Previous Article | Next Article ![]()
J Bacteriol, March 1998, p. 1525-1532, Vol. 180, No. 6
Department of Bacteriology, University of
Wisconsin, Madison, Wisconsin 53706
Received 7 November 1997/Accepted 6 January 1998
rRNA transcription in Escherichia coli is activated by
the FIS protein, which binds upstream of rrnp1
promoters and interacts directly with RNA polymerase. Analysis of the
contribution of FIS to rrn transcription under changing
physiological conditions is complicated by several factors: the wide
variation in cellular FIS concentrations with growth conditions, the
contributions of several other regulatory systems to rRNA synthesis,
and the pleiotropy of fis mutations. In this report, we
show by in vivo footprinting and Western blot analysis that occupancy
of the rrnBp1 FIS sites correlates with
cellular levels of FIS. We find, using two methods of measurement
(pulse induction of a FIS-activated hybrid promoter and primer
extension from an unstable transcript made from
rrnBp1), that the extent of transcription
activation by FIS parallels the degree of FIS site occupancy and
therefore cellular FIS levels. FIS activates transcription throughout
exponential growth at low culture density, but
rrnp1 transcription increases independently of
FIS immediately following upshift, before FIS accumulates. These
results support the model that FIS is one of a set of overlapping signals that together contribute to transcription from
rrnp1 promoters during steady-state growth.
The seven rRNA (rrn)
operons in Escherichia coli each have two promoters,
p1 and p2 (Fig.
1). The rate of rRNA transcription increases with increasing steady-state growth rate and begins to change
within 1 min of an improvement in the nutritional quality of the medium
(upshift) (19, 35). The rrnp1
promoters are three- to fivefold more active than the
p2 promoters during rapid growth (1, 12,
34) and are responsible for growth rate-dependent regulation of
rRNA transcription (13, 24).
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Activation of Escherichia coli rRNA
Transcription by FIS during a Growth Cycle
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

View larger version (13K):
[in a new window]
FIG. 1.
The rrnB promoter region. (A) FIS sites I, II
and III, UP elements,
10 and
35 hexamers, transcription start sites
(+1), and transcripts from the p1 and
p2 promoters (arrows) are indicated. (B) DNA
sequence of the region containing FIS sites I, II, and III in
rrnBp1. G residues protected by FIS against
methylation by DMS (Fig. 2 and reference 8) are
indicated with asterisks. Lines indicate sequences protected by FIS
against DNase I cleavage (48).
Several factors contribute to the regulation and extremely high
activity of the p1 promoters (11, 25,
32). In rrnBp1, the
10 and
35 hexamers
(recognized by the sigma subunit of RNA polymerase [RNAP]) are near
consensus. The core promoter (
40 to +1) is stimulated 30- to 60-fold
by an upstream (UP) element (the binding site for the RNAP alpha
subunit [Fig. 1]) (7, 15, 47, 49). Additionally,
rrnBp1 is stimulated by the 11.2-kDa transcription factor FIS (factor for inversion stimulation). FIS binds
to three sites, centered at
71 (site I),
102 (site II), and
143
(site III) relative to the transcription start site, and stimulates
transcription approximately fivefold in vivo (Fig. 1) (8, 9, 21,
22, 48). FIS dimers bind noncooperatively at adjacent sites in
rrnBp1 (8). FIS bound at site I is
sufficient to account for most of the effect of FIS on
rrnBp1, primarily through direct interactions
with the RNAP alpha subunit (8, 9, 22, 39, 48). Deletion of
an A:T base pair at position
72 (the
72 mutation) (i) eliminates
FIS binding at site I and activation in vitro and (ii) reduces promoter
activity in strains with a wild-type fis gene but not in
fis::kan strains (47, 48). Because of other regulatory systems acting on
rrnp1 core promoters that can compensate for the
loss of activation (18, 27), transcription from a wild-type
rrnBp1 containing FIS sites is not reduced in a
fis::kan strain (48). The
presence of overlapping regulatory systems has made it difficult to
determine the extent of the contribution of FIS to
rrnp1 promoter activity at different times and
under different growth conditions.
FIS is active in many cellular processes in addition to activation of rrnp1 promoters, although the fis gene is not essential for growth at 37°C (28). FIS plays a role in Hin- and Gin-mediated DNA inversion (28, 33), Tn5 transposition (52), oriC-directed DNA replication (16), transcriptional repression (53), and activation of transcription of tRNA operons and the proP promoter (14, 40-43, 54), as well as rrnp1 promoters (30, 48), and in many other systems (17, 20). Strains deleted for fis show slightly reduced growth rates in rich media and have altered morphology at high temperatures, and some fis strains have a longer lag phase before attaining logarithmic growth upon dilution of stationary-phase cultures (16, 42, 45). It is not certain which function(s) of FIS is responsible for the pleiotropic effects of fis mutations.
