INTRODUCTION

Top Abstract Introduction Materials & Methods Results & Discussion References

The 26S proteasome is a high-molecular-weight proteinase which, in the Eucarya domain, is responsible for the rapid proteolysis of central metabolic enzymes, regulatory proteins, transcription factors, and misfolded or damaged proteins (reviewed in reference 4). The 26S eucaryal proteasome is also an essential component of the ATP-dependent, nonlysosomal proteolytic pathway and, in higher vertebrates, generates peptides which are presented to the immune system on major histocompatibility complex class I molecules. The 20S catalytic core of the 26S eucaryal proteasome is highly conserved with the archaeal 20S proteasomes from Thermoplasma acidophilum (5) and Methanosarcina thermophila (14). A 20S proteasome has been purified from the hyperthermophilic archaeon Pyrococcus furiosus (2), and novel forms of proteasomes have also been reported in microbes from the Bacteria domain (reviewed in reference 4), signifying the broad importance of these high-molecular-weight proteases in procaryotes.

The 20S proteasome from T. acidophilum is a cylinder of four stacked rings, each comprised of seven subunits in an ₇₇₇₇ configuration with the  subunits localized to the outer rings and the  subunits forming the inner rings (10, 13). The active sites are localized to the  subunits on the inner surface of the cylinder. The walls of the cylinder have no openings, which limits the entry of substrates into the two openings at the ends of the cylinder. The recent crystal structure of the eucaryal 20S proteasome from yeast is similar (9), except that there are seven different types of  and  subunits. Studies with the T. acidophilum enzyme suggest that  subunits form seven-membered rings early in assembly, presumably to provide a scaffolding for the formation of  rings from monomeric  prosubunits (26), which contain a propeptide that is autocatalytically processed during assembly to expose an N-terminal threonine (Thr¹), forming the active-site nucleophile for peptide hydrolysis (13, 22). A relatively stable half-proteasome intermediate has been detected during assembly of the mammalian 20S proteasome (8, 21). A chaperone is proposed to assist in assembly of the two half-proteasomes into the eucaryal 20S proteasome. The eucaryal 20S proteasome is multicatalytic, displaying CL (chymotrypsinlike), TL (trypsinlike), and PG (postglutamyl) activities (16, 19). Three distinct -type subunits (Pre3, Pup1, and Pre2), each with an N-terminal Thr¹ active site, are responsible for PG, TL, and CL activities of the yeast 20S proteasome (11). The eucaryal enzyme also catalyzes cleavage after branched-chain amino acids (BRAAP activity) and small neutral amino acids (SNAAP activity) (17). Understanding of the assembly and multisubstrate activity of the archaeal 20S proteasome is not as advanced.

The 20S proteasome from T. acidophilum is the only archaeal 20S proteasome characterized biochemically (1, 6). T. acidophilum is a thermoacidophile which grows aerobically by utilizing glucose as an energy source and is both phylogenetically and metabolically distant from M. thermophila, which is an obligately anaerobic methanoarchaeon obtaining energy for growth by converting simple one- and two-carbon substrates to methane at neutral pH (15). Here we report biochemical features of the M. thermophila 20S proteasome which extend an understanding of the 20S proteasome in general for the Archaea and specifically for the methanoarchaea.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results & Discussion References

Materials. Biochemicals were purchased from Sigma Chemical Co. (St. Louis, Mo.). Other organic and inorganic chemicals were from Fisher Scientific and were analytical grade. Restriction endonucleases and DNA-modifying enzymes were from New England Biolabs (Beverly, Mass.), Promega (Madison, Wis.), or US Biochemical (Cleveland, Ohio). Oligonucleotides were from the University of Florida-Interdisciplinary Center for Biotechnology (Gainesville, Fla.) and Integrated DNA Technologies (Coralville, Iowa).

