Previous Article | Next Article 
J Bacteriol, April 1998, p. 1715-1722, Vol. 180, No. 7
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Mutation of a Gene Encoding a Putative
Glycoprotease Leads to Reduced Salt Tolerance, Altered Pigmentation,
and Cyanophycin Accumulation in the Cyanobacterium
Synechocystis sp. Strain PCC 6803
Ellen
Zuther,
Hendrik
Schubert, and
Martin
Hagemann*
Fachbereich Biologie, Universität
Rostock, D-18051 Rostock, Germany
Received 28 October 1997/Accepted 28 January 1998
 |
ABSTRACT |
The salt-sensitive mutant 549 of the cyanobacterium
Synechocystis sp. strain PCC 6803 was genetically and
physiologically characterized. The mutated site and corresponding
wild-type site were cloned and partially sequenced. The genetic
analysis revealed that during the mutation about 1.8 kb was deleted
from the chromosome of mutant 549. This deletion affected four open
reading frames: a gcp gene homolog, the psaFJ
genes, and an unknown gene. After construction of mutants with single
mutations, only the gcp mutant showed a reduction in salt
tolerance comparable to that of the initial mutant, indicating that the
deletion of this gene was responsible for the salt sensitivity and that
the other genes were of minor importance. Besides the reduced salt
tolerance, a remarkable change in pigmentation was observed that became
more pronounced in salt-stressed cells. The phycobilipigment content decreased, and that of carotenoids increased. Investigations of changes
in the ultrastructure revealed an increase in the amount of
characteristic inclusion bodies containing the high-molecular-weight nitrogen storage polymer cyanophycin (polyaspartate and arginine). The
salt-induced accumulation of cyanophycin was confirmed by chemical
estimations. The putative glycoprotease encoded by the gcp
gene might be responsible for the degradation of cyanophycin in
Synechocystis. Mutation of this gene leads to nitrogen
starvation of the cells, accompanied by characteristic changes in
pigmentation, ultrastructure, and salt tolerance level.
 |
INTRODUCTION |
The physiological basis for the
adaptation to high salinities has been studied intensively in several
cyanobacterial species. It includes three main subprocesses: active
extrusion of inorganic ions, leading to relatively unchanged internal
salt concentrations; accumulation of large internal amounts of organic
osmoprotective compounds; and expression of a set of salt stress
proteins (17). The ion export is mediated by
Na+/H+ antiporters, which are energized by the
respiratory chain localized on the cytoplasmic membrane
(27), and by H+- ATPases (12).
On the basis of the principal osmoprotective compound accumulated,
three salt tolerance groups of cyanobacteria could be distinguished
(29). Slightly salt-tolerant strains accumulate sucrose or
trehalose, moderately halotolerant strains synthesize glucosylglycerol
(GG), and halophilic strains contain glycine betaine or glutamate
betaine. The synthesis of salt stress proteins was analyzed by amino
acid labelling. After comparison of stress protein synthesis in
salt-shocked cells with that in cells subjected to other stresses, the
occurrence of general and specific stress proteins became obvious. A
first general stress protein was identified in Synechocystis
sp. strain PCC 6803 as a flavodoxin (11).
The genetic processes involved in cyanobacterial salt adaptation have
been investigated for only a short time. With a subtractive hybridization procedure, it was shown that about 10% of the genome of
Anabaena torulosa seems to be salt inducible (5).
Genes encoding enzymes involved in the ion export process (cytochrome oxidase [3]), in the synthesis of osmoprotective
compounds (GG-phosphate phosphatase [18]), and in the
transport of osmoprotective compounds (19) have been cloned
and functionally characterized. For the identification of additional
genes necessary in the process of salt adaptation, the generation of
mutants represents a powerful tool, since after the characterization of
such mutants processes originally not thought to be essential for salt
adaptation can be identified. In 1990, several spontaneous
cyanobacterial mutants were obtained that showed a defect in
respiration and a salt-sensitive phenotype (21).
We have employed the method of random cartridge mutagenesis
(23) to generate salt-sensitive mutants of the
cyanobacterium Synechocystis. Synechocystis sp.
strain PCC 6803 belongs to the group of moderately halotolerant
cyanobacteria (salt resistance limit, about 1.2 M NaCl) and accumulates
mainly GG after salt stress (28). Recently, the genome of
this strain was completely sequenced (22). Random cartridge
mutagenesis offers the advantage that the mutated site is tagged by an
antibiotic resistance gene marker, which makes it easier to reclone the
affected genes and guarantees a stable mutation in the multicopy genome
of this strain. In a first attempt, three salt-sensitive mutants
(mutants 143, 406, and 549) that had different remaining salt
tolerances were obtained (15). With the antibiotic
resistance gene as a probe in Southern hybridization experiments, it
was found that different sites of the chromosome were affected in the
three mutants. The salt-sensitive phenotype of one mutant (mutant 143)
could be correlated with a defect in GG synthesis, while the other two
mutants (mutants 406 and 549) were able to accumulate the same amount
of osmolytes as the wild type (WT) and the defect leading to reduced
salt tolerance remained unknown (15).
In this paper we describe the genetic and physiological
characterization of the salt-sensitive Synechocystis mutant
549. The mutated site was cloned and used to screen for the WT genes in a gene library. After sequencing, a deletion affecting four genes was
found in mutant 549. A newly generated single mutant showing a defect
only in a putative glycoprotease resembled the original mutant 549. After cultivation in high-salt media, a remarkable change in
pigmentation accompanied by changes in the ultrastructure was found in
salt treated cells of this mutant.
 |
MATERIALS AND METHODS |
Strains and culture conditions.
