Previous Article | Next Article ![]()
J Bacteriol, March 1998, p. 1368-1374, Vol. 180, No. 6
Department of
Biochemistry1 and
Institute of
Pharmacognosy,2 Faculty of Pharmaceutical
Sciences, Tokushima Bunri University, Yamashiro, Tokushima,
Tokushima 770, Japan
Received 15 July 1997/Accepted 6 January 1998
Escherichia coli heat-labile enterotoxin (LT) consists
of an A subunit and five B subunits. These subunits oligomerize into an
assembled holotoxin within the periplasm. Structural analysis of LT has
revealed that the A subunit interacts with the B subunit through its
carboxy terminus. This indicates that the carboxy-terminal portion of
the protein is required for assembly of holotoxin in the periplasm.
However, it is not known whether other regions of the A subunit
contribute to the assembly. The A subunit constituting the holotoxin
contains a disulfide bond between Cys-187 and Cys-199. It has been
observed in many proteins that the intramolecular disulfide bond is
deeply involved in the function and tertiary structure of the protein.
We speculated that the disulfide bond of the A subunit contributes to
the assembly in the periplasm, although the bond is not a structural
element of the carboxy-terminal portion of the A subunit. We replaced
these cysteine residues of the A subunit by oligonucleotide-directed
site-specific mutagenesis and analyzed the LTs produced by cells
containing the mutant LT genes. The amount of the mutant holotoxin
produced was small compared with that of the wild-type strain,
indicating that the disulfide bond of the A subunit contributes to the
structure which functions as the site of nucleation in the assembly. A
reconstitution experiment in vitro supported the notion. Subsequently,
we found that the mutant A subunit constituting holotoxin is easily
degraded by trypsin and that in cells incubated with mutant LTs, the
lag until the intracellular cyclic AMP begins to accumulate is longer
than in cells incubated with native LTs. These results might be useful for the analysis of the interaction of LT with target cells at the
molecular level.
Escherichia coli
heat-labile enterotoxin (LT) contains two dissimilar subunits, A and B,
which are present in the holotoxin at a ratio of 1 to 5 (23,
24). Both subunits are translated from a single polycistronic
messenger coding for one A subunit, followed downstream by one B
subunit. The A and B subunits are synthesized as precursor proteins
with signal sequences (25, 30). The synthesized precursors
are exported from the cytoplasm to the periplasm with the help of the
signal sequence. The exported A and B subunits oligomerize into a
holotoxin within the periplasm (6, 7). The A subunit may act
as the site of nucleation, interacting with multiple B subunits
simultaneously, thereby enhancing pentamer formation (26).
Studies on the in vivo assembly of the LT in E. coli using
pulse-labeling experiments revealed that the rate at which the B
subunits attained a sodium dodecyl sulfate (SDS)-stable pentameric
structure in the periplasm increased by about fourfold when the A
subunit was coexpressed (3, 4).
The A subunit consists of A1 and A2 fragments which are linked
covalently in the main chain as well as by a disulfide bond between
Cys-187 and Cys-199 (23, 24). The disulfide bond is an
important factor in determining the three-dimensional structure of the
protein. Therefore, the disulfide bond formation of the A subunit
between Cys-187 and Cys-199 is thought to be important in the
association of the A and B subunits in the periplasm, since the bond
must contribute to the construction of the A subunit. However, no
studies on the role of the disulfide bond in the construction of
holotoxin have been performed. In this study, we replaced these cysteine residues in vivo by oligonucleotide-directed mutagenesis and
analyzed LTs produced by the cells carrying the mutant LT genes to
clarify the role of the disulfide bond in the association of the A
subunit with the B-subunit oligomer.
Subsequently, we examined the role of the disulfide bond in the
expression of the biological activity of LT. The B subunits mediate
binding of the LT to specific receptors on the plasma membranes of
target cells. Upon binding, the toxins are internalized. The A subunit
internalized into cells catalyzes the NAD-dependent ADP-ribosylation of
Gs Strains, plasmids, and media.