It was proposed that FIS may account for the rapid increase in rrnp1 transcription during transition from stationary- to exponential-phase growth (41, 48). In agreement with this proposal, intracellular FIS concentrations vary widely with changing growth phase and rate (3, 43). FIS is present in very low or undetectable quantities in stationary-phase cells but accumulates to more than 50,000 molecules per cell within two generations of growth after stationary-phase cultures are diluted into fresh rich medium. Production of fis mRNA ceases and cellular levels of FIS decrease sharply as cells enter stationary phase. FIS concentrations are lower in cells grown in poor medium (3, 43). However, previous studies have not established whether the variation in FIS levels is important to rRNA transcription activation; e.g., it is conceivable that FIS site occupancy is complete at low FIS concentrations and that high FIS levels are required only for other cell functions.
We have examined the relationship between FIS concentration, FIS site occupancy, and FIS-dependent activation of rrnBp1 at different stages of growth, using a variety of experimental approaches to circumvent the complications described above. We find that FIS increases rrnBp1 transcription during exponential growth but is not responsible for the increase in rrnBp1 transcription at the earliest times following dilution of cells from stationary phase. This finding supports a model in which FIS is one of several systems that influence rrn promoter function to different extents depending on nutritional conditions and allows efficient production of rRNA during rapid logarithmic growth. The approaches used here should be generally applicable to the study of transcription in other systems where the interpretation of experimental conclusions is complicated by redundancy, pleiotropy, or transiency of expression.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids and strains.
Bacterial strains and plasmids are
listed in Table 1. The
fis::kan767 allele has been described
elsewhere (28). Lysogens carried single copy
prophages
containing promoter-lacZ constructs in one of two fusion
systems (system I or II, as described in reference
47). The plasmid vectors pSL6 and pRLG770 have been described previously (21, 48). pRLG770 has rrnB
T1 and T2 transcription terminators approximately 170 bp downstream of
a site for promoter fragment insertion (48).
|
In vivo DMS footprinting.
The in vivo methylation protection
procedure was modified from that of Thompson et al. (51).
Saturated cultures grown for 13 to 24 h were diluted into
prewarmed LB containing 100 µg of ampicillin per ml at a starting
optical density at 600 nm (OD600) of 0.03 to 0.1 and grown
at 30°C with aeration (doubling time of ~40 min). Aliquots of
culture sufficient to yield plasmid DNA for analysis (e.g., ~100 ml
of culture at an OD600 of ~0.1 to 0.3) were removed at
intervals to an Erlenmeyer flask, and dimethyl sulfate (DMS) was added
to a final concentration of 0.2 to 0.5% (vol/vol) and swirled for
30 s. (All work with DMS was carried out in a fume hood except
centrifugation of cells, which was carried out in bottles sealed with
O-rings). The cells were poured immediately over a half volume of ice
(prechilled to
20°C) and mixed to melt the ice, and EDTA was added
to a final concentration of 40 mM. For subsequent steps, all
containers, centrifuge bottles, rotors, media, and buffers were
prechilled. The chilled culture was centrifuged to pellet cells, and
cells were washed with LB, centrifuged again, resuspended in 2.5 ml of
20% sucrose-0.01 M Tris-Cl (pH 8.1), and kept on ice for 30 min.
Lysozyme (0.25 ml of freshly dissolved 10-mg/ml solution in 0.25 M
Tris-Cl [pH 8.1]) was added, and cells were incubated for 5 min on
ice, followed by addition of 0.3 ml of 0.2 M EDTA and further
incubation for 10 min on ice. A solution of 0.2% Triton X-100-25 mM
EDTA-50 mM Tris-Cl (pH 8.1) was added slowly with stirring on ice
(~20 min). The cleared cell lysate was centrifuged at 25,000 × g at 5°C for 1 h. Sodium acetate was added to the
supernatant to 0.2 M, followed by two extractions with an equal volume
of phenol and two extractions with phenol-chloroform (1:1). Plasmid DNA
was precipitated with 2 volumes of ethanol, pelleted, washed with
ethanol, and resuspended in 10 mM Tris-Cl (pH 8.1).
32P]dATP
(38), and digested with XhoI to generate a
~300-bp fragment. The labeled fragment was isolated from an
acrylamide gel and further purified and concentrated by using
benzolated naphthylated DEAE-cellulose (23). Strand cleavage
at G residues methylated by DMS was carried out in 100 µl of
piperidine at 95°C for 30 min, and then piperidine was thoroughly
evaporated in a vacuum centrifuge. Samples were resuspended in
distilled water and dried before resuspension in gel loading buffer (8 M urea, 0.5× TBE [0.1 M Tris, 0.1 M boric acid, 2.5 mM EDTA], 0.05%
xylene cyanol, 0.05% bromophenol blue). Samples containing equivalent
amounts of radioactivity were electrophoresed on 8% acrylamide-7 M
urea gels containing 0.5× TBE, dried, and autoradiographed. DMS
footprints with purified FIS were carried out in vitro as described
elsewhere (8). This procedure precluded analyzing all time
points in one experiment. Three experiments were used to cover the
range of times indicated in Fig. 3.