The derivative of
Synechocystis sp. strain PCC 6803 with enhanced transforming
capacity that was used in all experiments was obtained from S. Shestakov (Moscow State University, Russia). Axenic cells were
cultivated on agar plates or in liquid culture at 30°C under constant
illumination with a mineral medium (15). Salt-sensitive
mutants were generated by random cartridge mutagenesis (23)
using the aphII gene (aminoglycoside phosphotransferase II
gene, conferring kanamycin resistance) isolated from plasmid pUC4K
(35). The whole procedure, including transformation of Synechocystis, was described earlier (15).
Transformants were initially selected on media containing 10 µg of
kanamycin (Sigma) per ml, while the segregation of clones and the
cultivation of mutants were conducted with 50 µg of kanamycin per ml.
Escherichia coli JM101 (30) was used for routine
DNA manipulations, while strain Q358 (30) served as a host
for bacteriophage
. E. coli was cultivated in Luria broth
(LB) medium at 37°C.
DNA manipulations.
Total DNA was isolated from
Synechocystis by lysozyme treatment and phenol-chloroform
purification (5). All other DNA techniques, such as plasmid
isolation, transformation of E. coli, ligations, restriction
analysis (restriction enzymes were obtained from Life Technologies),
Southern hybridization analysis, plaque hybridization, isolation of
DNA, and DNA labelling by random priming using [
-32P]dATP (Amersham Buchler), were standard methods
(30). The WT genes were cloned from a library of
Synechocystis DNA fragments in the
vector EMBL3, kindly
provided by H. D. Osiewacz, Ruhr Universität, Bochum,
Germany. DNA fragments for sequencing were generated by subcloning
defined restriction fragments into pUC18, pUC19 (37),
pUCBM20, pUCBM21 (Boehringer Mannheim), or pGEM7 (Promega).
Additionally, partially deleted clones were obtained by double-stranded
nested deletion (kit from Pharmacia). DNA sequencing was performed by
the dideoxy chain termination method using [
-35S]dATP
(Amersham Buchler) and the Sequenase 2.0 kit (USB). For sequencing,
double-stranded plasmid DNA was isolated by means of the QIAprep
plasmid kit (Qiagen). The site of integration of the aphII
gene into the chromosomal DNA was characterized by partial sequencing
using the following synthetic primers specific for the aphII
gene: kan 5', CAGGCCTGGTATGAGTCAGC; kan 3',
ATTTTTATCTTGTGCAATGT (custom oligonucleotide synthesis;
Pharmacia). Computer analysis of the DNA sequence was done by means of
the DNASIS/PROSIS software package (Pharmacia).
Analysis of mutant phenotype.
Salt-shock experiments were
performed in CO2-gassed (2%) batch cultures of mutant and
WT cells after addition of solid NaCl (usually to give a final
concentration of 684 mM NaCl) to the standard medium (containing 2 mM
NaCl). Photosynthesis and respiration were measured with a Clark-type
oxygen electrode (9). The growth of cells was monitored by
estimation of the extinction at 750 nm (A750) at
appropriate dilutions employing a regression to calculate cell number
and biomass. The cyanophycin
(multi-L-arginyl-poly[L-aspartic acid])
content was estimated after isolation of cyanophycin granules, their
solubilization by 0.1 N HCl, and chemical estimation of arginine
exactly as described previously (4). The protein content was
also estimated as described previously (24).
Pigment analyses.
The chlorophyll a (Chl
a) and carotenoid concentrations of the samples were
determined by high-performance liquid chromatography (HPLC) according
to a modified method described previously (32) and with
previously published extinction coefficients (25). Due to
difficulties encountered in quantitative extraction of phycobiliproteins, the pigment content was routinely estimated from
measurements of whole-sample absorption. Absorption was measured with
samples placed at the entrance of the integrating sphere accessory
(Labsphere; Perkin Elmer) of a spectrophotometer (Lambda 2; Perkin
Elmer) to minimize scattering. The pigment-specific absorption
coefficient for phycocyanin, A*630, determined for a
subsample of WT cells was found to be relevant as well for the mutant
cells, indicating that differences in pigment "packaging" were low
over the range of absorbances encountered in the different cultures.
Electron microscopy.
Cells used for analyses of
ultrastructure were taken directly from cultures, immediately fixed
with glutaraldehyde (4% in 0.1 M Na phosphate buffer), and
additionally fixed with 1% osmium tetroxide, and water was removed
with acetone. These cells were embedded in an epoxy resin (Araldite;
Fluka) and cut into ultrathin sections. Sections of cells on the grids
were treated with 2% uranyl acetate and lead citrate. The micrographs
were obtained with an electron microscope, model EM902 (Zeiss).
 |
RESULTS |
Gene cloning.
