are functionally separable. However,
overproduction of FtsK-GFP resulted in a late-septation phenotype
similar to that of ftsK44, with fluorescent dots localized
at the blocked septa, suggesting that high levels of the N-terminal
domain may still localize but also inhibit FtsK activity.
Interestingly, under these conditions fluorescence was also sometimes
localized as bands at potential division sites, suggesting that
FtsK-GFP is capable of targeting very early. In addition, FtsK-GFP
localized to potential division sites in cephalexin-induced and
ftsI mutant filaments, further supporting the idea that
FtsK-GFP can target early, perhaps by recognizing FtsZ directly. This
hypothesis was supported by the failure of FtsK-GFP to localize in
ftsZ mutant filaments. In ftsK44 mutant
filaments, FtsA and FtsZ were usually localized to potential division
sites between the blocked septa. When the ftsK44 mutation
was incorporated into the FtsK-GFP fusions, localization to midcell
ranged between very weak and undetectable, suggesting that the FtsK44
mutant protein is defective in targeting the septum.
 |
INTRODUCTION |
Recent genetic and cytological
evidence suggests that cell division in bacteria requires a complex of
proteins localized to the division site that are both cytoplasmic and
span the inner membrane (18). Conditional mutations in the
fts genes encoding most of these proteins result in
inhibition of cell division at various stages in the process
(10). In Escherichia coli, ftsZ mutants yield filamentous cells with no sign of septation, indicating a
function early in the septation pathway (13), whereas
ftsK mutants gave rise to highly indented filaments,
suggesting a defect late in the pathway (5). Mutants in
other fts genes appear to be arrested as early as
ftsZ, such as ftsW (8, 12), or at a
later step, such as ftsI (7, 16, 21), but not as
late as ftsK. This genetic evidence has been supplemented by
the results of cytological studies showing that FtsZ and FtsA localize
to division sites (4, 6, 14) and that FtsZ localizes in
cells with other fts mutations but that FtsA fails to
localize in ftsZ mutants (1, 4). FtsI, which is
required for septal peptidoglycan synthesis, also localizes to the
septum (23). Two other proteins isolated by their ability to
interact with the cell division apparatus, ZipA and FtsN, also localize
to the E. coli septum, with ZipA being recruited early and
FtsN at a later stage (2, 11). Confirmation of the
localization of other Fts proteins to the division site would lend
further support for the idea that a large protein complex functions in
septation. Moreover, defining which mutants can or cannot support
localization would allow further ordering of the assembly pathway of
the putative septation complex.
The ftsK gene appears to be essential for cell division in
E. coli because the original ftsK44 mutation that
defined the gene resulted in a lethal defect in the late stages of
septation at the restrictive temperature (5). However, an
insertion mutation in the center of ftsK that leaves the N
terminus intact causes chain formation as in ftsK44 but is
not lethal (9). FtsK is predicted to be a large polytopic
protein, with a hydrophobic N terminus and a C terminus with high
sequence similarity to a family of proteins involved in intercellular
and intracellular DNA transfer (5). One member of this
family, Bacillus subtilis SpoIIIE, can partition chromosomes
through the completed sporulation septum by a conjugation-like
mechanism (19, 24). SpoIIIE has recently been shown to
localize to the sporulation septum; since a mutation in its N-terminal
hydrophobic domain interferes with its localization, it is likely that
this domain is responsible for targeting (25). However,
SpoIIIE is not required for vegetative septation in B. subtilis, whereas FtsK appears to be required in E. coli. FtsK also differs from other members of the SpoIIIE family
in having a large internal proline-glutamine-rich stretch which may
function as a flexible spacer between the N- and C-terminal domains. A
similar type of unique spacer domain is present in FtsZ1, a
Rhizobium meliloti homolog of FtsZ (15). The
roles of FtsK in E. coli septation and any role in DNA
dynamics are not understood. As a first step towards understanding more
about FtsK function, and about localization of proteins to the E. coli cell division site, we used green fluorescent protein (GFP)
to tag small N-terminal domains of FtsK in order to identify those important for localization to the septum. Here we report that a
relatively small N-terminal portion of FtsK is able to localize to the
E. coli septum. Normally, this targeting occurs late during the septation process, although under some conditions FtsK-GFP can
localize early. We also show that a single amino acid substitution in
this domain represented by ftsK44 appears to significantly inhibit FtsK targeting and demonstrate that FtsZ and FtsA generally do
not localize to septa blocked at the ftsK stage.
 |
MATERIALS AND METHODS |
Bacterial strains and growth media.
E. coli JM105 or
BSP853 (W3110 rnc40::Tn5) was used to
harbor FtsK-GFP fusion plasmids. Strain TOE44 (AB2497
ftsK44), obtained from K. Begg, contains the
temperature-sensitive ftsK44 mutation (5). Strain
JFL101 (ftsZ84) was obtained from J. Lutkenhaus. Strains
AX621 (ftsA1882) and AX655 (ftsI2158) were from
the E. coli Genetic Stock Center. LB medium (10 g of
tryptone per liter, 5 g of yeast extract per liter, 5 g of
NaCl per liter) was used for most experiments, except when
nonpermissive conditions were required for the fts mutants,
in which case LBNS (10 g of tryptone per liter, 5 g of yeast
extract per liter) was used. Chloramphenicol was added to 20 to 25 µg/ml.
Plasmid construction.