The extent of protection of the FIS sites at each time point was
determined by scanning autoradiographs with a Hoefer densitometer. Band
intensities of the specific signals for each FIS site (
67,
77, and
78 for site I;
109 for site II; and
139 and
150 for site III)
were normalized to a control band (G at position
58) that was
determined previously from in vitro experiments to be unaffected by FIS
binding. Positions
77 and
78 in site I were quantified together as
one signal. Normalized values for band intensities were used to
calculate the percent protection at each time point. It was determined
that cells that remained in stationary phase for less than about
24 h retained some residual FIS. Therefore, in a few experiments
it was necessary to correct for protection at early time points
resulting from residual FIS in the inoculum. In the figures, maximal
protection is defined as 100% and no protection is defined as 0%,
comparable to the signal observed in a strain lacking the
fis gene, or in vitro in the absence of FIS, or in cells
remaining in stationary phase more than about 24 h. Eighty-five percent protection of signals in site I represents maximal occupancy observed in vivo and is interpreted to reflect complete site occupancy since it is equivalent to the maximal protection of site I observed with saturating amounts of FIS in vitro. The residual cleavage probably
reflects partial accessibility of these positions to DMS in the
presence of bound protein.
Western blotting. Cultures of RLG911 (fis wild type) and RLG921 (fis::kan767) grown for 24 h at 30°C were diluted into fresh LB and grown under the same conditions as in the in vivo footprinting experiments. Aliquots of 0.25 to 1 ml of culture were removed at various times, pelleted in a microcentrifuge, resuspended in sample buffer (37), boiled for 5 min, sonicated, separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (37), blotted onto nitrocellulose (Bio-Rad), and probed with a polyclonal antibody to FIS (a gift from R. Johnson and C. Ball, University of California at Los Angeles). The FIS-antibody complexes were visualized by enhanced chemiluminescence (ECL kit; Amersham Life Science). No signal was observed from extracts made from RLG921 (data not shown).
In vitro transcription.
In vitro transcription was carried
out essentially as described previously (48). Briefly,
25-µl reaction mixtures containing 0.2 nM supercoiled plasmid DNA
were preincubated for 10 min at 22°C with 0, 45, or 90 nM purified
FIS in a mixture containing 10 mM Tris-Cl (pH 8.0), 10 mM
MgCl2, 150 mM NaCl, 1 mM dithiothreitol, 100 µg of bovine
serum albumin per ml, 500 µM ATP, 100 µM CTP and GTP, and 10 µM
UTP with [
-32P]UTP (Dupont NEN) at a specific activity
of ca. 30 ci/mmol. Transcription was initiated by addition of purified
RNAP (4 nM) and terminated after 15 min at 22°C by addition of 25 µl of 7 M urea-10 mM EDTA-1% sodium dodecyl sulfate-2×
TBE-0.05% bromophenol blue-0.025% xylene cyanol. Equivalent
aliquots of these samples were electrophoresed on 8% acrylamide-7 M
urea gels containing 1× TBE for 2 h at 250 V.
Determination of promoter activities in vivo.
-Galactosidase activities were determined from
promoter-lacZ fusions in
lysogens grown in LB with 2 mM
isopropylthiogalactopyranoside (IPTG) at 30°C for four generations
(to an OD600 of about 0.4 [36]).
cloning system as the test promoter but with a
different promoter fragment endpoint (+50 instead of +1), resulting in
a primer extension product of different length than that from the test
promoter. Approximately 15 µg of RNA (including recovery marker) was
mixed with 0.5 pmol of a 21-nucleotide
-32P-end-labeled
primer (sequence 5'TGGTGTTCGTCCCGGCTGTAA3') and Sequenase
reaction buffer (U.S. Biochemical). Following annealing, extension was
performed at 45°C as described previously (31). After
electrophoresis (10), bands were visualized and quantified with a PhosphorImager (Molecular Dynamics). Extension products were
corrected for differences in culture density by normalization to
OD600 at the time of sampling and for differences in RNA
recovery, primer annealing, primer extension, and gel loading by
normalization to the recovery marker.
Measurement of RNA half-lives. Half-lives of the RNAs used in the quantitative primer extension experiments were determined after 5 and 60 min of growth in LB. Rifampin was added to aliquots of RLG1829 to a final concentration of 200 µg/ml, samples were removed for RNA extraction every 60 s, and RNAs were extracted, processed, and analyzed by primer extension as described above.
| |
RESULTS |
|---|
|
|
|---|
High levels of FIS are required for complete occupancy of
rrnBp1 FIS sites in vivo.
Intracellular
levels of FIS vary widely with growth rate and growth phase. However,
since FIS has so many cellular roles, it was possible that the
variation in FIS levels was not related to its role in rRNA
transcription. Therefore, we compared occupancy of the three
rrnBp1 FIS binding sites with the intracellular
concentration of FIS. Occupancy was assayed on plasmid-borne
rrnBp1 throughout a growth cycle in rich medium
by in vivo footprinting with DMS. Certain G residues in a protein
binding site may be protected against methylation or show enhanced
methylation when the protein is bound (29). We previously
identified G residues protected by FIS in each of the three
rrnBp1 binding sites, using DMS footprinting in
vitro (8). These included top-strand positions
67,
77, and
78 in site I,
109 in site II, and
139 and
150 in site III
(Fig. 1B; Fig. 2, lanes 3). The same G
residues were protected in vivo during logarithmic growth (Fig. 2,
lanes 4) but not in stationary-phase cells, where FIS is not detectable
(3) (Fig. 3B), or in
fis::kan cells (Fig. 2A, lanes 5 and
6). To further confirm that the in vivo protection signals reflected
FIS binding, in vivo footprinting was carried out with
rrnBp1 containing a mutation (
72) that
abolishes FIS binding to site I in vitro (48). As expected,
site I in the mutant construct was not protected under conditions where
sites II and III were occupied by FIS (Fig. 2A, lane 7).