E. coli HB101 was used
as the host strain. Strain BL21 [F
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Contribution of the Disulfide Bond of the A Subunit
to the Action of Escherichia coli Heat-Labile
Enterotoxin
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
(a G protein involved in the regulation of adenylate cyclase)
that leads to the activation of adenylate cyclase, electrolyte efflux,
and ultimately diarrhea (8, 29). The A subunit's activity
is normally latent, requiring reduction of the disulfide bond between
Cys-187 and Cys-199 and proteolytic nicking between the A1 and A2
polypeptides to yield the enzymatically active A1 moiety (8,
19). However, it remains unknown how the disulfide bond is
involved in expression of the biological activity of LT. To elucidate
the role of the disulfide bond, we examined the kinetics of the action
of mutant LT prepared in this study.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
ompT
hsdSB(rB
mB
)]
containing the T7 RNA polymerase gene on a chromosome was the host
strain in the T7 expression system (27). The plasmids and LTs produced by these transformants are shown in Table
1. The plasmid EWD299 encoding the LTp
(LT produced by porcine enterotoxigenic E. coli) gene was
provided by W. S. Dallas (1). Plasmid pKK511, in which
the nucleotide sequence at the site recognized by NdeI in
the A-subunit gene (etxA) of EWD299 is altered as described later (Table 1), was used as the parent plasmid in this study. All
cultures were grown in L broth (1% tryptone, 0.5% yeast extract, 0.5% NaCl) (17). Agar (1.5%) was added to produce solid
medium, and ampicillin (50 µg/ml) was added when necessary.
TABLE 1.
Plasmids encoding wild-type and mutant LT subunits
Oligonucleotide-directed mutagenesis.
Cysteine residues were
replaced with serine in sequences corresponding to positions 187 and
199 of etxA of pKK511 by oligonucleotide-directed mutagenesis using plasmids as reported by Inouye and Inouye
(10). The following oligonucleotides were used as the
mutagens: 512, ATGAATTTCCGGAACCTTGTGGT (Cys-187
Ser);
513, GGTGATACTAGTAATGAGG (Cys-199
Ser).
Oligonucleotide 512 is complementary to the DNA sequence of the wild
type. The underlined bases denote mismatches with the sequence of the
wild type. By the mutations induced by oligonucleotides 512 and 513, recognition sites of MroI and SpeI, respectively,
were generated. The amino acid replacements induced are indicated in
parentheses. To confirm the correct mutations, the DNA sequence around
the mutated positions was determined by means of dideoxy chain
termination from a double-stranded template with a model 373A DNA
sequencing system (Applied Biosystems, Foster City, Calif.).
Construction of the plasmid for pulse-labeling experiments. To selectively express the LT gene product, the pET system was used. In this system, target genes are cloned in pET plasmids under the control of strong bacteriophage T7 transcription and translation signals and the T7 promoter is under the control of the lac operator (27). We used plasmid pET11. In this plasmid, the gene transcribed by T7 RNA polymerase is expressed from the initiation codon (ATG) that is located 1 base after the NdeI cleavage site. Therefore, the target gene is usually inserted into the NdeI site. The existence of other NdeI sites in the target gene fragment complicates the procedure. There is an NdeI cleavage site at position 538 in the etxA gene of EWD299 (1). To simplify the isolation of the target gene, the nucleotide sequence at position 538 was changed by oligonucleotide-directed mutagenesis using oligonucleotide 511 (5'-CACCCATACGAACAGGAG-3'; the underlined base denotes a mismatch with the sequence of the wild type). The mutated gene is not recognized by NdeI, but the amino acid residue encoded by the mutant gene is not altered. The prepared plasmid was named pKK511 (Table 1).
To express holotoxin by the pET system, a DNA fragment containing the holotoxin gene of LTp was amplified from pKK511 by PCR. The sequences of primers i and ii were 5'-TTTCCCATATGAAAAATATA-3' (sense) and 5'-CTGGATCCTTTTCAAATGCAGCA-3' (antisense), respectively. Primers i and ii extended from bases 150 to 169 and from bases 1378 to 1398 of the LTp gene reported by Dallas et al. (1), respectively. Primer i contained three mismatches with the sequence of the wild type (underlined) to create an NdeI site. The initiation codon (ATG) is located 1 base after the NdeI cleavage site. This allowed the structural holotoxin gene to be cloned into the NdeI site of pET11 downstream from the T7 promoter. Primer ii contained four mismatches with the sequence of the wild type (underlined), creating a BamHI site. The PCR product was ligated into pT7-Blue(R) (Takara), which is the cloning vector for the PCR-amplified DNA fragment (Table 1). An NdeI-BamHI fragment from the recombinant plasmid carrying the holotoxin gene of LTp was isolated and inserted into pET11 digested with NdeI and BamHI. The correct insertion of the LTp structure gene was confirmed by sequencing the nucleotides of the flanking DNA of the cloned gene. The resulting plasmid was named pET11-5110 (Table 1). Likewise, etxA of pKK511 was amplified by PCR. The oligonucleotides used for the amplification were primer i and primer iii, which is 5'-ATGGATCCGTAAATAAAACATAACATT-3' (antisense; the underlined bases denote mismatches with the sequence of the wild type to create a BamHI site). Primer iii extended from bases 944 to 971 of the LTp gene reported by Dallas et al. (1). The amplified A-subunit genes of LTp were inserted into pET11 digested with NdeI and BamHI as described above. A-subunit genes of LTp in plasmids pKK512 and pKK513 (Table 1) were also cloned into the NdeI site of pET11 in the same way. The resulting plasmids from pKK511, pKK512, and pKK513 were named pET11-5111, pET11-5121, and pET11-5131, respectively (Table 1).Pulse-labeling.