Integration of the aphII gene into
the genome of the salt-sensitive Synechocystis mutant 549 was first characterized in Southern blot experiments, in which an
EcoRI fragment of about 5.0 kb hybridized with the
aphII gene probe (15). This 5.0-kb
EcoRI fragment of chromosomal DNA from mutant 549 was cloned
into the plasmid pBR329 (8). Kmr clones of
E. coli were selected, and the recombinant plasmids were
isolated and characterized by restriction analysis (Fig. 1). The aphII gene cartridge
(about 1.3 kb) was obtained together with about 3.7 kb of flanking
cyanobacterial DNA. The resulting plasmid, pBRM549, was used to
transform the Synechocystis WT. Two hundred Kmr
clones were selected and, after complete segregation, tested for salt
and chloramphenicol resistance. All transformants tested were sensitive
to both high salt concentrations (600 mM NaCl) and chloramphenicol (5 µg/ml; pBR329 harbors a chloramphenicol resistance marker). These
results indicate that the salt-sensitive phenotype is coupled to the
integration of the aphII gene at the site cloned in pBRM549.
The absence of chloramphenicol resistance after transformation with
pBRM549 demonstrates that only the EcoRI fragment, not the
vector molecule, had been integrated in a double-crossover event
because single recombinants should carry all the markers of the
plasmid.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic drawing showing the genetic organization,
restriction map, and protein-encoding regions of the chromosomal site
affected in the Synechocystis mutant 549 (A), the
corresponding site of the Synechocystis WT (B), and the
insertion sites of the aphII gene in selected sites of the
different genes to obtain mutants with single mutations (C). Empty
arrows, protein-encoding regions in Synechocystis; darkly
shaded arrows, inserted aphII gene cassettes; black arrows,
regions sequenced in this work; *, partial deleted genes; lightly
stippled arrow, deletion that occurred during integration of an
aphII gene in mutant 549.
|
|
The DNAs flanking the
aphII gene in pBRM549 were obtained as
HindIII fragments from pBRM549 (the
aphII
gene contains one
HindIII
site) and used as probes for
screening the
Synechocystis gene
library to clone the
corresponding WT region. Positive plaques
hybridizing to both probes
were purified to obtain single clones
by three screening steps. DNA
from one of the lambda clones obtained
was isolated and characterized
by Southern hybridization analysis
using the same probe that was used
for screening. With both probes,
an
EcoRI fragment of about
5.8 kb was specifically recognized.
It was cloned into pUC18, leading
to the plasmid pM549S (Fig.
1). The plasmid pM549S was transformed into
mutant 549 cells,
which were then selected on high-salt media (600 mM
NaCl). Thousands
of clones had been restored to high salt tolerance,
indicating
that the
EcoRI fragment cloned into pM549S
contained the complete
WT region affected in the mutant 549.
Sequence analysis.
After subcloning of a 3.2-kb
SmaI/EcoRI fragment and generation of overlapping
deletions by digestion with exonuclease III, the nucleotide sequence of
this fragment was determined for both strands starting from the 5' and
3' ends (Fig. 1). During sequencing, similarities to previously
published sequences from Synechocystis were recognized
(7, 36). Therefore, the central part of the 3.2-kb
SmaI/EcoRI fragment was not sequenced again. For
precise determination of the integration site of the aphII
gene during the generation of mutant 549, the cyanobacterial DNA
flanking the Kmr cartridge on pBRM549 was partly sequenced
with primers specific to the 5' and 3' ends of the aphII
gene. Sequences identical to the WT fragment (for the 5' sequence
before position 263 and for the 3' sequence after position 2092) were
found (not shown). Therefore, about 1.8 kb of the WT region was deleted
during integration of the aphII gene cassette into the
genome of mutant 549 (Fig. 1).
The nucleotide sequence was subjected to computer analysis. Four
putative protein-coding regions (open reading frames [ORFs])
could be
identified on the sequenced
SmaI/
EcoRI fragment
(Fig.
1), all of which were affected by the deletion in mutant 549 (Fig.
1). The deduced amino acid sequences were compared to amino acid
sequences from databases. The amino acid sequences of the two
completely deleted ORFs were 100% identical to the PsaF and PsaJ
proteins of
Synechocystis, which were already sequenced
(
7)
and are part of photosystem I. From the gene
orf1 upstream of
psaF, probably encoding a
sialoglycoprotease (
slr0807, a
gcp gene
homolog
[
22]), the promoter region and the N-terminal part of
the protein were deleted in mutant 549. The ORF2 protein, encoded
downstream of
psaJ, does not show any similarities to known
proteins
(
slr0806 [
22]). In mutant 549, about 75 amino acid residues
of its C-terminal part are missing (Fig.
1).
Construction of mutants with mutations affecting single genes.
In order to clarify the role of the four ORFs deleted in mutant 549 in
salt tolerance in more detail, several insertion mutants with mutations
affecting single genes were constructed (Fig. 1) (see Table 1 for
nomenclature of the mutants) and physiologically characterized. The
psaF and psaJ genes were mutated together by integration of an aphII gene into the BalI site
present inside psaF, since both genes are transcribed as an
operon (7). A gcp (ORF1) mutant was constructed
by cloning the aphII gene cartridge into the internal
EcoRV site of the gcp gene homolog. Finally, ORF2
was mutated by insertion of the resistance marker into the BamHI site close to the 3' end of its coding sequence (Fig.
1). Plasmids showing correct integration of the aphII gene
were transformed into Synechocystis, from which
Kmr clones originating from homologous recombination with
the chromosomal DNA were selected (Table
1).