Cloning of psmA and psmB into expression vector pT7-7. The psmB gene, encoding the  prosubunit, was amplified by PCR with the high-fidelity thermophilic Vent DNA polymerase to minimize the error rate in DNA synthesis. The template DNA (1 ng) was a pUC19-based plasmid containing the complete psmB gene on a 3.0-kb HindIII-to-Sau3A1 fragment from the M. thermophila genome (14). Flanking oligonucleotides with either an NdeI or an EcoRI restriction enzyme site (underlined), 5'-CTGCCCATATGGATAATGACAAATA-3' and 5'-GGCTAGAATTCAACAGTTAAATGAT-3', were used for the amplification reaction. The NdeI and EcoRI sites were used to clone the amplification product into expression vector pT7-7 (25). The resulting plasmid, pMT7, has the psmB translational start codon located 8 bp downstream of the T7 ribosome binding site (Table 1). The psmA gene, encoding the  subunit, was isolated from a previously reported 17-kb Sau3A1 M. thermophila genomic fragment (14) by using restriction enzymes EcoRV and XmnI. The resulting 0.98-kb psmA-specific fragment was cloned into the HincII site of pUC19, and then, by using the restriction enzymes EcoRI and HindIII, psmA was subcloned into both pT7-7 and pMT7. The resulting plasmids, pMT7 and pMT7 (Table 1), have 165 bp of genomic DNA included upstream of psmA.

Heterologous production and purification of the 20S proteasome and  or  subunits. The psmB and psmA genes were coexpressed and independently expressed in Escherichia coli BL21(DE3) by using the bacteriophage T7 RNA polymerase-promoter system (25). Freshly transformed cells were inoculated into Luria-Bertani medium supplemented with ampicillin (100 mg/liter) and grown at 30°C and 200 rpm until the cells reached an A₆₀₀ of about 0.7. T7 RNA polymerase-dependent transcription was then induced by incubation with 0.4 mM isopropyl--D-thiogalactopyranoside for 3 h. Cells were harvested by centrifugation at 5,000 × g for 15 min at 4°C and then stored at 70°C. The typical cell yield was about 4.5 g (wet weight)/liter of culture. Cells (4.5 g) were thawed in 6 volumes (wt/vol) of 20 mM Tris buffer (pH 7.2) containing 1 mM dithiothreitol and passed through a French pressure cell at 20,000 lb/in². This was followed by centrifugation at 16,000 × g for 30 min at 4°C.

Activity assays and electrophoretic techniques. Peptide-hydrolyzing activities were assayed by monitoring the release of -naphthylamine colorimetrically or that of 7-amino-4-methylcoumarin fluorometrically as previously described (14). Specific activities are reported as nanomoles of product per minute per milligram of protein. Protein hydrolysis activity was assayed by measuring the generation of ninhydrin-reactive products (18, 20). Reaction mixtures (150-µl final volume) contained 150 µg of substrate and 10 µg of 20S proteasome in 10 mM Tris-HCl (pH 8.0) and were incubated at 65°C. The reaction was terminated after 80 min by addition of 50 µl of 10% trichloroacetic acid. Ninhydrin-reactive products were determined from a 100-µl aliquot of the supernatant after trichloroacetic acid precipitation of protein. Specific activity is reported as nanomoles of leucine equivalents per minute per milligram of protein. Control reactions included the enzyme and the substrate protein incubated separately and then precipitated with trichloroacetic acid after 80 min at 65°C. The irreversible inhibition was determined by incubating the purified 20S proteasome at 0.01 mg/ml with 20 µM 3,4-dichloroisocoumarin for 30 min at 22°C. A Spectra/Por cellulose ester membrane with a molecular mass cutoff of 15,000 Da (Spectrum, Houston, Tex.) was used to dialyze a 5-ml sample twice against 4 liters of Tris buffer at 4°C for 18 h. After dialysis, the protein concentration and peptide-hydrolyzing activity of the sample were reassessed.