BL21 cells transformed with pET11 derivative
plasmids were shaken at 37°C until they reached an optical density of
0.4 at 660 nm in L broth containing ampicillin (50 µg/ml). The
culture was centrifuged, and the cell pellet was suspended in M9
minimal medium (17) containing an amino acid mixture (the
final concentration of each amino acid was 50 µg/ml) without
methionine at an optical density of 3.0 at 660 nm. After a final
concentration of 2 mM isopropyl-1-thio-
-D-galactopyranoside (IPTG) was added,
the suspension was shaken at 37°C for 20 min. A portion (1 ml) was
labeled for 1 min at 37°C with 10 µCi of
L-[35S]methionine (0.5 to 1 kCi/mmol)
(ARS-101; American Radiolabeled Chemicals, Inc., St. Louis, Mo.) per
ml. Incorporation of the label was terminated by adding 250 µg of
unlabeled methionine. The incubation continued for the indicated chase
times. Thereafter, the cell suspension was centrifuged and the
resultant cell pellet was suspended in 100 µl of 10 mM Tris-HCl
buffer (pH 7.5).
Purification of LTp and the LTp B oligomer. E. coli HB101 strains harboring the appropriate plasmid were cultured in L broth containing ampicillin (50 µg/ml) for 18 h at 37°C with shaking. The bacteria were collected by centrifugation, washed with 10 mM Tris-HCl (pH 7.2), suspended in TEAN buffer (28), and lysed by sonication. After centrifugation at 15,000 × g for 20 min at 4°C, the supernatant was used as the crude cell lysate.
The purification was performed in accordance with the method of Uesaka et al. (28) by using a column containing immobilized D-galactose (Pierce, Rockford, Ill.). The crude cell lysate of each strain was applied to the column equilibrated with TEAN buffer at room temperature. TEAN buffer was applied to the column until the optical density at 280 nm of the effluent returned to the baseline. Materials that adhered to the column were eluted with 0.3 M D-(+)-galactose (Kishida, Osaka, Japan) in TEAN buffer. The absorbance at 280 nm was recorded, and the peaks were pooled.Preparation of the periplasmic fraction. The cells cultured in liquid medium were collected by centrifugation at 12,000 × g for 10 min, and then the cell pellet was suspended in 10 mM Tris-HCl buffer (pH 7.5). To prepare the periplasmic fraction, the cell suspension was incubated with polymyxin B at a concentration of 6,500 U/ml at 4°C for 15 min and centrifuged (12,000 × g for 15 min). The supernatant obtained was used as the periplasmic fraction.
Disassembly and reassembly of LT. The disassembly and reassembly of LT were achieved by modification of the pH as reported previously (21, 22). A purified holotoxin solution of LT (10 mg/ml) was diluted to a concentration of 1 mg/ml in 0.1 M KCl (pH 1.5), and the samples were briefly mixed. By acid denaturation, holotoxins of LT were disassembled into monomers of A and B subunits. After incubation at 30°C for 1 min, 10 µl of sample was poured into 90 µl of McIlvaine buffer (pH 7.0) (21) and briefly mixed. By incubation at neutral pH, the majority of disassembled monomers were reassembled into oligomers (21). After 60 min, 10 µl of the neutralized sample was poured into 990 µl of phosphate-buffered saline, to yield a final concentration of 10 µg of protein per ml. The samples were condensed to a concentration of 1 mg of protein per ml under vacuum.
SDS-PAGE and isoelectric focusing. SDS-PAGE was performed as described by Laemmli (12).
Isoelectric focusing was performed in acrylamide gel (4.5%) containing ampholine (pH 3.5 to 10.0; Pharmacia LKB, Uppsala, Sweden) at a concentration of 2.7%. A portion of sample (5 µl) was loaded onto the gel, and the gel was run for about 3 h at a constant voltage (50 V/cm). The gels were kept at 4°C during the electrophoresis. After electrophoresis, the gel was stained with Coomassie brilliant blue R-250.Antiserum.