Levels of salt tolerance of the mutants were compared to those of the
WT and the original mutant 549 by growing all clones
on solid media and
in liquid media in the presence of 2 to 684
mM NaCl. The
gcp
(ORF1) integration mutant showed a salt-sensitive
phenotype similar to
that of mutant 549 with a maximal tolerance
reduced to less than 550 mM
NaCl. In contrast, the mutants impaired
in
psaF,
psaJ, and ORF2 grew as well as the WT in media containing
684 mM NaCl (data not shown). Chromosomal DNA was isolated from
all
mutants and analyzed by DNA-DNA hybridization with the
aphII
gene and the genes concerned as probes. In all cases, the
aphII
gene probe gave signals showing that it was introduced
at the
expected sites. The hybridizations using the gene probes showed
that the mutants were completely segregated, since no signals
of the
size corresponding to the WT alleles could be observed.
Only the
results for the salt-sensitive
gcp mutant are shown in
comparison to the WT in Fig.
2. After
restriction by
EcoRI and
BamHI, a fragment about
1.3 kb larger than the 2.9-kb WT fragment
hybridized with DNA of the
gcp mutant with the
gcp gene as a probe,
while
after digestion by
HindIII and
BamHI, in
contrast to WT
DNA, two fragments were recognized by this probe in the
mutant
DNA, since the inserted
aphII gene contained a
HindIII site. With
the
aphII gene as a probe,
the same fragments showed signals with
DNA of the
gcp
mutant, while with WT DNA specific hybridization
signals could not be
detected (Fig.
2). These hybridization patterns
indicated that
recombination had occurred via a double-crossover
event, with
replacement of the WT alleles by the mutated copies.

View larger version (99K):
[in this window]
[in a new window]
|
FIG. 2.
Southern blot experiments for characterization of
complete segregation of the gcp mutant. The
32P-labelled internal BclI/KpnI
fragment of the gcp gene (A) or the 32P-labelled
aphII gene (B) was used as a probe for the hybridization to
EcoRI-BamHI- (lanes 1 and 2) and to
HindIII-BamHI-digested (lanes 3 and 4)
chromosomal DNA from the WT (lanes 1 and 3) and the gcp
mutant (lanes 2 and 4), respectively. The molecular masses of
HindIII-digested DNA size standards were drawn by
using the positions from the photo of the ethidium bromide-stained gel
at the same magnification.
|
|
Physiological characterization of the gcp (ORF1)
mutant.
Among the mutants with single mutations constructed in the
genes affected in mutant 549, only the gcp mutant showed a
significant reduction in its salt tolerance level and it was therefore
chosen for further analyses. The growth and photosynthesis of the
gcp mutant was compared to those of the original mutant 549 and the WT after applying a salt shock of 684 mM NaCl. In all cases an immediate decrease in photosynthesis was observed after the addition of
high salt concentrations (Fig. 3). During
the first 8 h after shock, photosynthesis recovered in the WT as
well as in the mutants. While the WT cells were able to adapt
photosynthesis to the demands of high salt concentrations completely
after only 48 h, in cells of the mutant 549 and in the
gcp mutant, respectively, it decreased continuously until
96 h, when photosynthesis was completely inhibited (Fig. 3).
Growth of the mutants stopped by 48 h after the salt shock, while
growth of the WT had already recovered (Table
2).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 3.
Alterations of photosynthetic oxygen evolution after a
salt shock of 684 mM NaCl in WT cells ( ), mutant 549 cells ( ),
and the gcp mutant ( ). The diagram represents means from
three independent experiments.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Alterations in the growth, cyanophycin content (analyzed
by electron microscopy), and pigmentation analyzed by HPLC in cells of
the gcp mutant and the Synechocystis WT grown in
basal medium and after a salt shock of 684 mM NaCl for different times
|
|
The decrease in photosynthesis was accompanied by a remarkable change
in the color of the mutants. Compared with the blue-green
color of the
WT, cells of the
gcp mutant were yellow-green in
basal
medium and became almost completely yellow after transfer
to high-salt
medium. With in vivo absorption spectra, which were
normalized at the
red peak of Chl
a, it became obvious that the
carotenoids in
particular were drastically enhanced compared with
Chl
a,
while the phycobilipigments were slightly reduced (Fig.
4; Table
2). These changes were already
visible in cultures in
basal medium, but they were increased
severalfold after the salt
shock. In order to define whether, in
addition to the quantitative
increase in carotenoids, qualitative
changes in their composition
also occurred, the pigments were analyzed
by HPLC. Quantitative
analysis also showed a reduced Chl
a
content of the
gcp mutant
cells, leading to an increase in
the ratios of all carotenoids
per Chl
a in the mutant,
especially after transfer to salt medium
(Table
2). In cells grown in
basal medium, the carotenoid contents
and ratios were not significantly
changed, but in salt-stressed
cells of the
gcp mutant, the
carotenoid content per cell increased
and the carotenoid composition
was markedly changed. Among the
carotenoids, the contents of
myxoxanthophyll and echinone were
doubled in salt-stressed mutant
cells, while the contents of zeaxanthine
and

-carotene resembled
that of the WT (Table
2).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 4.
Comparison of in vivo absorption spectra obtained from
WT cells and from the gcp mutant grown in basal medium or
after a salt shock of 684 mM NaCl for 48 and 96 h. All spectra
were normalized at the absorption maximum of Chl a at 680 nm. WT: control cells, ; 48 h, ; 96 h, .
gcp mutant: control cells,   ; 48 h, - - -;
96 h, - - -.
|
|
The changes in pigmentation made it very promising to search for
alterations in the ultrastructure of the cells. Cells grown
in basal
medium and salt-stressed cells were compared by transmission
electron
microscopy, where remarkable structural alterations became
obvious. The
amount and size of inclusion bodies were particularly
enhanced in the
gcp mutant (Fig.