|
|
67,
77, and
78, was 20% at 0.25 h after dilution, was at
its maximal observed level (100% occupancy) at 1.5 to 1.6 h, and
remained above 80% of maximum during mid-exponential growth phase, up
to 3.5 h. Occupancy declined to <60% of maximum after 4.5 h
as cells approached stationary phase. Complete loss of protection by
FIS was observed only after cells had been in culture for at least
24 h. Occupancy of FIS sites II and III followed a similar
pattern, although protection of FIS site II was slightly less complete
(data not shown). The length of time during which high levels of
protection were observed depended on the density of the starting
culture and thus on the time the cells remained in exponential phase
growth before the transition to stationary phase began (data not shown
and reference 1). We also observed differences in
the extent of methylation of two G residues in the core promoter (
8G
and
34G) between stationary-phase and logarithmic growth (data not
shown). These are positions where methylation by DMS is affected by
bound RNAP in vitro (38). No evidence was found for
interactions of other proteins with rrnBp1.
To determine whether the level of FIS site occupancy correlated
temporally with FIS concentration, we performed Western blotting on
extracts made from a culture grown under conditions similar to those
used in the in vivo footprinting assays (Fig. 3B and C). FIS was barely
detectable in stationary-phase cells. The concentration of FIS
increased to 10% of its highest level within 0.5 h of dilution, was at its highest levels at 1.5 to 3 h, and then declined to 10%
of its maximum level by 6 h, consistent with previous reports (3, 43). The maximum FIS site occupancy correlated with the highest concentration of FIS observed, and occupancy was partial at
intermediate concentrations of FIS. However, the resolution of these
experiments was insufficient to determine whether maximal FIS site
occupancy requires maximal, rather than slightly lower, levels of FIS.
We conclude that occupancy of the rrnBp1 FIS
sites in vivo correlates qualitatively with cellular FIS concentration and is complete only at very high concentrations of FIS.
High cellular levels of FIS are required for maximal transcription
activation.
Since close to maximal occupancy of the FIS sites in
the rrnBp1 promoter in vivo correlated with high
concentrations of FIS, we predicted that maximal activation of rRNA
transcription would also correlate with high concentrations of FIS. To
determine the extent of FIS-dependent activation of transcription at
different stages of growth, we used inducible hybrid promoters in which either a wild-type (rrnB-lac) or a
72 mutant
(rrnB-
72-lac) rrnBp1 FIS site I was fused to the lac core promoter (Fig. 4A and
reference 47). We used constructs with only FIS site
I, since this FIS site is sufficient for a majority of activation,
occupancy of sites II and III parallels that of site I, and use of site
I allowed comparison with a non-FIS binding construct differing by only 1 bp. The position of the FIS site relative to the
35 consensus hexamer is the same in these promoters as in
rrnBp1, but the lac core promoter
region is not subject to the growth rate-dependent and stringent
control systems that regulate the rrnBp1 core
promoter (5, 31). The hybrid promoters are regulated by
lac repressor binding to the lac operator site,
allowing induction by IPTG and estimation of synthesis rates during a
brief 15-min period of induction. The level of activation by FIS is
calculated as the ratio of activities of the wild-type and
72
promoters.
-galactosidase activities from wild-type and
mutant promoters after several generations of growth under inducing
conditions (2 mM IPTG). The activity of the hybrid promoter with the
wild-type FIS site was five- to sixfold higher than the activity of the promoter with the mutant FIS site (3,101 versus 559 U [Fig.
4A]), a difference comparable to that
seen with rrnBp1 constructs containing only FIS
site I (8, 48). FIS-dependent activation of the hybrid
promoter constructs was also observed in vitro with purified FIS
protein (Fig. 4B), confirming that the hybrid promoter is activated
directly by FIS. The wild-type and
72 mutant hybrid promoters had
similar activities in a fis::kan strain
(680 versus 510 U [Fig. 4A]), and these activities were comparable to
the activity of the
72 promoter in the wild-type strain, indicating that the difference in activity seen in the wild-type strain is due to
FIS. These results contrast with experiments with the
rrnBp1 promoter, where compensating regulatory
mechanisms acting on the core promoter increased promoter activity in a
fis::kan strain (48).
|
-galactosidase from mutant and wild-type hybrid
promoter-lacZ fusions during 15-min pulses of induction with 2 mM IPTG was determined at different times during the growth of a
culture (Fig. 5). No activation was
detected in the first 15 min of growth for cultures grown in LB (Fig.
5A), but activation was observed after 45 min and was at its maximal
level of five- to sixfold approximately 1.5 to 3 h after dilution.