Antiserum against the LTp B oligomer (
LTp-B)
was obtained by several subcutaneous injections of 50 µg of the
purified LTp B oligomer into rabbits (18). Since the LTp B
oligomer used as the antigen was purified from E. coli
possessing the recombinant gene for the LTp B but not the
LTp-A gene, the antiserum obtained could not contain the
antibodies against the A subunit (18).
Measurement of intracellular cyclic AMP accumulation. The ability of LTp to increase intracellular cyclic AMP in T84 cells (human colon carcinoma cell line) was determined essentially as described by Orlandi et al. (20). T84 cells were cultured in a 1:1 mixture of Ham's F12 medium and Dulbecco's modified Eagle's medium (DMEM) containing 5% fetal bovine serum (FBS). Cells were seeded in petri dishes (50-mm diameter) and grown to near confluence. The culture medium was changed to DMEM containing 1% FBS 30 min before the addition of toxin, and the cells were incubated at 37°C in a 5% CO2 atmosphere. LTp was added to the culture medium, and the cells were incubated for various periods of time at 37°C in a 5% CO2 atmosphere. The cells were washed four times with ice-cold phosphate-buffered saline (pH 7.4). The cells were then extracted with 0.1 N HCl, and the extracts were assayed for cyclic AMP by using a cyclic AMP enzyme immunoassay system (Amersham International plc, Buckinghamshire, England).
Protein determination. Protein was determined by the method of Lowry et al. (14) with bovine serum albumin as the standard.
| |
RESULTS |
|---|
|
|
|---|
Mutation. Cysteine residues at positions 187 and 199 were replaced by oligonucleotide-directed site specific mutagenesis to produce plasmids pKK512 and pKK513 (Table 1). The proper mutations were confirmed by the determination of the nucleotide sequence around the mutated position of etxA of these mutant plasmids.
To examine the effect of the mutation on the production of the A subunit, pET11 derivatives (pET11-5111, pET11-5121, and pET11-5131) carrying these A-subunit genes were made (Table 1). BL21 was transformed with these plasmids. The cells were pulse-labeled with [35S]methionine for 1 min and then were chased for 30 s. The periplasmic fractions of these labeled cells were prepared and resolved by SDS-PAGE. The radioactive bands were visualized by autoradiography (Fig. 1). The band corresponding to the A subunit (the bands indicated by the arrow) appeared in every sample except that containing the control (lane 4). The difference in the density of the band among samples was not significant. This means that the mutation did not seriously affect the biosynthesis and the translocation across the inner membrane of the A subunit.
|
Analysis of LT in mutant cells. To examine the properties of LTps produced by these mutant plasmids, we tried to purify the holotoxins of mutant LTps. We used an immobilized D-galactose column for the purification as described in Materials and Methods. It has been shown that not only holotoxin of LT but also the B-subunit oligomer adsorb to the column and that these toxins are eluted with the galactose solution (28). The crude cell lysate of the transformants harboring plasmids (pKK511, pKK512, and pKK513) was applied to the immobilized D-galactose column, and the materials adsorbed to the column were eluted with the galactose solution.
It has been shown that the oligomerized B subunit is stable in SDS at low temperature but dissociates at 100°C (5). To examine the properties of the materials recovered from the D-galactose column, the materials were treated with SDS at different temperatures. About 15 µg of the material was mixed with an equal volume of twice-concentrated SDS buffer containing 2% SDS (12). Equal portions were heated at 100°C for 5 min or kept at 37°C for 5 min and then subjected to SDS-PAGE. The gel was stained with Coomassie brilliant blue dye. The results are shown in Fig. 2A. When the samples were kept at low temperature (37°C), a protein with a molecular size of 59 kDa appeared in every sample (Fig. 2A, lanes 1 to 3). The migration position of these proteins switched to the position of a 12-kDa protein after heating (Fig. 2A, lanes 4 to 6). This shows that the proteins with a molecular size of 59 kDa are B-subunit pentamers, meaning that B subunits produced by these mutants oligomerized into pentamers in the cells.
|
LTp-B. The yielded immunoprecipitate was collected by
centrifugation. Since the serum used did not contain the antibody
against A subunit, free A subunit was not recovered. The A subunits
recovered in the precipitate must be a component of the holotoxin of
LTp. The precipitate was resolved by SDS-PAGE, and the results are
shown in Fig. 3. The bands corresponding
to the A and B subunits and the chase period of each sample are
indicated in the figure. The samples for lanes 1 and 2 were prepared
from BL21/pET11-5110 producing wild-type LTp. In these lanes, the
densities of both bands, those of the A and B subunits, increased with
the chase period. This shows that the A subunit efficiently associated
with the B subunit. The samples for lanes 3 and 4 and for lanes 5 and 6 were prepared from the cells producing LTp(C199S) and LTp(C187S),
respectively. In these samples, the density of the band of the B
subunit increased with the chase period; however, the density of the
band of the A subunit did not increase significantly. It is likely that
the Cys-mutated A subunits do not associate with the B subunit
efficiently and that an A subunit without a disulfide bond cannot
function as the nucleus in the assembly of a B subunit.