5). This
increase became even
more pronounced in salt-stressed cells. In mutant
cells treated
for 96 h with high salt concentrations, about 20 to
30% of the
cell volume was occupied by these inclusion bodies. On the
basis
of their characteristic internal structures they could be
identified
as cyanophycin granules (
33,
34). Therefore, a
defect in the
gcp gene homolog leads to a massive
accumulation of cyanophycin
in
Synechocystis. This
accumulation of cyanophycin granules could
be confirmed by chemical
estimations of the cyanophycin content.
In cells of the
gcp
mutant stressed for 96 h by 684 mM NaCl, about
40 times more
cyanophycin was found than in the WT, while in control
cells the
difference was not significant (WT, control, 0.49 µg
of
cyanophycin/mg of protein; salt-stressed cells, 0.93 µg/mg;
gcp mutant, control, 0.48 µg/mg; salt-stressed cells,
21.48 µg/mg).
In addition to the accumulation of cyanophycin
granules, the accumulation
of large amounts of glycogen, seen as small
white granules between
thylakoids (
34), and a decrease in
large white areas outside
the thylakoid space were found in comparison
to WT cells (Fig.
5). These large white areas in the micrographs of the
cells represent
holes, most probably caused by the volatilization of
polyphosphate
granules under the electron beam in thin sections
(
34). Furthermore,
the organization of the thylakoid system
disappeared in salt-stressed
cells of the
gcp mutant. Only
some irregularly positioned thylakoid
fragments remained visible in
cells treated for 72 to 96 h with
684 mM NaCl. In salt-treated
cells of the WT, almost no differences
were visible compared with
differences in cells grown in basal
medium (Fig.
5), while in the
cyanobacterium
Microcystis firma significant salt-induced
alterations in the ultrastructure were
detected (
31).

View larger version (139K):
[in this window]
[in a new window]
|
FIG. 5.
Comparison by electron microscopy of the ultrastructures
of WT cells (A and B) and of the gcp mutant (C and D) grown
in basal medium (A and C) or after a salt shock of 684 mM NaCl for
96 h (B and D). The bars represent 0.25 µm. CG, cyanophycin
granules; G, glycogen; PP, polyphosphate.
|
|
 |
DISCUSSION |
During the characterization of Synechocystis mutant
549, a deletion of about 1.8 kb was found. The occurrence of deletions with random cartridge mutagenesis was also found in previous studies, in which 1.3 to 50 kb has been lost, leading to very stable mutants (6, 16). These deletions make it difficult to decide which of the affected ORFs is responsible for the observed phenotype. In
order to identify the gene responsible for the reduced salt tolerance
of mutant 549, mutants with single mutations were generated and
characterized regarding salt tolerance. The psaFJ genes,
which were completely deleted in mutant 549, seem to be nonessential for salt adaptation in Synechocystis, since an insertion
mutant impaired in psaF could grow on 684 mM NaCl.
Nevertheless, in the kinetics of adaptation to high salt
concentrations, differences compared to the WT were detectable
(unpublished data). These subunits of photosystem I are of minor
importance for its function, because psaFJ mutants showed no
significant alterations in photosynthetic activity (7).
Recently, it was found that the PsaF protein might be involved in
electron transfer from plastocyanin to P700 in higher plants
(20). orfII, encoding a protein of completely unknown function, was partly deleted in mutant 549, but an insertion mutant specific for this gene showed no alterations after growth in
high-salt and basal medium compared with the WT.
The reduction in salt tolerance found for mutant 549 could be
reproduced in experiments with an insertion mutation in orfI or gcp. Both the mutant 549 and the gcp mutant
showed a reduction of remaining salt tolerance to the same extent
(limit less than 550 mM NaCl) and the same kinetic behavior after a
lethal salt shock of 684 mM NaCl (Fig. 3). Therefore, it could be
concluded that the partial deletion of this gene in mutant 549 was
responsible for the mutant's reduced salt tolerance. Compared with
mutants of Synechocystis defective in the synthesis of the
osmoprotective compound GG, the salt tolerance of the gcp
mutant remained relatively high. GG mutants were also not able to
restore the immediate decrease in photosynthesis after a salt shock of
684 mM NaCl. Photosynthesis became completely inhibited by about
30 h, and their salt tolerance limit was reduced to less than 350 mM NaCl (15, 16). Therefore, the gcp gene product
seems not to be directly involved in basic processes of salt adaptation
and its defect might lead only indirectly to a reduction in salt
tolerance.
Last year the complete genome sequence of Synechocystis was
published (22). The ORF1 protein was identified as a
putative sialoglycoprotease, which might be involved in the degradation of proteins. A comparison of the Gcp protein to several other putative
glycoproteases from heterotrophic bacteria showed high sequence
similarities (about 40% identical amino acid residues) (Fig.
6). Most of the related sequences were
obtained during genome sequencing projects. The function of these
proteins was derived from sequence comparisons alone. Only for the
protein from Pasteurella haemolytica has the function as a
protease been biochemically proven. This protease, belonging to the
group of metalloproteases, showed specificity for a glycosylated
protein, the glycophorin A, with a major cleavage site at
Arg-31-Asp-32 (2). A similar protein from E. coli was thought to be involved in the regulation of a
macromolecular operon (26).

View larger version (119K):
[in this window]
[in a new window]
|
FIG. 6.