Activation declined as cells approached stationary phase. Thus,
activation by FIS followed the time course of site I occupancy observed
in DMS footprints (Fig. 3A) and correlated with increased FIS
concentrations observed in Western blots (Fig. 3B and C).
|
rRNA synthesis and growth increase before FIS-dependent activation. We and others have suggested previously that FIS may be important for the rapid increase in rRNA transcription upon outgrowth from stationary phase (17, 41, 42, 45, 48). In the experiments with hybrid promoters described above, FIS did not contribute measurably to promoter activity during the first 15 min of growth, and activation of transcription by FIS did not reach maximal levels until more than an hour after dilution into rich medium (Fig. 5A). However, the 15-min pulse times in these experiments were too long to provide an accurate estimate of the kinetics of this response. To directly and more precisely measure the contribution of FIS to the increase in rrnBp1 promoter activity during the first hour following dilution of the culture, we used quantitative primer extension (31) to measure the synthesis of an unstable mRNA expressed from the rrnBp1 promoter (as opposed to the hybrid promoter).
We constructed rrnBp1 promoter-lacZ fusions containing either the wild-type or the
72 mutant FIS site I. These promoters made identical mRNAs with a half-life that did not vary
in a growth phase-dependent manner over the time course of the
experiment (approximately 60 s when measured either 5 or 60 min
after dilution of cells into fresh medium [see Materials and Methods;
data not shown]). This short half-life allowed estimation of the rate
of RNA synthesis by measuring the amount of RNA present. A recovery marker RNA was introduced during the RNA extraction process to correct
for variable recoveries and for variable efficiency of primer annealing
or extension. The marker RNA annealed to the same primer as was used
for extension of the transcripts from the rrnBp1
promoters but yielded an extension product of different length.
Cultures carrying either a wild-type or a
72 mutant
rrnBp1-lacZ fusion were sampled at 5, 10, 15, 25, 35, 45, and 60 min following dilution of stationary-phase
cells into fresh LB. After RNA extraction, primer extension and gel
electrophoretic separation (Fig. 6A), the
products were quantified by phosphorimaging and normalized to
the recovery marker in the same sample (Fig. 6B). A large increase in
RNA synthesis rate was observed for both the wild-type and mutant
promoters during the first 20 min after dilution. This increase was the
same for both promoters, indicating that a mechanism other than
activation by FIS was responsible. A statistically significant
difference in the activities of the two promoters was observed
approximately 25 min following dilution, indicating the onset of
activation by FIS. At 60 min, the wild-type promoter was approximately
twofold more active than the non-FIS-activated
72 mutant promoter.
Maximal FIS-dependent activation of rrnBp1 was
achieved at a later time (data not shown), consistent with the kinetics
of activation of the rrn-lac hybrid promoter (compare Fig.
5A and 6B). Thus, FIS contributed to rRNA transcription during exponential growth, but only after other system(s) had increased the
rRNA synthesis rate following the upshift. The timing of this activation is consistent with the kinetics of occupancy of
rrnBp1 FIS site I (Fig. 2), FIS concentration
(Fig. 3), and activation of the hybrid promoter (Fig. 5).
|
| |
DISCUSSION |
|---|
|
|
|---|
We investigated FIS binding to the rrnBp1 FIS sites and the contribution of FIS to rRNA synthesis during different phases of growth. The multiple regulatory systems acting on the rrnBp1 promoter and the pleiotropy of fis mutations required novel techniques to study the contribution of FIS to rrnp1 transcription without interference from other systems. By comparing activities of promoters with wild-type and mutant FIS binding sites, we were able to avoid the complications of working with strains with altered growth phenotypes caused by fis mutations. By using a hybrid promoter activated by FIS, we were able to monitor effects of FIS independently of regulatory systems acting on the rrnBp1 core promoter. Similar approaches should be applicable to the study of other systems involving pleiotropic activators or promoters subject to multiple regulatory inputs.
We observed that FIS was present at very low levels in stationary-phase cells, increased dramatically after the cells were diluted into fresh media, and was at its maximal concentration by 1.5 h after the start of growth, consistent with previous reports (3, 43). Maximal occupancy of rrnBp1 FIS site I in vivo, determined by footprinting with DMS, and maximal activation of transcription by FIS, determined by analysis of the hybrid promoter and by primer extension, correlated with high cellular FIS levels. The duration of the period of maximal activation varied as a function of the initial density of the batch culture and thus with the number of generations of logarithmic growth before the onset of stationary phase. Activation by FIS was not limited to a brief time interval following upshift as has been implied in previous studies but rather persisted until the culture was about one doubling from entering stationary phase (Fig. 5). The mechanism regulating fis to produce such a pattern of expression is not yet understood. Transcription of fis is known to be affected, either directly or indirectly, by FIS itself, integration host factor and ppGpp. However, these factors appear to affect the level, but not the timing, of FIS expression (3, 44-46).
It was previously suggested that FIS may be responsible for mediating the initial increase in rRNA synthesis upon dilution of stationary-phase cells into fresh medium (41, 43, 48). However, we observed a large increase in transcription from both the wild-type and FIS site I mutant rrnBp1 promoters immediately following dilution. Activation of the wild-type rrnBp1 by FIS was not detected until the cells had achieved their new growth rate, about 20 min following dilution. The rapid increase in transcription from rrnp1 promoters is consistent with previous observations that rRNA production increases too rapidly to result from de novo protein synthesis (19, 35). The thrU (tufB) promoter is also activated by FIS, and its transcription also increases upon upshift independently of fis (43). We suspect that this FIS-independent mechanism is likely to be general to many stable RNA promoters.