|
|
Characterization of the Cys-mutated LTp. (i) Response to limited trypsinolysis. The purified holotoxins of LTp (wild-type and mutant LTps; 30 µg) were treated with trypsin (3 µg) at 37°C for 10 min. The volume of the reaction mixture was 20 µl. The reactions were quenched by the addition of 20 µl of twice-concentrated SDS buffer (12), which contains 2-mercaptoethanol, and then the mixtures were heated at 100°C for 10 min. The products were separated by SDS-PAGE (Fig. 5). A subunit of native LTp was cleaved to yield the A1 and A2 fragments (Fig. 5, lane 2) as reported previously (15). Since the elution profile of the wild-type LTps treated with 30 µg of trypsin (10 times as much trypsin as that used in the experiment illustrated in Fig. 5) resembled that of lane 2 of Fig. 5 (data not shown), the nicked A subunit that is associated with the B-subunit pentamer seems to be fairly stable in response to trypsin treatment. On the other hand, the majority of the A subunit of the mutant LTps was degraded by trypsinolysis (lanes 4 and 6). This means that the structure of these mutant A subunits differs from that of the A subunit of wild-type LT, although both mutant and wild-type A subunits associate with B-subunit pentamers.
|
(ii) Cyclic AMP accumulation activity. It has been reported that some cultured cells exhibit an increase in the intracellular cyclic AMP level in response to LT exposure. Since our initial experiments revealed that T-84 cells are more sensitive than CHO-K1 cells to the action of LT to accumulate intracellular cyclic AMP (data not shown), we used T-84 cells to examine the effect of the Cys mutation of the A subunit on the activity of the A subunit to accumulate intracellular cyclic AMP.
At first, we estimated the amount of holotoxin in the purified toxin solution. As shown in Fig. 2B, the majority of the toxin in the purified sample solution from the wild-type strain was holotoxin. However, the percentage of holotoxin in the samples from the mutant strains was low. So, we measured the density of each band by scanning and estimated the amount of holotoxin in each sample from the density of the band. These samples and their trypsin-treated LTps (the treatment was performed as described above) were added to the culture medium of the cells. The final concentration of holotoxin in each medium is indicated in Fig. 6A. After the cells were incubated with each toxin for 8 h, the intracellular cyclic AMP level was determined as described in Materials and Methods. The intracellular cyclic AMP level increased in response to all LTps except for the trypsin-treated mutant LTps. The minimum concentrations of the holotoxin to induce obvious cyclic AMP accumulation (ca. 2,500 pmol/mg of cellular protein) of native LTp, trypsin-treated native LTp, LTp(C199S), and LTp(C187S) were 1.2, 0.2, 180, and 700 nM, respectively.
|
| |
DISCUSSION |
|---|
|
|
|---|
It is well known that the A subunit associates with B subunits
that are in the process of assembling and in doing so catalyzes the
assembly process. During assembly, the intramolecular interactions that
give rise to the tertiary structure in the individual toxin subunits
create interfaces that allow specific intramolecular interactions that
ultimately lead to stable quaternary complexes of LT. The crystal
structure of the holotoxin of LT revealed that the major contacts
between the A and B subunits are clustered toward the C-terminal
portion of the A2 polypeptide, which is inserted into the central pore
of the B pentamer (24). Therefore, all the information for
the A subunit necessary for the interaction with the B subunit is
presumed to be contained in the A2 fragment. Streatfield et al. showed
that deletion of C-terminal residues within the
14 to
4 region of
the A subunit caused the loss of the capacity of the A subunit to act
as the site of nucleation (26). However, this is inevitable,
because the C-terminal residues are the portion of the A2 fragment that
is inserted into the pore of the B pentamer.
In the present study, we showed that replacement of cysteine residues with serine reduced the capacity of the A subunit to act as the site of nucleation of the assembly with the B subunit and proposed that the disulfide bond between Cys-187 and Cys-199 is important for this function of the A subunit. However, it was possible that the reduction was due to alterations in the structure of the A subunit brought about by the substitution of serine for cysteine residues. To confirm the role of the disulfide bond in the function of the A subunit, we further replaced these cysteine residues with glycine and expressed these genes in E. coli. The amounts of these mutant A subunits [A(C187G) and A(C199G)] associated with the B-subunit oligomer were also small (data not shown). This result supports the suggestion that dissociation of the disulfide bond of the A subunit reduces the capacity of the A subunit to act as the site of nucleation of assembly with the B subunit. The results from pulse-chase (Fig. 3) and reconstitution (Fig. 4) experiments also support this suggestion.