To amplify ftsK fragments
by PCR, the following primers were made: FtsK1
(5'TTGAGCTCCCTGGAGAGCCTTTCTTGA3'), FtsK3
(5'AATCTAGAAAAGGTATCTACCGGC3'), FtsK4
(5'TTTCTAGATTTGCCGTGATTTTCATC3'), and FtsK7
(5'TTTCTAGAATCATCGCGACGGGTACG3'). The FtsK1 primer included
a SacI site and the region including the FtsK ribosome
binding sequence and start codon (underlined), whereas the other 3 primers all included an XbaI site and the desired 3' end of
the FtsK insert. The XbaI site was engineered to be in frame
with the GFP gene in pZG, as described previously (14). The
FtsK1 primer was designed so that a TGA sequence overlapping the FtsK
start codon would be in frame with the lacZ gene of the vector, in order to prevent inadvertent expression of lacZ
fusions that might interfere with the expression of FtsK-GFP. To
amplify the inserts for cloning by PCR, reaction mixtures included
primer pairs FtsK1-FtsK3, FtsK1-FtsK4, and FtsK1-FtsK7. PCR mixtures also included template DNA supplied by a dilute suspension of JM105
cells and a mixture of Taq polymerase (Promega) and Vent polymerase (New England Biolabs). The reaction conditions consisted of
denaturation at 95°C for 1 min, annealing at 50°C for 2 min, and
polymerization at 72°C for 1 min over 30 cycles. The PCR products of
2.6, 0.71, and 0.64 kb, respectively, were purified, cleaved with
SacI and XbaI, and cloned into SacI-
and XbaI-cleaved pZG. This procedure replaced the
ftsZ gene of pZG, a derivative of pBC SK+ containing GFP
between the XbaI and PstI sites and
lacIq inserted at the EcoRI site,
with the ftsK fragments. Plasmids were named pK3G, pK4G, and
pK7G, corresponding to the number of the downstream PCR primer. The
fragments containing the ftsK44 mutation were cloned by
using cells from strain TOE44 as the DNA template for PCR
amplification, with FtsK1-FtsK3 and FtsK1-FtsK4 as primer pairs, and
otherwise repeating the above-described protocol. The resulting
plasmids were pK3(
)G and pK4(
)G. Expression of the insert genes was
dependent on the vector lac promoter and regulated by the
lacIq gene. The one exception was pK4G(+), from
which the lacIq cassette was deleted by cleavage
with EcoRI followed by religation. Strain BSP853 containing
this plasmid produced significantly higher levels of FtsK-GFP, and IPTG
(isopropyl-
-D-thiogalactopyranoside) was not needed to
visualize fluorescence.
Growth conditions for fusion protein expression.
For
FtsK-GFP localization in the JM105 or BSP853 strain background, cells
were grown in LB medium plus chloramphenicol as standing overnight
cultures and then subcultured at 37°C and shaken for 1 to 2 h in
the same medium. Standing overnight cultures were used to circumvent a
reproducible growth lag in the strains containing the active FtsK-GFP
fusions. Subsequently, 0.5 to 1 mM IPTG was added to the growing
cultures and incubated one to two additional hours at 37°C before
microscopic examination. For FtsK-GFP localization in fts
mutants, cells were grown at 28 to 32°C in LBNS plus chloramphenicol, with thymine for TOE44, until early logarithmic phase. The culture was
then divided into two, 0.5 mM IPTG was added to both aliquots, and one
was shifted to 42°C while the other remained at the lower temperature. Aliquots were taken at various times after induction. To
rule out the possibility that FtsK-GFP localization was due to the
presence of preformed division sites in ftsI mutants, cells were induced at 42°C for 2 h prior to IPTG induction and then grown for an additional 5 h before aliquots were taken for
examination. For FtsK-GFP localization in cephalexin-treated cells,
strain BSP853 was grown at 37°C in LB medium plus chloramphenicol for several hours until early logarithmic phase and then 10 µg of cephalexin per ml was added and the cultures were monitored between 2 and 4 h after drug addition. Short induction times at this IPTG concentration were necessary for detection of fluorescence localization of FtsK-GFP. Complementation tests with TOE44 were done with plates containing LBNS plus chloramphenicol plus thymine, with or without IPTG, at 28 and 42°C.
For FtsA-GFP localization in TOE44, plasmid pAG (14)
containing lacIq was introduced into TOE44.
Expression of FtsA-GFP was induced with 40 to 100 µM IPTG for several
hours, concomitant with the shift of the culture from 28 to 42°C.
Because TOE44 is a thyA mutant, the growth medium was
supplemented with 50 µg of thymine per ml.
Microscopic techniques.
Immunofluorescence localization of
FtsZ in TOE44 was performed essentially as described previously
(1) with polyclonal antiserum against a preparation of
purified E. coli FtsZ, which was verified to be specific by
immunoblot analysis. The secondary antibody was conjugated to Oregon
Green (Molecular Probes). Propidium iodide was used to stain DNA as
described previously (17).
For GFP visualization, live cells were viewed immediately after either
immobilization in 1% low-melting-point agarose in LB
medium or
placement on the surface of a thin agar layer on a microscope
slide.
All images were viewed with an Olympus BX60 fluorescence
microscope
equipped with a 100× oil immersion plan fluorite objective
(numerical
aperture = 1.3), a 100-W mercury lamp, a standard fluorescein
isothiocyanate filter set, and an Optronics DEI-750 cooled video
camera. Images were digitized with a Scion LG3 video card, manipulated
with Adobe Photoshop, and printed on a Tektronix Phaser 400 dye-sublimation
printer. The FtsK-GFP signals were often so faint that
they could
not be viewed with the eye but were easily detectable by the
video
camera, which was capable of on-chip integration. Exposures were
generally between 2 and 8 s.
 |
RESULTS |
Construction and characterization of FtsK-GFP fusions.
To
determine if FtsK is localized to the cell midpoint, we used a
GFP-tagging strategy that was successful in confirming the septal
localization of FtsZ and demonstrating that FtsA also targets to the
septum (14). Because the N terminus of B. subtilis SpoIIIE has been recently implicated in septal
localization (25), we reasoned that the N terminus of FtsK
might be a localization domain. Therefore, GFP was fused to the C
termini of three N-terminal fragments of FtsK. The GFP portion in the
fusion proteins was attached to a cytoplasmic portion of FtsK as
predicted by previous hydropathy analysis (5).
Three N-terminal fragments of
ftsK, encoding 205, 230, and
859 amino acids, were fused to the gene encoding GFP (239 amino
acids),
creating pK7G, pK4G, and pK3G, respectively (Fig.
1).
All three plasmids have identical
transcriptional and translational
controls and have the same fusion
junction with GFP; only the
3' end of
ftsK differs in each
case. Initially, we used versions
of these plasmids that contained a
copy of
lacIq to repress transcription from
P
lac. However, even with
full induction with
IPTG, these fusions were expressed at very
low levels, as assessed by
cellular fluorescence (see below) and
by immunoblotting (data not
shown). Expression was undetectable
without IPTG induction. This low
expression level may have been
due to the rare TTG initiation codon
present in the wild-type
ftsK sequence that was preserved in
the fusions. The low levels
of FtsK-GFP may also have been caused in
part by proteolysis,
since lower-molecular-weight bands were observed
in immunoblots
(data not shown).

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 1.
Properties of different FtsK-GFP fusions. Structures of
the fusion proteins and fusion endpoints are shown at the left. Open
and hatched boxes represent the N-terminal and C-terminal domains of
FtsK, respectively. Shaded boxes represent portions of the long spacer
region of FtsK. Black boxes denote GFP. Asterisks represent the
presence and positions of the ftsK44 mutations in the
various clones. For complementation, ++ denotes full complementation, + denotes partial complementation, and denotes no detectable
complementation. For localization, + denotes strong midcell
localization and denotes no detectable localization. wt, wild
type.
|
|
To test if the FtsK-GFP fusions were functional, they were introduced
into the
ftsK44 mutant strain TOE44. The complementation
results are summarized in Fig.