The rapid FIS-independent increase in rrnp1 transcription may be attributable to one or more of several regulatory systems that affect rrn expression. rrnp1 transcription is sensitive to the level of the initiating nucleotide (ATP in six rrnp1 promoters and GTP in the seventh). This mechanism contributes to growth rate-dependent regulation of rRNA synthesis (4, 18) and could potentially affect rRNA production upon dilution of stationary-phase cells. However, previous reports suggest that purine nucleoside triphosphate (NTP) concentrations do not increase immediately after upshift (6). The rapid decrease in ppGpp concentration upon upshift (26) may be a more likely contributor to the initial increase in rrnp1 activity following dilution.
The rapid increase in total rRNA production previously reported upon upshift (19) most likely reflects an increase in transcription from both rrnp1 and rrnp2 promoters. Transcripts from rrnp2 promoters increase more rapidly than transcripts from rrnp1 promoters during the first few minutes of upshift (1, 50). The rrnp2 promoters may therefore contribute substantially to the rapid increase in rRNA synthesis during outgrowth. Thus, changes in NTP and/or ppGpp levels (4, 18, 26) and transcription from the rrnp2 promoters could explain the increase in rRNA synthesis during upshift, and these mechanisms could also account for the nearly normal growth and rRNA transcription in strains with fis null mutations.
FIS is an important contributor to the activity of the rrnp1 promoters during logarithmic growth at low densities, acting in conjunction with other mechanisms to ensure production of sufficient rRNA for rapid growth. While having redundant mechanisms for rRNA transcriptional control would be a reasonable strategy for such an important biosynthetic pathway, the different systems may not overlap completely. Understanding the relative contributions of the FIS-dependent, NTP-dependent, and ppGpp-dependent mechanisms to rrnp1 activity, and the relationship between transcription of the p1 and p2 promoters, presents a challenge for the future and will provide a perspective on the interplay of control mechanisms in systems with multiple overlapping regulators.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grant GM37048 from the National Institutes of Health to R.L.G. J.A.A. was supported in part by an NIH predoctoral training grant.
We thank Reid Johnson for antibodies to FIS and members of our lab for discussion and comments on the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Bacteriology, University of Wisconsin, 1550 Linden Dr., Madison, WI 53706. Phone: (608) 262-9813. Fax: (608) 262-9865. E-mail: rgourse{at}bact.wisc.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Appleman, J. A., and R. L. Gourse. Unpublished results. |
| 2. | Bachmann, B. J. 1987. Linkage map of Escherichia coli K-12, edition 7, p. 807-876. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, D.C. |
| 3. |
Ball, C. A.,
R. Osuna,
K. C. Ferguson, and R. C. Johnson.
1992.
Dramatic changes in FIS levels upon nutrient upshift in Escherichia coli.
J. Bacteriol.
174:8043-8056 |
| 4. | Bartlett, M., T. Gaal, W. Ross, and R. L. Gourse. RNA polymerase mutants defective in the NTP-sensing mechanism for growth rate-dependent control of rRNA transcription. Submitted for publication. |
| 5. |
Bartlett, M., and R. L. Gourse.
1994.
Growth rate-dependent control of the rrnB P1 core promoter in Escherichia coli.
J. Bacteriol.
176:5560-5564 |
| 6. | Beck, C., J. Ingraham, O. Maaloe, and J. Neuhard. 1973. Relationship between the concentration of nucleoside triphosphates and the rate of synthesis of RNA. J. Mol. Biol. 78:117-121[Medline]. |
| 7. |
Blatter, E. E.,
W. Ross,
H. Tang,
R. L. Gourse, and R. H. Ebright.
1994.
Domain organization of RNA polymerase subunit: C-terminal 85 amino acids constitute a domain capable of dimerization and DNA binding.
Cell
78:889-896[Medline].
|
| 8. | Bokal, A. J., IV, W. Ross, and R. L. Gourse. 1995. The transcriptional activator protein FIS: DNA interactions and cooperative interactions with RNA polymerase at the Escherichia coli rrnB P1 promoter. J. Mol. Biol. 245:197-207[Medline]. |
| 9. | Bokal, A. J., IV, W. Ross, T. Gaal, R. C. Johnson, and R. L. Gourse. 1997. Molecular anatomy of a transcription activation patch: FIS-RNA polymerase interactions at the Escherichia coli rrnB P1 promoter. EMBO J. 16:154-162[Medline]. |
| 10. |
Borukhov, S.,
V. Sagitov,
C. A. Josaitis,
R. L. Gourse, and A. Goldfarb.
1993.
Two modes of transcription initiation in vitro at the rrnB P1 promoter of Escherichia coli.
J. Biol. Chem.
268:23477-23482 |
| 11. |
Condon, C.,
C. Squires, and C. L. Squires.
1995.