However, the holotoxin was produced even in the mutant cells, although
in small amounts compared with the amounts produced in the wild type
(Fig. 2B). Since these mutant A subunits retain C-terminal residues
within the
14 to
4 region which is the core of the assembly, we
think that the disulfide bond formation of the A subunit is important
but not essential in the creation of the structure of the core region
of A2 fragment.
A report showed that the fusion proteins consisting of the A2 fragment
of cholera toxin and alkaline phosphatase,
-lactamase, or
maltose-binding protein assemble with the B subunit to form holotoxin-like chimeras. No portion of the A1 domain of cholera toxin
was required for formation of holotoxin-like chimeras (9, 11). However, it is not clear whether these fusion proteins efficiently function as the site of nucleation in the assembly. In our
experiment, the mutant A subunit functions as the site of nucleation,
although the efficiency is low (Fig. 2B). Further analysis of the
holotoxin-like chimeras will make clear the structure of the core
region of the A2 fragment in the assembling process.
Subsequently, we examined the sensitivity of the mutant LTps to trypsinolysis. As shown in Fig. 5, the mutant A subunits associated with the B-subunit pentamer were easily degraded by limited trypsinolysis, although the native A subunits associated with the B-subunit pentamer were cleaved by the lysis only at a site generating A1 and A2 fragments. This shows that the three-dimensional structure of the mutant A subunit is different from that of the native A subunit.
As shown in Fig. 6A, the ability of the mutant LTps to elevate the intracellular cyclic AMP concentration is less than that of the wild-type LTp. When LTs are incubated with mammalian cells, the B subunits of the LTs recognize and bind to specific receptors (GM1 ganglioside) on the cell surface. In addition to GM1 ganglioside, some cell surface glycoproteins are known to serve as alternative receptors (2). Crystallographic studies revealed that LT binds with its enzymatically active A subunit pointing away from the membrane (16). Since the B subunits of the mutant LTps form pentamers (Fig. 2), it seems that the mutation does not cause the reduction of binding affinity to the receptors of the cell surface. Actually, a preliminary study using fluorescence antibody showed that a suitable number of mutant LTps bind to the cells (data not shown). Characteristically, the A subunit of mutant LTp is highly sensitive to proteolysis (Fig. 5). We predict that the low activity of mutant LTps to elevate the level of intracellular cyclic AMP is due to the low resistance of the mutant LTps to proteases. The mutant LTps added to the culture medium should be degraded by intracellular and extracellular proteases.
Subsequently, we examined the kinetics of the mutant LTps and found that in the cells exposed to them, the lag time until the intracellular cyclic AMP begins to increase is greater than that in the cells exposed to native LTps (Fig. 6B), although the reason for this is unclear. The amino acid sequence of the A1 fragment, which contains the enzymatic activity, was not changed by the mutation. Therefore, it is unlikely that the enzymatic activity of the A1 fragment of the mutant LTps is responsible for the longer lag time.
The cell-bound LTs are internalized via endocytosis through
noncoated-membrane invagination of the plasma membrane and appear first
in noncoated vesicles and then in a tubulovesicle closely associated
with the Golgi apparatus. The carboxy-terminal amino acid sequence of
the A2 polypeptide of LT is RDEL, which is homologous to a potential
endoplasmic reticulum (ER) retention signal; thus, the LTs recognized
by specific receptors in the Golgi network are shuttled back into the
ER (9, 20). A recent study showed that the disulfide bond of
the A subunit is dissociated by the protein-disulfide isomerase in the
ER and A1 fragments generated in the ER (19). The A1
fragments appear on the surface of the ER and are carried to the
Gs/adenylate cyclase complex on the basolateral membrane by the
basolaterally targeted vesicles (13). The A1 peptide then
catalyzes the NAD-dependent ADP-ribosylation of Gs
, a component of
the heterotrimeric signal-transducing guanine-nucleotide binding
protein that stimulates adenylate cyclase (9).