1. At 42°C in the absence of added
NaCl in the medium, TOE44 mutant cells gave rise to no colonies.
However, pK3G allowed colony formation in this strain under these
conditions with a plating efficiency indistinguishable from that
at
32°C. Plasmid pK4G also partially complemented the mutant,
with a
decrease in plating efficiency of about 10-fold. Interestingly,
pK7G
did not complement at all, suggesting that the residues between
205 and
230 were essential for this activity. The complementation
of the
ftsK44 mutant by an N-terminal domain of FtsK is similar
to
the complementation by partial
ftsK fragments observed by
Begg
et al. (
5), except that in this case GFP was also
attached.
These results suggest that FtsK has at least two distinct
domains
that can function separately, such that a functional N
terminus,
even when it is attached to GFP, can mix with a functional C
terminus
to reconstitute normal FtsK activity. The ability of some of
the
GFP fusions to act as fully functional domains also supports the
localization data discussed below.
Localization of FtsK-GFP.
To visualize FtsK-GFP in living
cells, the strains containing the three different plasmids were induced
for 1 to 2 h with IPTG to express the fusion proteins. Microscopic
examination of the cells revealed two populations, one with uniformly
distributed dim fluorescence and one with bright fluorescence
concentrated at the center (Fig. 2).
Detectable fluorescent localization to the septum nearly always
occurred in cells with an obvious midcell constriction, whereas cells
with no clear constriction had no detectable midcell fluorescence (Fig.
2). This suggested that FtsK-GFP, and also FtsK, might be recruited to
the septum later in the cell division process. Occasionally, cells were
observed with fluorescent bands instead of dots at midcell, but even
these cells contained a slight constriction coincident with the band, suggesting that they represented an initial FtsK localization event.
All three FtsK-GFP fusions localized to midcell (Fig. 2 and data not
shown), indicating that the inability to complement ftsK44
for colony formation did not prevent the ability to target correctly.
These results strongly suggest that the FtsK protein localizes late to
the E. coli septum and demonstrate that the first 205 amino
acids of this 1,329-amino-acid protein, just the N-terminal 15%, are
sufficient to target GFP to the septum. The simplest conclusion that
can be drawn is that this segment functions as a midcell targeting
domain for FtsK.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 2.
Late localization of FtsK-GFP to the septum. Cells
containing FtsK-GFP fusions on plasmids were grown and examined as
described in Materials and Methods. (A and B) Phase-contrast (A) and
fluorescence (B) micrographs of a field of JM105 cells containing pKG4
after IPTG induction, with arrows highlighting fluorescence
localization at constrictions; (C and D) fluorescence (C) and
phase-contrast (D) micrographs of a field of cells with pKG3 in JM105
after IPTG induction. Bar = 5 µm.
|
|
The FtsK44 mutant protein domain is defective in localizing to the
septum.
To test if the protein encoded by the
temperature-sensitive ftsK44 allele could also localize to
the septum, the same 230- and 859-amino-acid segments of FtsK44 present
in pK4G and pK3G were used to fuse the mutant protein to GFP, creating
pK4(
)G and pK3(
)G. As expected, these plasmids were unable to
complement the ftsK44 mutant (Fig. 1). When FtsK44-GFP
proteins were expressed from cells in the same experiment with cells
expressing FtsK-GFP as a positive control, the FtsK44-GFP cells usually
displayed uniform fluorescence (Fig. 3A),
suggesting that the FtsK44 mutant protein domain cannot detectably
localize to midcell. Over the course of many repeated experiments, we
occasionally found very weak localization to constrictions that was
barely detectable (Fig. 3B and C), suggesting that the mutant protein
may have retained a small amount of targeting activity. This
localization defect was particularly apparent in filamentous cells,
which facilitated visualization (see below), and was also observed at
28°C, suggesting that the FtsK44 protein was still defective even at
temperatures permissive for growth of TOE44.

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 3.
FtsK44-GFP is defective in localization to the septum.
(A) Typical fluorescence micrograph showing no fluorescence at
constrictions of JM105 cells containing pK4( )G; (B and C)
phase-contrast (B) and fluorescence (C) micrographs of a field of JM105
cells containing pK4( )G showing very weak fluorescence at
constrictions and the brightest localized fluorescence ever observed
for this mutant fusion (highlighted by arrows); usually no localization
was observed. Bar = 5 µm.
|
|
It was possible that the lack of localization of the FtsK44-GFP fusion
was due to an additional mutation incurred from PCR
amplification, poor
expression, or protein degradation. DNA sequencing
of the entire
inserts containing the GFP fusions to the wild-type
and mutant FtsK
[pK4G and pK4(

)G] revealed only the single base
change
corresponding to the
ftsK44 mutation, ruling out the
possibility
of additional mutations. To ascertain whether the
FtsK44-GFP fusion
protein was expressed, IPTG-induced cells with pK3G,
pK3(

)G,
pK4G, and pK4(

)G were subjected to immunoblot analysis with
anti-GFP
antibody. Expression was weak, as expected, but major bands of
approximately 160 kDa for pK3G and pK3(

)G and approximately 50
kDa
for pK4G and pK4(

)G were observed at similar levels (data
not shown).
The predicted sizes of the fusions were 122 and 53
kDa, respectively.
The discrepancy with the larger fusion may
have been due to aberrant
migration in sodium dodecyl sulfate-polyacrylamide
gel electrophoresis,
because of the unusual extended structure
of the spacer domain, which
is absent in the smaller fusion; similar
aberrantly slow migration was
observed with
R. meliloti FtsZ1,
which has a similar type of
spacer region (
15). In any case,
the immunodetection of both
FtsK-GFP and FtsK44-GFP fusion proteins
at similar levels suggests that
the poor FtsK44-GFP localization
was not due to the absence of the
fusion protein from the cell
and instead suggests that FtsK44-GFP is
defective in detectably
localizing to the septum. These results suggest
that FtsK44 is
a defective protein that somehow retains enough activity
under
permissive conditions of high salt or low temperature to complete
septation.
Although the ability of the N terminus of FtsK to localize to the
septum supports the idea that it is a localization domain,
another
possibility is that it localizes because it is able to
oligomerize with
the wild-type FtsK already present at the septum.