Control of rRNA transcription in Escherichia coli.
Microbiol. Rev.
59:623-645 |
| 12. |
deBoer, H. A., and M. Nomura.
1979.
In vivo transcription of rRNA operons in Escherichia coli initiates with purine nucleotide triphosphates at the first promoter and with CTP at the second promoter.
J. Biol. Chem.
254:5609-5612 |
| 13. |
Dickson, R. R.,
T. Gaal,
H. A. deBoer,
P. L. De Haseth, and R. L. Gourse.
1989.
Identification of promoter mutants defective in growth-rate-dependent regulation of rRNA transcription in Escherichia coli.
J. Bacteriol.
171:4862-4870 |
| 14. |
Emilsson, V., and L. Nilsson.
1995.
Factor for inversion stimulation-dependent growth rate regulation of serine and threonine tRNA species.
J. Biol. Chem.
270:16610-16614 |
| 15. | Estrem, S., and R. L. Gourse. Unpublished data. |
| 16. |
Filutowicz, M.,
W. Ross,
J. Wild, and R. L. Gourse.
1992.
Involvement of FIS protein in replication of the Escherichia coli chromosome.
J. Bacteriol.
174:398-407 |
| 17. | Finkel, S., and R. Johnson. 1992. The FIS protein: it's not just for DNA inversion anymore. Mol. Microbiol. 6:3257-3265[Medline]. |
| 18. |
Gaal, T.,
M. Bartlett,
W. Ross,
C. L. Turnbough, Jr., and R. L. Gourse.
1997.
Transcription regulation by initiating NTP concentration: rRNA synthesis in bacteria.
Science
278:2092-2097 |
| 19. | Gausing, K. 1980. Regulation of ribosome biosynthesis in E. coli, p. 693-718. In G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura (ed.), Ribosomes: structure, function, and genetics. University Park Press, Baltimore, Md. |
| 20. | Gonzalez-Gil, G., P. Bringmann, and R. Kahmann. 1996. FIS is a regulator of metabolism in Escherichia coli. Mol. Microbiol. 22:21-29[Medline]. |
| 21. |
Gosink, K. K.,
W. Ross,
S. Leirmo,
R. Osuna,
S. Finkel,
R. Johnson, and R. L. Gourse.
1993.
DNA binding and bending are necessary but not sufficient for Fis-dependent activation of rrnB P1.
J. Bacteriol.
175:1580-1589 |
| 22. |
Gosink, K. K.,
T. Gaal,
A. J. Bokal, and R. L. Gourse.
1996.
A positive control mutant of the transcription activator protein FIS.
J. Bacteriol.
178:5182-5187 |
| 23. |
Gourse, R. L.
1988.
Visualization and quantitative analysis of complex formation between E. coli RNA polymerase and an rRNA promoter in vitro.
Nucleic Acids Res.
16:9789-9809 |
| 24. | Gourse, R. L., H. A. de Boer, and M. Nomura. 1986. DNA determinants of rRNA synthesis in E. coli: growth rate dependent regulation, feedback inhibition, upstream activation, antitermination. Cell 44:197-205[Medline]. |
| 25. | Gourse, R. L., T. Gaal, M. S. Bartlett, J. A. Appleman, and W. Ross. 1996. rRNA transcription and growth rate dependent regulation of ribosome synthesis in Escherichia coli. Annu. Rev. Microbiol. 50:645-677[Medline]. |
| 26. |
Hernandez, V. J., and H. Bremer.
1990.
Guanosine tetraphosphate (ppGpp) dependence of the growth rate control of rrnB P1 promoter activity in Escherichia coli.
J. Biol. Chem.
265:11605-11614 |
| 27. | Jinks-Robertson, S., R. L. Gourse, and M. Nomura. 1983. Expression of rRNA and tRNA genes in Escherichia coli: evidence for feedback regulation by products of rRNA operons. Cell 33:865-876[Medline]. |
| 28. |
Johnson, R. C.,
C. A. Ball,
D. Pfeffer, and M. I. Simon.
1988.
Isolation of the gene encoding the Hin recombinational enhancer binding protein.
Proc. Natl. Acad. Sci. USA
85:3484-3488 |
| 29. |
Johnsrud, L.
1978.
Contacts between Escherichia coli RNA polymerase and a lac operon promoter.
Proc. Natl. Acad. Sci. USA
75:5314-5318 |
| 30. |
Josaitis, C.,
T. Gaal, and R. L. Gourse.
1990.
Sequences upstream of the 35 hexamer of rrnB P1 affect promoter strength and upstream activation.
Biochim. Biophys. Acta
1050:307-311[Medline].
|
| 31. |
Josaitis, C.,
T. Gaal, and R. L. Gourse.
1995.
Stringent control and growth-rate-dependent control have nonidentical promoter sequence requirements.
Proc. Natl. Acad. Sci. USA
92:1117-1121 |
| 32. | Keener, J., and M. Nomura. 1996. Regulation of ribosome biosynthesis, p. 1417-1431. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: Cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C. |
| 33. |
Koch, C., and R. Kahmann.
1986.
Purification and properties of the Escherichia coli host factor required for inversion of the G segment in bacteriophage Mu.