As shown in Fig. 6B, the generation of a proteolytic nick site in the native LTp in vitro shortened the lag phase, indicating that the time until A1 fragments generate in the ER closely relates to the length of the lag phase. Since the structure of the mutant A subunit bound to the B subunit differs from that of the native A subunit (Fig. 5), it is possible that the efficiency of the internalization into cells of the mutant LTp via noncoated-membrane invagination is low and that internalization takes time. In addition, the translocational efficiency of the mutant LTp to cross the ER membrane may be low due to the deformation. It is also possible that the frequency with which A1 fragments are generated in the ER is low in the mutant LTps. Studies on the kinetics of the action of mutant LTps serve to clarify the behavior of LTp in cells at the molecular level.
| |
ACKNOWLEDGMENT |
|---|
This work was supported in part by a grant-in-aid for scientific research from the Ministry of Education, Science, and Culture, Japan.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry, Faculty of Pharmaceutical Sciences, Tokushima Bunri University, Yamashiro, Tokushima, Tokushima 770, Japan. Phone: 81-886-22-9611, ext. 5811. Fax: 81-886-55-3051. E-mail: okamoto{at}mandala.ne.jp.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Dallas, W. S.,
D. M. Gill, and S. Falkow.
1979.
Cistron encoding Escherichia coli heat-labile toxin.
J. Bacteriol.
139:850-858 |
| 2. | Griffiths, S. L., and D. R. Critchley. 1991. Characterization of the binding site for Escherichia coli heat-labile toxin type I in intestinal brush borders. Biochim. Biophys. Acta 1075:154-161[Medline]. |
| 3. |
Hardy, S. J. S.,
J. Holmgren,
S. Johansson,
J. Sanchez, and T. R. Hirst.
1988.
Coordinated assembly of multisubunit proteins: oligomerization of bacterial enterotoxins in vivo and in vitro.
Proc. Natl. Acad. Sci. USA
85:7109-7113 |
| 4. | Hirst, T. R. 1995. Biogenesis of cholera toxin and related oligomeric enterotoxins, p. 123-184. In J. Moss, B. Iglewski, M. Vaughan, and A. T. Tu (ed.), Bacterial toxins and virulence factors in disease. Marcel Dekker, Inc., New York, N.Y. |
| 5. |
Hirst, T. R.,
S. J. S. Hardy, and L. L. Randall.
1983.
Assembly in vivo of enterotoxin from Escherichia coli: formation of the B subunit oligomer.
J. Bacteriol.
153:21-26 |
| 6. |
Hofstra, H., and B. Witholt.
1984.
Kinetics of synthesis, processing, and membrane transport of heat-labile enterotoxin, a periplasmic protein in Escherichia coli.
J. Biol. Chem.
259:15182-15187 |
| 7. |
Hofstra, H., and B. Witholt.
1985.
Heat-labile enterotoxin in Escherichia coli: kinetics of association of subunits into periplasmic holotoxin.
J. Biol. Chem.
260:16037-16044 |
| 8. | Hol, W. G. J., T. K. Sixma, and E. A. Merritt. 1995. Structure and function of E. coli heat-labile enterotoxin and cholera toxin B pentamer, p. 185-223. In J. Moss, B. Iglewski, M. Vaughan, and A. T. Tu (ed.), Bacterial toxins and virulence factors in disease. Marcel Dekker, Inc., New York, N.Y. |
| 9. | Holmes, R. K., M. G. Jobling, and T. D. Connell. 1995. Cholera toxin and related enterotoxins of gram-negative bacteria. Biogenesis of cholera toxin and related oligomeric enterotoxins, p. 225-255. In J. Moss, B. Iglewski, M. Vaughan, and A. T. Tu (ed.), Bacterial toxins and virulence factors in disease. Marcel Dekker, Inc., New York, N.Y. |
| 10. | Inouye, S., and M. Inouye. 1987. Oligonucleotide directed site-specific mutagenesis using double-stranded plasmid DNA, p. 181-206. In S. A. Narang (ed.), Synthesis and application of DNA and RNA. Academic Press, Inc., New York, N.Y. |
| 11. |
Jobling, M. G., and R. K. Holmes.
1992.
Fusion proteins containing the A2 domain of cholera toxin assemble with B polypeptides of cholera toxin to form immunoreactive and functional holotoxin-like chimeras.
Infect. Immun.
60:4915-4924 |
| 12. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685[Medline]. |
| 13. |
Lencer, W. I.,
C. Constable,
S. Moe,
M. G. Jobling,
H. M. Webb,
S. Ruston,
J. L. Madara,
T. R. Hirst, and R. K. Holmes.
1995.
Targeting of cholera toxin and Escherichia coli heat-labile toxin in polarized epithelia: role of COOH-terminal KDEL.