To address this
issue, the localization of FtsK-GFP in the
ftsK44 mutant
TOE44 was examined under nonpermissive conditions. Under
these
conditions,
ftsK44 cells form moderately long filaments
with
regular, deep indentations. These indentations represent
division sites
presumably blocked at the time FtsK normally functions.
When it was
expressed at low levels, FtsK-GFP fluorescence was
often localized to
the constricting septa within the short filaments
(Fig.
4D and E and data not shown). Presumably,
these cells were
somewhat filamentous because the pKG4 plasmid was able
to only
partially complement the
ftsK44 phenotype. It is not
clear why
so many constrictions lacked detectable fluorescence.
However,
because FtsK44-GFP was defective in localizing to septa (Fig.
3), one explanation for the TOE44 phenotype may be poor localization
of
the intact FtsK44 protein, which is tolerated by the cell at
lower
temperatures but not at higher temperatures or low osmolarity.
If the
assumption is made that FtsK44 in TOE44 cells is poorly
localized at
the nonpermissive temperature, then the ability of
FtsK-GFP to localize
in TOE44 under the same conditions supports,
but does not prove, the
idea that the N-terminal domain is a true
localization domain.

View larger version (120K):
[in this window]
[in a new window]
|
FIG. 4.
Localization of FtsZ and FtsA to new division sites in
ftsK filaments. (A and B) IFM of FtsZ in TOE44 filaments
showing FtsZ staining (A) and propidium iodide staining of chromosomes
(B) from the same cells. Arrows in panels A and B indicate a cell with
FtsZ at a nearly constricted septum and at one potential division site.
(C) Fluorescence micrograph of FtsA-GFP expressed from pAG in TOE44
(ftsK44) filaments. (D) Fluorescence micrograph showing
fluorescent localization at some constrictions of TOE44 filaments
containing pKG4. (E) Phase-contrast image of the filaments shown in
panel D. Arrows highlight some constrictions that also show
fluorescence. Bars = 5 µm.
|
|
FtsZ and FtsA localization in an ftsK mutant.
To
understand more about the role and placement of FtsK in the cell
division pathway, we tested the ability of FtsA and FtsZ to localize in
ftsK44 mutant filaments. FtsZ localization was determined by
immunofluorescence microscopy (IFM). Surprisingly, FtsZ rings were
almost always found at potential, unconstricted division sites and not
at the nearly complete septa (Fig. 4A and B). Occasional cells
contained a faint dot of fluorescence still visible at the constricting
septum, along with one or two FtsZ rings at the potential division
sites (Fig. 4A). FtsA-GFP was localized to potential division sites and
not blocked septa in a manner similar to that of FtsZ (Fig. 4C). These
results suggest two possibilities. One is that the FtsK division block
destabilizes the FtsZ ring at the last stage, causing disassembly of
the midcell FtsZ ring and new assembly of a ring or rings at unblocked
potential division sites. Since FtsA is recruited to the FtsZ ring, it
is predicted to localize similarly. The other possibility is that the
stage at which the FtsK block occurs is after the FtsZ ring normally
disassembles and goes to the potential division sites. Since IFM
analysis (17) and monitoring of growing cells with FtsZ-GFP
(22) demonstrate that FtsZ persists at the septum until immediately before cell separation, we favor the former idea that the
FtsZ ring is destabilized after an FtsK block. Such FtsZ ring instability after a block in constriction has been suggested previously (1, 3, 17).
Overexpressed FtsK-GFP causes an ftsK mutant phenocopy
and can localize early.
We made versions of pKG4 in which the
lacIq gene was excised, and cells containing the
new plasmid, pKG4(+), were viable. Overall expression was high, and in
BSP853 no IPTG induction was necessary to observe bright fluorescence.
Concentrated dots of fluorescence still localized to many of the
constriction points (Fig. 5A to D).
However, these cells often formed chains that were very similar to
ftsK44 mutant cell chains. This result suggests that
although low levels of FtsK-GFP were able to complement
ftsK44 at least partially, high levels inhibited septation
in wild-type cells and caused a cell division block at a late stage
similar to the ftsK44 block. The block was not total, since
strains with pKG4(+) and the other FtsK-GFP fusions were able to form
colonies on plates containing IPTG. In fact, complementation of TOE44
by pKG3 and pKG4 occurred in the presence of IPTG, suggesting that the
observed septation inhibition may have been merely a delay from which
the cells could recover. It is possible that this inhibition or delay is due to interference with the proper stoichiometries of the N- and
C-terminal domains. For example, at low levels, FtsK N termini might be
able to form productive complexes with FtsK C termini, but at high
levels, N termini might compete for sites to prevent proper midcell
targeting of C termini. Localization of the N-terminal portion of FtsK
was probably required for this inhibitory effect, because
overexpression of pK(
)G4 resulted in high levels of fluorescence but
had no significant effect on cell division (data not shown).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 5.
FtsK-GFP overproduction correlates with cell division
inhibition and early localization. All fields show BSP853 cells
overproducing FtsK-GFP from pGK4(+) (no lacIq).
Phase-contrast micrographs (A, C, and E) and fluorescence micrographs
(B, D, and F) are paired to show localization to constriction points in
ftsK44-like filaments (A to D) and an undivided cell with
fluorescence at both the midcell constriction and at both potential
division sites (E and F). Bars = 5 µm.
|
|
Interestingly, some cells overexpressing FtsK-GFP exhibited, in
addition to fluorescent dots at constrictions, fluorescent
bands at
one-quarter and three-quarter positions corresponding
to potential
division sites. A typical cell with a fluorescent
dot at the blocked
midcell septum and bands at both potential
division sites is shown in
Fig.
5E to F. This result indicates
that FtsK-GFP is capable of
localizing before constriction is
visible under some conditions;
further evidence for this is presented
below.
FtsK-GFP localization in ftsA, ftsI, and
ftsZ mutants.
When it is expressed at low levels,
FtsK-GFP appears to localize to the septum only after visible
constriction begins, implying that it localizes later than FtsZ and
perhaps later than some other cell division proteins. One possibility
is that the septal localization of FtsK as well as the timing of its
targeting requires the proper function and localization of other cell
division proteins. To test this idea, FtsK-GFP was expressed in
temperature-sensitive mutants of ftsZ, ftsA, and
ftsI.
Because FtsK localizes late in wild-type cells, it was expected that
FtsK would fail to localize in
ftsZ and
ftsA
mutant filaments.
Indeed, FtsK-GFP failed to localize detectably in
ftsZ filaments
(Fig.
6A),
indicating that FtsZ function was required for FtsK
localization.