Amino acid sequence alignment of the gcp gene
homolog (ORF1) from Synechocystis sp. strain PCC 6803 (SYNE
[22]) and other putative gcp genes from
several bacteria. HINF, Haemophilus influenzae
(10); ECOL, Escherichia coli (26);
PHAE, Pasteurella haemolytica (1); MLEP,
Mycobacterium leprae (33a). Uppercase letters are
used when amino acids are identical to those in the
Synechocystis sequence (shaded boxes).
|
|
Besides the reduced salt tolerance, the most obvious alterations in the
phenotype of the Synechocystis gcp mutant were related to
changed pigmentation and a remarkable accumulation of cyanophycin and
glycogen. An increase in the carotenoids and especially in echinenone
and myxoxanthophyll, as well as in glycogen accumulation, was also
observed for salt-adapted cells of the WT (9, 32), but these
increases and the decrease in phycocyanin were much more pronounced in
the salt-stressed cells of the gcp mutant. Cyanophycin,
composed of polyaspartate and arginine, which is synthesized without
the participation of ribosomes, has been found only as a
high-molecular-weight nitrogen reserve in many cyanobacteria, mainly
accumulating in cells during the transition to stationary phase
(33). The enhanced content of cyanophycin could be best explained by the assumption that the putative protease encoded by the
gcp gene is responsible for cyanophycin degradation in the
Synechocystis WT. The enzymes involved in cyanophycin
synthesis and degradation are only poorly characterized in
cyanobacteria, but they were found to be constitutively expressed
(33), except in Anabaena, where the level of both
activities increased in heterocysts during their differentiation
(14). A defect in the degradative activity would lead to
uncontrolled accumulation of cyanophycin. Under our culture conditions,
cyanophycin synthesis seems to be especially induced in high-salt
media, since in the control cells the cyanophycin level showed no
(chemical estimation), or only minor (ultrastructural studies), changes
in the gcp mutant, while it is massively induced in
salt-treated cells. This massive accumulation of cyanophycin, which
could not be remobilized, would starve the cells for nitrogen. The
observed changes in pigmentation, as well as the accumulation of large
amounts of glycogen, are very characteristic of nitrogen-starved
cyanobacteria (13). A reduced supply or availability of
nitrogen reduces protein synthesis relative to glycogen and induces the
degradation of phycobilisomes, because the phycobiliproteins serve not
only as light-harvesting pigments but also as a nitrogen storage
mechanism in cyanobacteria. In contrast to phycocyanin, the content of
carotenoids as nitrogen-free pigments is enhanced, especially that of
xanthophylls, decreasing effects of excess light absorption by the
remaining pigments (13). The unfavorable situation of
shortened nitrogen supply seems to lead to more dramatic effects, when
a second stress factor is introduced, such as salt stress. Under the
combined stresses of nitrogen starvation and salt, the cell is unable
to adapt to a new steady state and lysis occurs. The gcp
mutant also shows interesting possibilities for biotechnological
applications, since after a salt shock the cyanophycin accumulation is
dramatically enhanced and the content of several carotenoids,
especially echinenone and myxoxanthophyll, which could be used as
antioxidants, is also increased. In further studies, the effects of the
gcp gene defect on the nitrogen metabolism and on general
stress tolerance will be investigated with this mutant.
 |
ACKNOWLEDGMENTS |
We thank B. Haselkorn, University of Chicago, for critical
reading of the manuscript. The excellent technical assistance of B. Brzezinka, I. Dörr, and F. Fischer is greatly appreciated. Many
thanks are due to the Centre for Electron Microscopy of the Faculty of
Medicine, especially to G. Fulda for performing the ultrastructural
studies.
The work at the University of Rostock was supported by a grant from the
Deutsche Forschungsgemeinschaft.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Fachbereich
Biologie, Universität Rostock, Doberaner Str. 143, D-18051
Rostock, Germany. Phone: 49-381-4942076. Fax: 49-381-4942079. E-mail:
mh{at}boserv.bio4.uni-rostock.de.
Present address: Department of Molecular Genetics & Cell Biology,
University of Chicago, Chicago, IL 60637.
 |
REFERENCES |
| 1.
|
Abdullah, K. M.,
R. Y. C. Lo, and A. Mellors.
1991.
Cloning, nucleotide sequence, and expression of the Pasteurella haemolytica A1 glycoprotease gene.
J. Bacteriol.
173:5597-5603[Abstract/Free Full Text].
|
| 2.
|
Abdullah, K. M.,
E. A. Udoh,
P. E. Shewen, and A. Mellors.
1992.
A neutral glycoprotease of Pasteurella haemolytica A1 specifically cleaves O-sialoglycoproteins.
Infect. Immun.
60:56-62[Abstract/Free Full Text].
|
| 3.
|
Alge, D., and G. A. Peschek.
1993.
Characterization of a ctaCDE operon-like genomic region encoding subunits I-III of the cytochrome c oxidase of the cyanobacterium Synechocystis PCC 6803.
Biochem. Mol. Biol. Int.
29:511-525[Medline].
|
| 4.
|
Allen, M. M.
1988.
Inclusions: cyanophycin.
Methods Enzymol.
167:321-325.
|
| 5.
|
Apte, S. K., and R. Haselkorn.
1990.
Cloning of salinity stress-induced genes from the salt-tolerant nitrogen-fixing cyanobacterium Anabaena torulosa.
Plant Mol. Biol.