In vitro assembly. A subunit equimolar ratio of  subunits and  prosubunits at a final concentration of 1.3 mg of protein/ml of Tris buffer was incubated at temperatures ranging from 0 to 65°C for 90 min and then electrophoresed under nondenaturing and denaturing conditions. The sample incubated at 37°C was also equilibrated at 80% NH₄(SO₄)₂ and then centrifuged at 10,000 × g for 15 min at 4°C. The protein pellet (2 mg) was resuspended in 0.1 ml of Tris buffer and applied to a Superose 6 HR 10/30 column equilibrated with Tris buffer containing 150 mM NaCl. Fractions eluting at about 645 kDa were analyzed for peptide-hydrolyzing activity and electrophoresed by denaturing SDS-14% PAGE.

Site-specific amino acid replacements in PsmB and purification of the altered proteins. Amino acids DNDKYLKG of the N terminus of the  prosubunits were deleted by PCR amplification of the psmB gene as described above, except that the oligonucleotide CTGCCCATATGACAACTACCGTAGG (oligo _8aa) was used for annealing to the 5' end of psmB to generate plasmid pMT7. Alterations in the N-terminal region of the mature form of the  subunit were generated by using derivations of oligo _8aa for PCR amplification in which A12G, A12T, and A15G were introduced to generate Thr1Ala, Thr1Ser, and Thr2Ala, respectively. Mutations were confirmed by DNA sequence analysis.

Transmission electron microscopy. Isolated 20S proteasomes produced in E. coli and authentic 20S proteasomes purified from M. thermophila were placed on 200-mesh grids coated with either Formvar or carbon films and briefly stained with 1% aqueous uranyl acetate. Some preparations were prefixed with 2% cacodylate-buffered glutaraldehyde before staining. Samples were viewed and photographed on a Zeiss EM-10CA transmission electron microscope operated at 80 kV.

	RESULTS AND DISCUSSION

Top Abstract Introduction Materials & Methods Results & Discussion References

Heterologous production of the M. thermophila 20S proteasome and independent subunits. The 20S proteasome was produced in E. coli by coproduction of  subunits and  prosubunits with the T7 RNA polymerase-promoter system (25). The same system was used to independently produce either  subunits or  prosubunits containing the nine-residue propeptide which is absent in the authentic 20S proteasome purified directly from M. thermophila (Fig. 1). The plasmids used are shown in Table 1. The 20S proteasome and independently produced subunits each comprised 5 to 10% of the total cell protein of E. coli, which facilitated purification to homogeneity, as judged by SDS-PAGE (Fig. 2). The in vivo-assembled, heterologously produced 20S proteasome catalyzed hydrolysis of 20 µM Suc-AAF-Amc and 300 µM Cbz-LLE--Na (carbobenzoxy-LLE--naphthylamide) at 42°C with specific activities (1.3 ± 0.2 and 9.1 ± 0.2 nmol/min/mg of protein) commensurate with those previously reported (14) for the authentic M. thermophila proteasome (1.2 and 8.9 nmol/min/mg of protein) when assayed at the same concentrations of substrates and temperature. Electron microscopy revealed a cylindrical structure comprised of four stacked rings indistinguishable from the quaternary structure of the authentic 20S proteasome (Fig. 3C and D). The results indicate that the 20S proteasome produced in E. coli is similar to the previously described authentic proteasome isolated from M. thermophila (14).

View larger version (9K): [in this window] [in a new window]   FIG. 1.   Deduced and experimentally determined N-terminal sequences of the M. thermophila 20S proteasome  and  subunits. PsmA and PsmB,  subunit and  prosubunit sequences deduced from the psmA and psmB gene sequences shown in uppercase letters; -1 and -2, experimentally determined sequences of the  subunit from the authentic 20S proteasome purified directly from M. thermophila; -3, experimentally determined sequence of the  subunit produced in E. coli either independently or in the 20S proteasome; -1, experimentally determined sequence obtained for either the mature  subunit from the authentic 20S proteasome or the mature  subunits from the heterologously produced 20S proteasomes assembled either in vivo or in vitro; -2, experimentally determined sequence of the  prosubunit independently produced in E. coli. X, uncertain amino acid assignment. The bases in boldface are putative ribosome binding sites.