Control cells grown at 28°C exhibited localization
to constrictions
(data not shown). Likewise, FtsK-GFP localization
was not detectable in
ftsA mutant filaments that were grown for
over two
generations at the nonpermissive temperature (Fig.
6F),
and control
cells at 28°C showed localization as expected (Fig.
6B). However, we
sometimes observed FtsK-GFP localized to potential
division sites
between constrictions in short
ftsA mutant filaments
at
early times after shift to the nonpermissive temperature (Fig.
6C to
E). Localization to constrictions was rarely observed in
these cases.
Because repeated searches for FtsK-GFP localization
in long
ftsA filaments failed, we surmise that the transient
localization
was probably due to residual activity of FtsA or a factor
dependent
on FtsA at potential division sites. Taken together, these
results
suggest that FtsK-GFP localization to the septum requires
functional
FtsZ and probably also FtsA.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 6.
FtsK-GFP localization in ftsA,
ftsI, and ftsZ mutants and in cephalexin-treated
cells. (A) Fluorescence micrograph of pKG4 in a JFL101
(ftsZ84) filament after 3 h at 42°C; (B to E)
fluorescence micrographs (B, C, and E) and a phase-contrast micrograph
(D) of pKG4 in ftsA1882 cells showing localization to
midcell septa (arrows) in cells grown at 28°C (B), and at 60 min
after the shift to 42°C (C to E [panel E is of a field different
from that shown in panels C and D]); (F) fluorescence micrograph of
pKG4 in ftsA1882 filaments 2 h after the shift to
42°C; (G) IFM of FtsZ in ftsI2158 short filaments at
42°C; (H) fluorescence micrograph of pKG4 in ftsI2158
filaments, showing localization; (I to K) fluorescence micrographs (I
and J) and a phase-contrast micrograph (K) of BSP853 cells containing
pKG7, 4 h after cephalexin addition, showing fluorescent bands at
unconstricted midcell sites (I), and 2 h after cephalexin
addition, showing fluorescent dots at constrictions (J and K).
Bars = 5 µm.
|
|
FtsK-GFP localization was then examined under conditions where FtsI,
which is responsible for septal peptidoglycan synthesis,
is inactivated
either by the drug cephalexin (
7,
20) or by
growth of an
ftsI mutant at the nonpermissive temperature
(
21).
Because it is directly involved in septal cell wall
biosynthesis,
FtsI is thought to act at a later stage than FtsZ or
FtsA. FtsK-GFP
was able to localize clearly and strongly to potential
division
sites in filaments generated under both types of conditions
(Fig.
6H to K). Targeting to constrictions was observed in short
filaments
after shorter induction times (Fig.
6J and K) but not at
later
times when visible constrictions disappeared. The spacing between
FtsK-GFP fluorescent bands varied but was at least 6 µm, or
approximately
four nucleoid lengths. Figure
6I to K clearly shows two
FtsK-GFP
bands per filament, some of which were over 10 µm apart,
implying
that the second-generation division sites, but not the first-
or third-generation division sites, were recognized. The result
shown
in Fig.
6I suggested that at this later time point the original
midcell
FtsZ ring had been disassembled, sometimes with a kink
left in the
filament, and that targeting to the third-generation
sites was delayed.
These suggestions are similar to what has been
observed for FtsZ in
ftsI filaments by us (Fig.
6G) and by others
(
17). FtsK44-GFP, encoded by pK4(

)G, did not form any
detectable
bands in cephalexin-induced filaments, supporting the idea
that
it is defective in localization (data not shown).
The above-described results, from both
ftsI mutant filaments
and cephalexin-induced filaments, suggest that FtsI function
is not
strictly necessary for FtsK-GFP localization. Moreover,
the presence of
a large proportion of FtsK-GFP bands at unconstricted,
new division
sites supports the idea that FtsK-GFP, when it is
expressed at
relatively high levels, has the capacity to localize
to potential
division sites prior to visible constriction.
 |
DISCUSSION |
There is a growing body of evidence that the key proteins involved
in E. coli cell division may all be localized to the septum region, indicating their direct role in the functioning of the cell
division machine. It is already established that FtsZ, FtsA, FtsI,
FtsN, and ZipA localize to the septum. Here, we show that the
N-terminal 15% of FtsK is sufficient to target GFP to the septum,
which suggests that this domain is all that is needed for the wild-type
FtsK to recognize the cell midpoint.
FtsK-GFP appears to be targeted late during the septation process.
Normally, cells with FtsK-GFP fluorescence at the septum were observed
to be in the process of visibly constricting, which is the last step in
septation before septum closure and cell separation. The
ftsK44 mutant is arrested at a late stage, consistent with the late localization of FtsK. This late localization is similar to
that of FtsN (2). Unexpectedly, FtsZ and FtsA were usually not found at septa in cell chains after blockage of FtsK function. This
finding might be explained if FtsZ and FtsA did not persist through the
entire division process, which FtsK appears to complete. However,
evidence from immunofluorescence work and studies of live cells with
GFP fusions (22) suggests that FtsZ persists essentially all
the way through cell separation. In addition, FtsK-GFP was observed as
a band in cells just beginning visible constriction. Therefore, we
propose that the presence of FtsK is actually necessary to prevent
premature disappearance of FtsZ from the closing septum. FtsZ function
along with that of FtsK may still be required at this late stage. Since
FtsA seems to follow FtsZ, it is not surprising, then, that FtsA also
is absent in the final stages when FtsK function is blocked. As more
cell division proteins are characterized, and more dynamic studies of
the septation machine are done, it should be possible in the near
future to obtain a clearer picture of the pathway of assembly of the
cell division apparatus.
What is the function of FtsK? One possibility is that it forms a seal
at the last stage of septation, as proposed for SpoIIIE function at the
sporulation septum in B. subtilis (25). No
obvious perturbation in chromosome segregation has been observed in any ftsK mutant to date (5, 9), indicating that if
FtsK has a SpoIIIE-like DNA transport function, it is not essential
under the conditions tested. The behavior of an ftsK null
allele or a mutation in the C terminus homologous to the DNA-binding
region of SpoIIIE will be important to determine in future studies.
Perhaps there is functional redundancy with another protein, such as
MukB or an uncharacterized segregation protein. One speculation is that
FtsK seals the septum closed and simultaneously helps to keep
segregated DNA away from the seal. If so, then the ftsK44 mutant would not have a DNA phenotype because the seal would not be
complete, obviating a need to remove DNA from the closed septum. The
large internal spacer domain of FtsK may impart flexibility to this
potentially complicated maneuver.