15:723-733[Medline].
|
| 6.
|
Chauvat, F.,
P. Rouet,
H. Bottin, and A. Boussac.
1989.
Mutagenesis by random cloning of an Escherichia coli kanamycin resistance gene into the genome of the cyanobacterium Synechocystis sp. PCC 6803: selection of mutants defective in photosynthesis.
Mol. Gen. Genet.
216:51-59[Medline].
|
| 7.
|
Chitnis, P. R.,
D. Purvis, and N. Nelson.
1991.
Molecular cloning and targeted mutagenesis of the gene psaF encoding subunit III of the photosystem I from the cyanobacterium Synechocystis sp. PCC 6803.
J. Biol. Chem.
266:20146-20151[Abstract/Free Full Text].
|
| 8.
|
Covarrubias, L., and F. Bolivar.
1982.
Construction and characterization of new cloning vehicles. VI. Plasmid pBR329, a new derivative of pBR328 lacking the 428 base pair inserted duplication.
Gene
17:79-89[Medline].
|
| 9.
|
Erdmann, N.,
S. Fulda, and M. Hagemann.
1992.
Glucosylglycerol accumulation during salt acclimation of two unicellular cyanobacteria.
J. Gen. Microbiol.
138:363-368.
|
| 10.
|
Fleischmann, R. D.,
M. D. Adams,
O. White,
R. A. Clayton,
E. F. Kirkness,
A. R. Kerlavage,
C. J. Bult,
J.-F. Tomb,
B. A. Doughtery,
J. M. Merrik,
K. McKenney,
G. Sutton,
W. Fitzhugh,
C. A. Fields,
J. D. Gocayne,
J. D. Scott,
R. Shirley,
L.-I. Liu,
A. Glodek,
J. M. Kelley,
J. F. Weidman,
C. A. Phillips,
T. Spriggs,
E. Hedblom,
M. D. Cotton,
T. R. Utterback,
M. C. Hanna,
D. T. Nguyen,
D. M. Saudek,
R. C. Brandon,
L. D. Fine,
J. L. Fritchman,
J. L. Fuhrmann,
N. S. M. Geoghagen,
C. L. Gnehm,
L. A. McDonald,
K. V. Small,
C. M. Fraser,
H. O. Smith, and J. C. Venter.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
Science
269:496-512[Abstract/Free Full Text].
|
| 11.
|
Fulda, S., and M. Hagemann.
1995.
Salt treatment induces accumulation of flavodoxin in the cyanobacterium Synechocystis sp. PCC 6803.
J. Plant Physiol.
146:520-526.
|
| 12.
|
Gabbay-Azaria, R.,
U. Pick,
G. Ben-Hayyim, and E. Tel-Or.
1994.
The involvement of a vanadate-sensitive ATPase in plasma membranes of a salt tolerant cyanobacterium.
Physiol. Plant.
90:692-698.
|
| 13.
|
Grossman, A. R.,
M. R. Schaefer,
G. G. Chiang, and J. L. Collier.
1995.
The response of cyanobacteria to environmental conditions: light and nutrients, p. 751-767. In
D. Bryant (ed.), Molecular biology of cyanobacteria.
Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 14.
|
Gupta, M., and N. G. Carr.
1981.
Enzyme activities related to cyanophycin metabolism in heterocysts and vegetative cells of Anabaena spp.
J. Gen. Microbiol.
125:17-23.
|
| 15.
|
Hagemann, M., and E. Zuther.
1992.
Selection and characterization of mutants of the cyanobacterium Synechocystis sp. PCC 6803 unable to tolerate high salt concentrations.
Arch. Microbiol.
158:429-434.
|
| 16.
|
Hagemann, M.,
S. Richter,
E. Zuther, and A. Schoor.
1996.
Characterization of a glucosylglycerol-phosphate accumulating, salt-sensitive mutant of the cyanobacterium Synechocystis sp. PCC 6803.
Arch. Microbiol.
166:83-91[Medline].
|
| 17.
|
Hagemann, M., and N. Erdmann.
1997.
Environmental stresses, p. 156-221. In
A. K. Rai (ed.), Cyanobacterial nitrogen metabolism and environmental biotechnology.
Springer, Heidelberg, Germany.
|
| 18.
|
Hagemann, M.,
A. Schoor,
R. Jeanjean,
E. Zuther, and F. Joset.
1997.
The stpA gene from Synechocystis sp. strain PCC 6803 encodes the glucosylglycerol-phosphate phosphatase involved in cyanobacterial osmotic response to salt shock.
J. Bacteriol.
179:1727-1733[Abstract/Free Full Text].
|
| 19.
|
Hagemann, M.,
S. Richter, and S. Mikkat.
1997.
The ggtA gene encodes a subunit of the transport system for the osmoprotective compound glucosylglycerol in Synechocystis sp. strain PCC 6803.
J. Bacteriol.
179:714-720[Abstract/Free Full Text].
|
| 20.
|
Hippler, M.,
J. Reichert,
M. Sutter,
E. Zak,
L. Altschmied,
U. Schröer,
R. G. Herrmann, and W. Haehnel.
1996.
The plastocyanin binding domain of photosystem I.
EMBO J.
15:6374-6384[Medline].
|
| 21.
|
Jeanjean, R.,
B. Onana,
G. A. Peschek, and F. Joset.
1990.
Mutants of the cyanobacterium Synechocystis PCC 6803 impaired in respiration and unable to tolerate high salt concentrations.