J. Biol. Chem.
261:15673-15678 |
| 34. |
Lund, E., and J. E. Dahlberg.
1979.
Initiation of Escherichia coli ribosomal RNA synthesis in vivo.
Proc. Natl. Acad. Sci. USA
76:5480-5484 |
| 35. | Maaloe, O., and N. O. Kjeldgaard. 1966. . Control of macromolecular synthesis. Benjamin Press, New York, N.Y. |
| 36. | Miller, J. H. 1972. . Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 37. |
Neville, D. M., Jr.
1971.
Molecular weight determination of protein-dodecyl sulfate complexes by gel electrophoresis in a discontinuous buffer system.
J. Biol. Chem.
246:6328-6334 |
| 38. | Newlands, J. T., W. Ross, K. K. Gosink, and R. L. Gourse. 1991. Factor-independent activation of Escherichia coli rRNA transcription. II. Characterization of complexes of rrnB P1 promoters containing or lacking the upstream activator region with Escherichia coli RNA polymerase. J. Mol. Biol. 220:560-583. |
| 39. |
Newlands, J.,
C. Josaitis,
W. Ross, and R. L. Gourse.
1992.
Both FIS-dependent and factor-independent upstream activation of the rrnB P1 promoter are face of the helix dependent.
Nucleic Acids Res.
20:719-726 |
| 40. |
Nilsson, L., and V. Emilsson.
1994.
Factor for inversion stimulation-dependent growth rate regulation of individual tRNA species in Escherichia coli.
J. Biol. Chem.
269:9460-9465 |
| 41. | Nilsson, L., A. Vanet, E. Vijgenboom, and L. Bosch. 1990. The role of FIS in trans-activation of stable RNA operons of E. coli. EMBO J. 9:727-734[Medline]. |
| 42. | Nilsson, L., H. Verbeek, U. Hoffmann, M. Haupt, and L. Bosch. 1992. Inactivation of the fis gene leads to reduced growth rate. FEMS Lett. Microbiol. 99:85-88. |
| 43. |
Nilsson, L.,
H. Verbeek,
E. Vijgenboom,
C. van Drunen,
A. Vanet, and L. Bosch.
1992.
FIS-dependent trans activation of stable RNA operons of Escherichia coli under various growth conditions.
J. Bacteriol.
174:921-929 |
| 44. | Ninnemann, O., C. Koch, and R. Kahmann. 1992. The E. coli fis promoter is subject to stringent control and autoregulation. EMBO J. 11:1075-1083[Medline]. |
| 45. |
Osuna, R.,
D. Lienau,
K. Hughes, and R. C. Johnson.
1995.
Sequence, regulation, and functions of fis in Salmonella typhimurium.
J. Bacteriol.
177:2021-2032 |
| 46. |
Pratt, T. S.,
T. Steiner,
L. S. Feldman,
K. A. Walker, and R. Osuna.
1997.
Deletion analysis of the fis promoter region in Escherichia coli: antagonistic effects of integration host factor and FIS.
J. Bacteriol.
179:6367-6377 |
| 47. | Rao, L., W. Ross, J. A. Appleman, T. Gaal, S. Leirmo, P. Schlax, M. T. Record, and R. L. Gourse. 1994. Factor independent activation of rrnB P1. An "extended" promoter with an upstream element that dramatically increases promoter strength. J. Mol. Biol. 235:1421-2435[Medline]. |
| 48. | Ross, W., F. Thompson, J. T. Newlands, and R. L. Gourse. 1990. E. coli FIS protein activates ribosomal RNA transcription in vitro and in vivo. EMBO J. 9:3733-3742[Medline]. |
| 49. |
Ross, W.,
K. K. Gosink,
J. Salomon,
K. Igarashi,
C. Zou,
A. Ishihama,
K. Severinov, and R. L. Gourse.
1993.
A third recognition element in bacterial promoters: DNA binding by the alpha subunit of RNA polymerase.
Science
262:1407-1413 |
| 50. | Sarmientos, P., S. Contente, G. Chinali, and M. Cashel. 1983. Ribosomal RNA operon promoters P1 and P2 show different regulatory responses, p. 65-74. In D. H. Hamer, and M. Rosenberg (ed.), Gene expression. Alan R. Liss, New York, N.Y. |
| 51. |
Thompson, J. F.,
L. M. de Vargas,
C. Koch,
R. Kahmann, and A. Landy.
1987.
Cellular factors couple recombination with growth phase: characterization of a new component in the site-specific recombination pathway.
Cell
50:901-908[Medline].
|
| 52. |
Weinreich, M., and W. Reznikoff.
1992.
FIS plays a role in Tn5 and IS50 transposition.
J. Bacteriol.
174:4530-4537 |
| 53. |
Xu, J., and R. C. Johnson.
1995.
Identification of genes negatively regulated by FIS: FIS and RpoS comodulate growth-phase-dependent gene expression in Escherichia coli.
J. Bacteriol.
177:938-947 |
| 54. |
Xu, J., and R. C. Johnson.
1995.
FIS activates the RpoS-dependent stationary-phase expression of proP in Escherichia coli.
J. Bacteriol.
177:5222-5231 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»