What does the FtsK N terminus recognize in order to be targeted? Since
FtsK has a complex polytopic membrane architecture, particularly in its
N-terminal domain, its dependence on FtsZ and FtsA may be via either a
direct protein-protein interaction or an indirect interaction with
another protein at the division site. The ability of FtsK-GFP, when it
is overproduced, to localize to potential division sites in
predivisional cells strongly suggests that FtsK has the capacity to
recognize FtsZ or another early-acting component of the division
apparatus. FtsK-GFP also clearly localized to potential division sites
in ftsA mutants at early times after shifting to the
nonpermissive temperature but then became diffuse. One explanation for
this phenomenon is that FtsK-GFP targeting indeed depends on FtsA, but
in this mutant, FtsA was not completely inactivated at early times
after the temperature shift. Another possibility is that FtsK-GFP
targeting depends on another factor which is FtsA dependent and which
takes several generations to be fully inactivated.
In filamentous cells in which FtsI was inactivated, FtsK-GFP clearly
localized both to constricting septa and to a subset of potential
division sites. One conclusion that can be drawn is that FtsI is not
necessary for FtsK-GFP localization. This is significant for two
reasons. First, although both FtsK and FtsN appear to be recruited late
in septation, FtsN targeting is dependent on FtsI (2), which
suggests that the mechanisms of recruitment of FtsN and FtsK may be
distinct. Secondly, because the FtsI transpeptidase presumably starts
acting well before FtsK does (1, 17), FtsK is likely to
recognize an early constituent of the cell division machine such as
FtsZ, ZipA, and FtsA. Our observation here that FtsK-GFP often targets
new, unconstricted division sites directly supports this model. The
apparent contradiction that FtsK-GFP and presumably FtsK are detectable
only late in septation in normal cells can be rationalized by a model
that couples FtsK levels with timing of localization. In normal
dividing cells, FtsK does not attain high-enough levels to assemble the protein at the septum until late in septation, at which point all of
the free FtsK becomes bound to the septum. After cell division, the
amount of free FtsK presumably returns to the original level and the
process continues, ensuring that FtsK never assembles early. In cells
overexpressing FtsK-GFP, levels are now significantly higher, such that
FtsK can assemble prematurely at potential division sites as well as
late during septation. Since FtsZ has generally not been observed to
assemble at potential division sites in wild-type cells and yet appears
to be required for FtsK targeting, it is likely that the inhibitory
effect of high levels of FtsK-GFP on late septation results in a delay
in cell division. Such a delay would allow levels of free FtsZ and
FtsK-GFP to build up sufficiently to form new FtsZ rings and, hence,
new FtsK-GFP targeting sites. In ftsI filaments
overexpressing FtsK-GFP, FtsK once again was able to assemble
prematurely at potential division sites. However, because a significant
amount of FtsK-GFP assembles at unconstricted FtsZ rings and remains
there, the level of free FtsK-GFP might be expected to drop. This
potential drop may be especially large, because early assembly of FtsK
may force it to assemble over the entire cell circumference, perhaps
requiring much more protein than for assembly at a constricting septum.
Therefore, the concentration of free FtsK-GFP in filamentous cells,
even after overproduction, would be too low to assemble at every
potential division site. In addition, free FtsZ levels might drop as
well, since FtsZ would be tied up in unconstricting rings; previous
observations of ftsI filaments with various numbers of FtsZ
rings are consistent with this idea (1, 17). Because
premature FtsK-GFP localization correlated with a cell division block
of some type, it was not possible to determine if the premature
targeting per se had any inhibitory effect, for example, on the
constriction of the FtsZ ring. Future dynamic studies of cell division
in single cells as well as studies of domain interactions and
second-site suppressors should prove useful in identifying
protein-protein contacts important for FtsK targeting and function.
GFP is a highly useful tool for determining protein localization in
living cells and has been used previously to show that the cell
division proteins FtsZ, FtsA, and ZipA localize to the septum (11,
14). It usually is much easier to construct and express GFP
fusions than to purify proteins and make antibodies, and for some
proteins that are hard to purify, GFP fusions may be the only way to
perform cytological analysis. Another advantage of GFP, as demonstrated
in this paper, is the ability to define localization domains easily.
This is especially true for essential cell division proteins, since the
studies can be done with tagged domains in a merodiploid. With FtsK,
the large N-terminal fusion to GFP was able to complement the
ftsK44 mutant, lending greater credence to the results.
However, as with any method involving protein fusions, results with GFP
must be interpreted with caution. Although the cells are live instead
of fixed, a new protein is being expressed. In our study, FtsK-GFP,
despite its ability to complement ftsK44, may still have had
aberrant activities due to the tag. Keeping these caveats in mind,
future studies combining GFP tagging with immunofluorescence and domain
swapping should be a fruitful approach toward a deeper understanding of
the assembly and function of the bacterial cell division machine.
 |
ACKNOWLEDGMENTS |
We thank Ken Begg for the TOE44 strain.
This work was supported by National Science Foundation grant
MCB-9410840.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Molecular Genetics, University of Texas Medical
School, Houston, TX 77030. Phone: (713) 500-5452. Fax: (713) 500-5499. E-mail: margolin{at}utmmg.med.uth.tmc.edu.
 |
REFERENCES |
| 1.
|
Addinall, S. G.,
E. Bi, and J. Lutkenhaus.
1996.
FtsZ ring formation in fts mutants.
J. Bacteriol.
178:3877-3884[Abstract/Free Full Text].
|
| 2.
|
Addinall, S. G.,
C. Cao, and J. Lutkenhaus.
1997.
FtsN, a late recruit to the septum in Escherichia coli.
Mol. Microbiol.
25:303-309[Medline].
|
| 3.
|
Addinall, S. G.,
C. Cao, and J. Lutkenhaus.
1997.
Temperature shift experiments with an ftsZ84(Ts) strain reveal rapid dynamics of FtsZ localization and indicate that the Z ring is required throughout septation and cannot reoccupy division sites once constriction has initiated.
J. Bacteriol.
179:4277-4284[Abstract/Free Full Text].
|
| 4.
|
Addinall, S. G., and J. Lutkenhaus.
1996.
FtsA is localized to the septum in an FtsZ-dependent manner.
J. Bacteriol.
178:7167-7172[Abstract/Free Full Text].
|
| 5.
|
Begg, K. J.,
S. J. Dewar, and W. D. Donachie.
1995.
A new Escherichia coli cell division gene, ftsK.
J. Bacteriol.
177:6211-6222[Abstract/Free Full Text].
|
| 6.
|
Bi, E., and J. Lutkenhaus.
1991.
FtsZ ring structure associated with division in Escherichia coli.