J. Cell Biol.
131:951-962 |
| 14. |
Lowry, O. H.,
N. J. Rosenbrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275 |
| 15. | Merritt, E. A., S. P. Pronk, T. K. Sixma, K. H. Kalk, B. A. M. van Zanten, and W. G. J. Hol. 1994. Structure of partially-activated E. coli heat-labile enterotoxin (LT) at 2.6 Å resolution. FEBS Lett. 337:88-92[Medline]. |
| 16. | Merritt, E. A., T. K. Sixma, K. H. Kalk, B. A. M. van Zanten, and W. G. J. Hol. 1994. Galactose binding site in E. coli heat-labile enterotoxin (LT) and cholera toxin (CT). Mol. Microbiol. 13:745-753[Medline]. |
| 17. | Miller, J. 1972. , p. 431-433. Experiments in molecular genetics Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 18. |
Okamoto, K.,
K. Okamoto,
A. Miyama,
T. Tsuji,
T. Honda, and T. Miwatani.
1988.
Effect of substitution of glycine for arginine at position 146 of the A1 subunit on biological activity of Escherichia coli heat-labile enterotoxin.
J. Bacteriol.
170:2208-2211 |
| 19. |
Orlandi, P. A.
1997.
Protein-disulfide isomerase-mediated reduction of the A subunit of cholera toxin in a human intestinal cell line.
J. Biol. Chem.
272:4591-4599 |
| 20. |
Orlandi, P. A.,
P. K. Curran, and P. H. Fishman.
1993.
Brefeldin A blocks the response of cultured cells to cholera toxin. Implications for intracellular trafficking in toxin action.
J. Biol. Chem.
268:12010-12016 |
| 21. |
Ruddock, L. W.,
J. J. F. Coen,
C. Cheesman,
R. B. Freedman, and T. R. Hirst.
1996.
Assembly of the B subunit pentamer of Escherichia coli heat-labile enterotoxin.
J. Biol. Chem.
271:19118-19123 |
| 22. |
Ruddock, L. W.,
S. P. Ruston,
S. M. Kelly,
N. C. Price,
R. B. Freedman, and T. R. Hirst.
1995.
Kinetics of acid-mediated disassembly of the B subunit pentamer of Escherichia coli heat-labile enterotoxin.
J. Biol. Chem.
270:29953-29958 |
| 23. | Sixma, T. K., K. H. Kalk, B. A. M. van Zanten, Z. Dauter, J. Kingma, B. Witholt, and W. G. J. Hol. 1993. Refined structure of Escherichia coli heat-labile enterotoxin, a close relative of cholera toxin. J. Mol. Biol. 230:890-918[Medline]. |
| 24. | Sixma, T. K., S. E. Pronk, K. H. Kalk, E. S. Wartna, B. A. M. van Zanten, B. Witholt, and W. G. J. Hol. 1991. Crystal structure of a cholera toxin-related heat-labile enterotoxin from E. coli. Nature (London) 351:371-377[Medline]. |
| 25. |
Spicer, E. K., and J. A. Nobel.
1982.
Escherichia coli heat-labile enterotoxin, nucleotide sequence of the A subunit gene.
J. Biol. Chem.
257:5716-5721 |
| 26. |
Streatfield, S. J.,
M. Sandkvist,
T. K. Sixma,
M. Bagdasarian,
W. G. J. Hol, and T. R. Hirst.
1992.
Intermolecular interactions between the A and B subunits of heat-labile enterotoxin from Escherichia coli promote holotoxin assembly and stability in vivo.
Proc. Natl. Acad. Sci. USA
89:12140-12144 |
| 27. | Studier, F. W., A. H. Rosenberg, J. J. Dunn, and J. W. Dubendorff. 1990. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185:60-89[Medline]. |
| 28. | Uesaka, Y., Y. Otsuka, Z. Lin, S. Yamasaki, J. Yamaoka, H. Kurazono, and Y. Takeda. 1994. Simple method of purification of Escherichia coli heat-labile enterotoxin and cholera toxin using immobilized galactose. Microb. Pathog. 16:71-76[Medline]. |
| 29. | Welsh, C. F., J. Moss, and M. Vaughan. 1995. ADP-ribosylation factors: a family of guanine nucleotide-binding proteins that activate cholera toxin and regulate vesicular transport, p. 257-280. In J. Moss, B. Iglewski, M. Vaughan, and A. T. Tu (ed.), Bacterial toxins and virulence factors in disease. Marcel Dekker, Inc., New York, N.Y. |
| 30. |
Yamamoto, T.,
T. Tamura, and T. Yokota.
1984.
Primary structure of heat-labile enterotoxin produced by Escherichia coli pathogenic for humans.
J. Biol. Chem.
259:5037-5044 |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»