View larger version (53K): [in this window] [in a new window]   FIG. 2.   SDS-PAGE of the authentic and heterologously produced M. thermophila 20S proteasome and individual  or  subunits. Lanes: 1, 20S proteasome produced in E. coli; 2,  subunit and  prosubunit independently produced in E. coli, combined in vitro, and incubated for 90 min at 37°C; 3,  prosubunit independently produced in E. coli; 4,  subunit independently produced in E. coli; 5, authentic 20S proteasome purified from M. thermophila. Proteins were stained with Coomassie blue R-250. Molecular size standards are indicated on the right.

View larger version (174K): [in this window] [in a new window]   FIG. 3.   Transmission electron micrographs of negatively stained M. thermophila 20S proteasomes and subunits. (A)  subunit produced in E. coli independently of the  prosubunit. Seven-membered ring structures (7) with no apparent central pore are visible (arrowheads). (B)  prosubunit produced in E. coli independently of the  subunit. (C) Authentic 20S proteasome purified from M. thermophila. End-on views (single arrow and arrowheads) and lateral views (double arrowheads) of the cylindrical 20S proteasome comprised of four stacked (7777) rings. (D) 20S proteasome produced in E. coli. The structures are indistinguishable from those in C. (E) The 20S proteasome assembled in vitro from 7 and  prosubunits independently produced in E. coli. The structures are indistinguishable from those in C and D. Bars, 50 nm.

In vitro assembly of the 20S proteasome. When independently produced  ring structures and  prosubunits were purified and reconstituted in subunit equimolar amounts at pH 7.2, approximately 50% of the  prosubunit was processed, as determined by SDS-PAGE (Fig. 2). Sequencing identified an N-terminal threonine for the processed  subunits that was identical to the  subunit in the authentic 20S proteasome (Fig. 1). Mature  subunits were not detected in the absence of the  subunit rings (Fig. 2), which indicates that processing is dependent on the  ring. Gel filtration chromatography resolved a 645-kDa protein from the reconstitution mixture, which was judged homogeneous by SDS-PAGE. The purified protein catalyzed hydrolysis of 20 µM Suc-AAF-Amc and 300 µM Cbz-LLE-Na with specific activities (1.3 ± 0.2 and 9.1 ± 0.2 nmol/min/mg of protein) identical to those of the in vivo-assembled, heterologously produced 20S proteasome reported here and similar to those of the previously reported (14) authentic 20S proteasome purified from M. thermophila (1.2 and 8.9 nmol/min/mg of protein). Electron microscopy revealed a cylindrical structure comprised of four stacked rings indistinguishable from the quaternary structure of the authentic 20S proteasome (Fig. 3E). These results indicate that a fully active 20S proteasome was assembled in vitro. Both maturation of the  prosubunit (Fig. 4) and assembly of the 20S proteasome (Fig. 5) were optimal between 37 and 42°C.

View larger version (23K): [in this window] [in a new window]   FIG. 4.   Temperature-dependent processing of the M. thermophila  prosubunit. Purified 7 rings and  prosubunits were combined in subunit equimolar amounts (15 µM, final concentration) and incubated for 60 min at 16°C (lane 1), 21°C (lane 2), 30°C (lane 3), 37°C (lane 4), 42°C (lane 5), 50°C (lane 6), 55°C (lane 7), 60°C (lane 8), or 70°C (lane 9). A sample of the protein mixture (1.1 µg) was analyzed by SDS-PAGE by using 12% polyacrylamide. Proteins were stained with Coomassie blue R-250. Molecular size standards are indicated on the right.