Nature (London)
354:161-164[Medline].
|
| 7.
|
Botta, G. A., and J. T. Park.
1981.
Evidence of penicillin-binding protein 3 in murein synthesis during septation but not during cell elongation.
J. Bacteriol.
145:333-340[Abstract/Free Full Text].
|
| 8.
|
Boyle, D. S.,
M. M. Khattar,
S. G. Addinall,
J. Lutkenhaus, and W. D. Donachie.
1997.
ftsW is an essential cell-division gene in Escherichia coli.
Mol. Microbiol.
24:1263-1273[Medline].
|
| 9.
|
Diez, A. A.,
A. Farewell,
U. Nannmark, and T. Nystrom.
1997.
A mutation in the ftsK gene of Escherichia coli affects cell-cell separation, stationary-phase survival, stress adaptation, and expression of the gene encoding the stress protein UspA.
J. Bacteriol.
179:5878-5883[Abstract/Free Full Text].
|
| 10.
|
Donachie, W. D.
1993.
The cell cycle of Escherichia coli.
Annu. Rev. Microbiol.
47:199-230[Medline].
|
| 11.
|
Hale, C. A., and P. de Boer.
1997.
Direct binding of FtsZ to ZipA, an essential component of the septal ring structure that mediates cell division in E. coli.
Cell
88:175-185[Medline].
|
| 12.
|
Khattar, M. M.,
K. J. Begg, and W. D. Donachie.
1994.
Identification of FtsW and characterization of a new ftsW division mutant of Escherichia coli.
J. Bacteriol.
176:7140-7147[Abstract/Free Full Text].
|
| 13.
|
Lutkenhaus, J.
1993.
FtsZ ring in bacterial cytokinesis.
Mol. Microbiol.
9:403-410[Medline].
|
| 14.
|
Ma, X.,
D. W. Ehrhardt, and W. Margolin.
1996.
Colocalization of cell division proteins FtsZ and FtsA to cytoskeletal structures in living Escherichia coli cells by using green fluorescent protein.
Proc. Natl. Acad. Sci. USA
93:12998-13003[Abstract/Free Full Text].
|
| 15.
|
Margolin, W.,
J. C. Corbo, and S. R. Long.
1991.
Cloning and characterization of a Rhizobium meliloti homolog of the Escherichia coli cell division gene ftsZ.
J. Bacteriol.
173:5822-5830[Abstract/Free Full Text].
|
| 16.
|
Nanninga, N.
1991.
Cell division and peptidoglycan assembly in Escherichia coli.
Mol. Microbiol.
5:791-795[Medline].
|
| 17.
|
Pogliano, J.,
K. Pogliano,
D. S. Weiss,
R. Losick, and J. Beckwith.
1997.
Inactivation of FtsI inhibits constriction of the FtsZ cytokinetic ring and delays the assembly of FtsZ rings at potential division sites.
Proc. Natl. Acad. Sci. USA
94:559-564[Abstract/Free Full Text].
|
| 18.
|
Rothfield, L. I., and S. S. Justice.
1997.
Bacterial cell division: the cycle of the ring.
Cell
88:581-584[Medline].
|
| 19.
|
Sharpe, M. E., and J. Errington.
1995.
Postseptational chromosome partitioning in bacteria.
Proc. Natl. Acad. Sci. USA
92:8630-8634[Abstract/Free Full Text].
|
| 20.
|
Spratt, B. G.
1977.
Properties of the penicillin-binding proteins of Escherichia coli K12.
Eur. J. Biochem.
72:341-352[Medline].
|
| 21.
|
Spratt, B. G.
1977.
Temperature-sensitive cell division mutants of Escherichia coli with thermolabile penicillin binding proteins.
J. Bacteriol.
131:293-305[Abstract/Free Full Text].
|
| 22.
| Sun, Q., and W. Margolin. Real-time tracking of
FtsZ dynamics during the bacterial cell cycle. Submitted for
publication.
|
| 23.
|
Weiss, D. S.,
K. Pogliano,
M. Carson,
L.-M. Guzman,
C. Fraipont,
M. Nguyen-Distéche,
R. Losick, and J. Beckwith.
1997.
Localization of the Escherichia coli cell division protein FtsI (PBP3) to the division site and cell pole.
Mol. Microbiol.
25:671-681[Medline].
|
| 24.
|
Wu, L. J., and J. Errington.
1995.
A conjugation-like mechanism for prespore chromosome partitioning during sporulation in Bacillus subtilis.
Genes Dev.
9:1316-1326[Abstract/Free Full Text].
|
| 25.
|
Wu, L. J., and J. Errington.
1997.
Septal localization of the SpoIIIE chromosome partitioning protein in Bacillus subtilis.
EMBO J.
16:2161-2169[Medline].
|
J Bacteriol, March 1998, p. 1296-1304, Vol. 180, No. 5
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Baek, C.-H., Wang, S., Roland, K. L., Curtiss, R. III
(2009). Leucine-Responsive Regulatory Protein (Lrp) Acts as a Virulence Repressor in Salmonella enterica Serovar Typhimurium. J. Bacteriol.
191: 1278-1292
[Abstract]
[Full Text]
-
Hett, E. C., Rubin, E. J.
(2008). Bacterial Growth and Cell Division: a Mycobacterial Perspective. Microbiol. Mol. Biol. Rev.
72: 126-156
[Abstract]
[Full Text]
-
Wang, L., Yu, Y., He, X., Zhou, X., Deng, Z., Chater, K. F., Tao, M.
(2007). Role of an FtsK-Like Protein in Genetic Stability in Streptomyces coelicolor A3(2). J. Bacteriol.
189: 2310-2318
[Abstract]
[Full Text]
-
Wang, S. C. E., West, L., Shapiro, L.
(2006). The Bifunctional FtsK Protein Mediates Chromosome Partitioning and Cell Division in Caulobacter. J. Bacteriol.
188: 1497-1508
[Abstract]
[Full Text]
-
Sharp, M. D., Pogliano, K.
(2003). The Membrane Domain of SpoIIIE Is Required for Membrane Fusion during Bacillus subtilis Sporulation. J. Bacteriol.
185: 2005-2008
[Abstract]
[Full Text]
-
Errington, J., Daniel, R. A., Scheffers, D.-J.
(2003). Cytokinesis in Bacteria. Microbiol. Mol. Biol. Rev.
67: 52-65
[Abstract]
[Full Text]
-
Sciochetti, S. A., Lane, T., Ohta, N., Newton, A.
(2002). Protein Sequences and Cellular Factors Required for Polar Localization of a Histidine Kinase in Caulobacter crescentus. J. Bacteriol.