FEMS Microbiol. Lett.
68:125-130.
|
| 22.
|
Kaneko, T.,
S. Sato,
H. Kotani,
A. Tanaka,
E. Asamizu,
Y. Nakamura,
N. Miyajima,
M. Hirosawa,
M. Sugiura,
S. Sasamoto,
T. Kimura,
T. Hosouchi,
A. Matsuno,
A. Muraki,
N. Nakazaki,
K. Nruo,
S. Okumura,
S. Shimpo,
C. Takeuchi,
T. Wada,
A. Watanabe,
M. Yamada,
M. Yasuda, and S. Tabata.
1996.
Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC 6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions.
DNA Res.
3:109-136[Abstract].
|
| 23.
|
Labarre, J.,
F. Chauvat, and P. Thuriaux.
1989.
Insertional mutagenesis by random cloning of antibiotic resistance genes into the genome of the cyanobacterium Synechocystis strain PCC 6803.
J. Bacteriol.
171:3449-3457[Abstract/Free Full Text].
|
| 24.
|
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275[Free Full Text].
|
| 25.
|
Mantoura, R. F. C., and C. A. Llewellyn.
1983.
The rapid determination of algal chlorophyll and carotenoid pigments and their breakdown products in natural waters by reverse-phase high-performance liquid chromatography.
Anal. Chim. Acta
15:297-314.
|
| 26.
|
Nesin, M.,
J. R. Lupski,
P. Svec, and G. N. Godson.
1987.
Possible new genes as revealed by molecular analysis of a 5-kb Escherichia coli chromosomal region 5' to the rpsU-dnaG-rpoD macromolecular-synthesis operon.
Gene
51:149-161[Medline].
|
| 27.
|
Peschek, G. A.,
V. Molitor,
M. Trnka,
M. Wastyn, and W. Erber.
1988.
Characterization of cytochrome-c oxidase in isolated and purified plasma and thylakoid membranes from cyanobacteria.
Methods Enzymol.
167:437-449.
|
| 28.
|
Reed, R. H., and W. D. P. Stewart.
1985.
Osmotic adjustment and organic solute accumulation in unicellular cyanobacteria from freshwater and marine habitats.
Mar. Biol.
88:1-9.
|
| 29.
|
Reed, R. H.,
L. J. Borowitzka,
M. A. Mackay,
J. A. Chudek,
R. Foster,
S. R. C. Warr,
D. J. Moore, and W. D. P. Stewart.
1986.
Organic solute accumulation in osmotically stressed cyanobacteria.
FEMS Microbiol. Rev.
39:51-56.
|
| 30.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 31.
|
Schiewer, U., and L. Jonas.
1977.
Die Wirkung unterschiedlicher NaCl-Konzentrationen auf die Ultrastruktur von Blaualgen. I. Microcystis firma.
Arch. Protistenkd.
119:127-145.
|
| 32.
|
Schubert, H.,
S. Fulda, and M. Hagemann.
1993.
Effects of adaptation to different salt concentrations on photosynthesis and pigmentation of the cyanobacterium Synechocystis sp. PCC 6803.
J. Plant Physiol.
142:291-295.
|
| 33.
|
Simon, R. D.
1987.
Inclusion bodies in the cyanobacteria: cyanophycin, polyphosphate, polyhedral bodies, p. 199-226. In
P. Fay, and C. VanBaalen (ed.), The cyanobacteria.
Elsevier Science Publishers B. V., Amsterdam, The Netherlands.
|
| 33a.
| Smith, D. R., and K. Robison. 1994. Unpublished
data.
|
| 34.
|
Stanier, G. (Cohen-Bazire)
1988.
Fine structure of cyanobacteria.
Methods Enzymol.
167:157-172.
|
| 35.
|
Vieira, J., and J. Messing.
1982.
The pUC plasmids, an M13mp7-derived system for the insertion mutagenesis and sequencing with synthetic universal primers.
Gene
19:259[Medline].
|
| 36.
|
Xu, Q.,
L. Yu,
V. P. Chitnis, and P. R. Chitnis.
1994.
Function and organization of photosystem I in a cyanobacterial mutant strain lacks PsaF and PsaJ subunits.
J. Biol. Chem.
269:3205-3211[Abstract/Free Full Text].
|
| 37.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[Medline].
|
J Bacteriol, April 1998, p. 1715-1722, Vol. 180, No. 7
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zheng, L., Yu, C., Bayles, K., Lasa, I., Ji, Y.
(2007). Conditional Mutation of an Essential Putative Glycoprotease Eliminates Autolysis in Staphylococcus aureus. J. Bacteriol.
189: 2734-2742
[Abstract]
[Full Text]
-
Kolodny, N. H., Bauer, D., Bryce, K., Klucevsek, K., Lane, A., Medeiros, L., Mercer, W., Moin, S., Park, D., Petersen, J., Wright, J., Yuen, C., Wolfson, A. J., Allen, M. M.
(2006). Effect of Nitrogen Source on Cyanophycin Synthesis in Synechocystis sp. Strain PCC 6308. J. Bacteriol.
188: 934-940
[Abstract]
[Full Text]
-
Quintero, M. J., Muro-Pastor, A. M., Herrero, A., Flores, E.
(2000). Arginine Catabolism in the Cyanobacterium Synechocystis sp. Strain PCC 6803 Involves the Urea Cycle and Arginase Pathway. J. Bacteriol.
182: 1008-1015
[Abstract]
[Full Text]