View larger version (54K): [in this window] [in a new window]   FIG. 5.   Temperature-dependent assembly of the M. thermophila 20S proteasome. The purified 20S proteasome produced in E. coli is shown in lane 1. Purified 7 rings and  prosubunits independently produced in E. coli were combined in subunit equimolar amounts (15 µM) and incubated for 60 min at 16°C (lane 2), 21°C (lane 3), 30°C (lane 4), 37°C (lane 5), 42°C (lane 6), 50°C (lane 7), 55°C (lane 8), or 60°C (lane 9). Purified 7 rings produced in E. coli independently of  prosubunits are in lane 10. Samples (1.1 µg) were analyzed by nondenaturing electrophoresis using 2.0% agarose. Proteins were stained with Coomassie blue R-250. The 7777 20S proteasome, a putative 77 structure, and 7 rings are indicated by arrowheads (right). The unincorporated  prosubunits eluted from the gel and were not detectable.

Multisubstrate activity. Heterologous production of the M. thermophila 20S proteasome in vivo by coproduction of  subunits and  prosubunits in E. coli facilitated the isolation of amounts which enabled an examination of the multisubstrate activity with a variety of fluorogenic and chromogenic small-peptide substrates (Table 2). The greatest activity was obtained with Cbz-LLE-Na, in which the peptide bond was cleaved carboxyl to the acidic glutamate residue (PG activity). Substantial activity was also obtained with Suc-LLVY-Amc and Suc-AAF-Amc, in which the peptide bonds carboxyl to the aromatic tyrosine and phenylalanine residues were cleaved (CL activity) at 73 and 38% of the PG activity. This result contrasts with that obtained with the 20S proteasome from T. acidophilum, which cleaves Cbz-LLE-Na at only 7 to 8% of the rate of Suc-LLVY-Amc hydrolysis (1), suggesting significant differences in the active sites between these two archaeal 20S proteasomes. Minor TL activity was measurable with the substrates Benz-FVR-Amc (N-benzoyl-FVR-Amc) and Boc-FSR-Amc (N-t-butoxycarbonyl)-FSR-Amc (Table 2); however, the activity was only 2% of the PG activity. Significant SNAAP activity was not detected. The M. thermophila 20S proteasome also catalyzed hydrolysis of a variety of proteins (see Table 4); however, proteolysis was only measurable at temperatures above 50°C (data not shown), which suggests that substrate proteins must be at least partially unfolded prior to degradation.

View larger version (21K): [in this window] [in a new window]   FIG. 6.   Effects of temperature and pH on the activity of the M. thermophila 20S proteasome. (A) The heterologously produced 20S proteasome was assayed for PG () or CL () activity at the indicated temperatures by using (final concentrations) 250 µM Cbz-LLE-Na and 6% (vol/vol) dimethyl sulfoxide () or 20 µM Suc-LLVT-Amc and 0.4% dimethyl sulfoxide (). Specific activities are expressed as nanomoles of product per minute per milligram of protein. (B) The heterologously produced 20S proteasome was assayed for PG (, , ) or CL (, , ) activity at 37°C and the indicated pH by using (final concentrations) 150 µM Cbz-LLE-Na and 6% (vol/vol) dimethyl sulfoxide (, , ) or 20 µM Suc-LLVY-Amc and 0.4% (vol/vol) dimethyl sulfoxide (, , ). Reaction mixtures contained the following buffers (final concentrations): 50 mM morpholineethanesulfonic acid (, ), 100 mM Tris-Cl (, ), or 50 mM (, ). Specific activities are expressed as nanomoles of product per minute per milligram of protein.