184: 6037-6049
[Abstract]
[Full Text]
-
Akerlund, T., Gullbrand, B., Nordstrom, K.
(2002). Effects of the Min system on nucleoid segregation in Escherichia coli. Microbiology
148: 3213-3222
[Abstract]
[Full Text]
-
Hale, C. A., de Boer, P. A. J.
(2002). ZipA Is Required for Recruitment of FtsK, FtsQ, FtsL, and FtsN to the Septal Ring in Escherichia coli. J. Bacteriol.
184: 2552-2556
[Abstract]
[Full Text]
-
Barre, F.-X., Soballe, B., Michel, B., Aroyo, M., Robertson, M., Sherratt, D.
(2001). Circles: The replication-recombination-chromosome segregation connection. Proc. Natl. Acad. Sci. USA
98: 8189-8195
[Abstract]
[Full Text]
-
Nanninga, N.
(2001). Cytokinesis in Prokaryotes and Eukaryotes: Common Principles and Different Solutions. Microbiol. Mol. Biol. Rev.
65: 319-333
[Abstract]
[Full Text]
-
Barre, F.-X., Aroyo, M., Colloms, S. D., Helfrich, A., Cornet, F., Sherratt, D. J.
(2000). FtsK functions in the processing of a Holliday junction intermediate during bacterial chromosome segregation. Genes Dev.
14: 2976-2988
[Abstract]
[Full Text]
-
Yim, L., Vandenbussche, G., Mingorance, J., Rueda, S., Casanova, M., Ruysschaert, J.-M., Vicente, M.
(2000). Role of the Carboxy Terminus of Escherichia coli FtsA in Self-Interaction and Cell Division. J. Bacteriol.
182: 6366-6373
[Abstract]
[Full Text]
-
Yu, X.-C., Margolin, W.
(2000). Deletion of the min Operon Results in Increased Thermosensitivity of an ftsZ84 Mutant and Abnormal FtsZ Ring Assembly, Placement, and Disassembly. J. Bacteriol.
182: 6203-6213
[Abstract]
[Full Text]
-
Dorazi, R., Dewar, S. J.
(2000). The SOS promoter dinH is essential for ftsK transcription during cell division. Microbiology
146: 2891-2899
[Abstract]
[Full Text]
-
Feilmeier, B. J., Iseminger, G., Schroeder, D., Webber, H., Phillips, G. J.
(2000). Green Fluorescent Protein Functions as a Reporter for Protein Localization in Escherichia coli. J. Bacteriol.
182: 4068-4076
[Abstract]
[Full Text]
-
Brown, W. J., Rockey, D. D.
(2000). Identification of an Antigen Localized to an Apparent Septum within Dividing Chlamydiae. Infect. Immun.
68: 708-715
[Abstract]
[Full Text]
-
Corre, J., Patte, J., Louarn, J.-M.
(2000). Prophage {lambda} Induces Terminal Recombination in Escherichia coli by Inhibiting Chromosome Dimer Resolution: An Orientation-Dependent cis-Effect Lending Support to Bipolarization of the Terminus. Genetics
154: 39-48
[Abstract]
[Full Text]
-
Den Blaauwen, T., Buddelmeijer, N., Aarsman, M. E. G., Hameete, C. M., Nanninga, N.
(1999). Timing of FtsZ Assembly in Escherichia coli. J. Bacteriol.
181: 5167-5175
[Abstract]
[Full Text]
-
Pedersen, L. B., Angert, E. R., Setlow, P.
(1999). Septal Localization of Penicillin-Binding Protein 1 in Bacillus subtilis. J. Bacteriol.
181: 3201-3211
[Abstract]
[Full Text]
-
Weiss, D. S., Chen, J. C., Ghigo, J.-M., Boyd, D., Beckwith, J.
(1999). Localization of FtsI (PBP3) to the Septal Ring Requires Its Membrane Anchor, the Z Ring, FtsA, FtsQ, and FtsL. J. Bacteriol.
181: 508-520
[Abstract]
[Full Text]
-
Chen, J. C., Weiss, D. S., Ghigo, J.-M., Beckwith, J.
(1999). Septal Localization of FtsQ, an Essential Cell Division Protein in Escherichia coli. J. Bacteriol.
181: 521-530
[Abstract]
[Full Text]
-
Yu, X., Margolin, W, Gonzalez-Garay, M., Cabral, F
(1999). Vinblastine induces an interaction between FtsZ and tubulin in mammalian cells. J. Cell Sci.
112: 2301-2311
[Abstract]
-
Joseleau-Petit, D., Vinella, D., D'Ari, R.
(1999). Metabolic Alarms and Cell Division in Escherichia coli. J. Bacteriol.
181: 9-14
[Full Text]
-
Hale, C. A., de Boer, P. A. J.
(1999). Recruitment of ZipA to the Septal Ring of Escherichia coli Is Dependent on FtsZ and Independent of FtsA. J. Bacteriol.
181: 167-176
[Abstract]
[Full Text]
-
Buddelmeijer, N., Aarsman, M. E. G., Kolk, A. H. J., Vicente, M., Nanninga, N.
(1998). Localization of Cell Division Protein FtsQ by Immunofluorescence Microscopy in Dividing and Nondividing Cells of Escherichia coli. J. Bacteriol.
180: 6107-6116
[Abstract]
[Full Text]
-
Yu, X.-C., Weihe, E. K., Margolin, W.
(1998). Role of the C Terminus of FtsK in Escherichia coli Chromosome Segregation. J. Bacteriol.
180: 6424-6428
[Abstract]
[Full Text]
-
Berlyn, M. K. B.
(1998). Linkage Map of Escherichia coli K-12, Edition 10: The Traditional Map. Microbiol. Mol. Biol. Rev.
62: 814-984
[Abstract]
[Full Text]
-
Draper, G. C., McLennan, N., Begg, K., Masters, M., Donachie, W. D.
(1998). Only the N-Terminal Domain of FtsK Functions in Cell Division. J. Bacteriol.
180: 4621-4627
[Abstract]
[Full Text]
-
Wang, L., Khattar, M. K., Donachie, W. D., Lutkenhaus, J.
(1998). FtsI and FtsW Are Localized to the Septum in Escherichia coli. J. Bacteriol.
180: 2810-2816
[Abstract]
[Full Text]
-
Sun, Q., Margolin, W.
(1998). FtsZ Dynamics during the Division Cycle of Live Escherichia coli Cells. J. Bacteriol.
180: 2050-2056
[Abstract]
[Full Text]