Active-site analysis of multisubstrate activity. The N-terminal Thr¹ O of the 20S proteasome  subunit is presumed to act as the nucleophile in hydrolysis of peptide bonds, as determined by both the crystal structure of the T. acidophilum 20S proteasome in complex with an inhibitor (13) and replacement of  subunit Thr¹ with Ala, which abolishes CL activity (23). The discovery that the natural inhibitor lactacystin becomes covalently linked to N-terminal Thr¹ of  subunits of the eucaryal 20S proteasome supports this mechanism (7). Recent genetic analysis of the yeast 20S proteasome shows that three distinct -type subunits (Pre3, Pup1, and Pre2), each with an N-terminal Thr¹ active site, are responsible for PG, TL, and CL activities (11). Clearly, with only one type of  subunit, this basis for multisubstrate activity cannot apply to the archaeal 20S proteasome. The CL, PG, TL, and protein-hydrolyzing activities of the M. thermophila 20S proteasome permitted an investigation of the basis for the multisubstrate activity of the archaeal proteasome by site-directed replacement of potential active-site residues in the  subunit. The experiments were performed with 20S proteasomes assembled in vivo by coproduction of  and subunits in E. coli. The subunit lacks the propeptide, except for an N-terminal methionine (Met¹Thr¹Thr²Thr³Val⁴Gly⁵Val⁶Val⁷...). The activities of the unaltered 20S proteasome (see Table 5) were similar to those reported in Tables 2 and 4, which indicated that the N-terminal methionine of the subunit was removed by E. coli aminopeptidase, exposing the essential N-terminal threonine (Thr¹). Electron micrographs (not shown) of 20S proteasomes altered by amino acid replacements revealed quaternary structures for each which resembled those of the authentic 20S proteasome purified from M. thermophila. Thus, the effects of amino acid substitutions on the multisubstrate activity were independent from effects on processing of the  prosubunit and assembly of the 20S proteasome.

View this table: [in this window] [in a new window]   TABLE 5.   Small-peptide- and protein-hydrolyzing activities of M. thermophila 20S proteasomes altered by amino acid replacements in the  subunit

The function of Lys³³ in catalysis. The crystal structure of the T. acidophilum 20S proteasome indicates that Lys³³ is in close proximity to Thr¹, where it is proposed to function either directly or indirectly to strip a proton from the initial attacking nucleophile (Thr¹ O). The Lys³³Arg replacement in the M. thermophila enzyme led to significant reduction of all activities (Table 5), further supporting the idea of one active site for multisubstrate activity. Although the Lys³³Ala replacement eliminated CL and PG activities and greatly reduced proteolysis, TL activity was threefold greater. The reason for increased TL activity is unknown; however, it is possible that Lys³³ prevents active-site access of substrates with basic P₁ residues. The crystal structure of the T. acidophilum 20S proteasome suggests that the side-chain amino group of Lys³³ and the NH₂ terminus of the  subunit (Thr¹ N) are in close proximity to the attacking Thr¹ O and that, therefore, either one is positioned for the proton acceptor-donor function (13). It was proposed that Lys³³ is positively charged and unlikely to accept a proton; however, direct evidence has not been reported for this hypothesis. Although the quaternary structure was preserved, replacement of Lys³³ with Arg in the T. acidophilum 20S proteasome completely abolished CL activity (23). Unfortunately, the complete loss of activity did not resolve the question of whether Lys³³ is directly involved in proton transfer and, therefore, essential for catalysis or whether it functions only indirectly to polarize the Thr¹ N. The Lys³³Arg replacement preserved a substantial amount of all of the activities of the M. thermophila enzyme (Table 5). The side chain of Arg (pK_a, 12.5) is more likely to be protonated than Lys³³ (pK_a, 10.5); thus, these results support the idea that the positive charge of the side-chain amino group of Lys³³ only assists in catalysis by polarization of the Thr¹ N, which functions as the direct proton acceptor-donor in catalysis.

Conclusions. The 20S proteasome from M. thermophila is only the second to be characterized from the Archaea domain. This 20S proteasome, the first from a methanoarchaeon, has features which distinguish it from the T. acidophilium 20S proteasome. The ability to assemble the M. thermophila 20S proteasome in vitro demonstrated that accessory proteins are not essential for processing or assembly. Investigation of the multisubstrate activity has extended an understanding of the archaeal 20S proteasome in general and the active site in particular. Our results support the previously proposed role for Lys³³ in polarization of the active-site Thr¹ N.