Previous Article | Next Article 
J Bacteriol, April 1998, p. 1878-1886, Vol. 180, No. 7
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Regulation of ntcA Expression and
Nitrite Uptake in the Marine Synechococcus sp. Strain
WH 7803
Debbie
Lindell,1,2
Etana
Padan,2 and
Anton F.
Post1,2,*
H. Steinitz Marine Biology Laboratory,
Interuniversity Institute for Marine Sciences, Eilat
88103,1 and
Department of Microbial
and Molecular Ecology, Hebrew University of Jerusalem,
Jerusalem,2 Israel
Received 11 September 1997/Accepted 20 January 1998
 |
ABSTRACT |
NtcA is a transcriptional activator involved in global nitrogen
control in cyanobacteria. In the absence of ammonium it regulates the
transcription of a series of genes encoding proteins required for the
uptake and assimilation of alternative nitrogen sources (I. Luque, E. Flores, and A. Herrero, EMBO J. 13:2862-2869, 1994). ntcA,
present in a single copy in the marine Synechococcus sp. strain WH 7803, was cloned and sequenced. The putative amino acid sequence shows a high degree of identity to NtcA from freshwater cyanobacteria in two functional domains. The expression of
ntcA was negatively regulated by ammonium from a putative
transcription start point located downstream of an NtcA consensus
recognition sequence. Addition of either rifampin or ammonium led to a
rapid decline in ntcA transcript levels with half-lives of
less than 2 min in both cases. Nitrate-grown cells showed high
ntcA transcript levels, as well as the capacity for active
nitrite uptake. However, ammonium-grown cells showed low levels of the
ntcA transcript and did not utilize nitrite. The addition
of ammonium to nitrite uptake-active cells resulted in a gradual
decline in the rate of uptake over a 24-h period. Active nitrite uptake
was not induced in cells transferred to medium lacking a nitrogen
source despite evidence of elevated expression of ntcA,
indicating that ntcA expression is not sufficient for
uptake capacity to develop. Nitrate and nitrite addition led to the
development of nitrite uptake, whereas the addition of leucine did not.
Furthermore, nitrite addition triggered the de novo protein synthesis
required for uptake capacity to develop. These data suggest that
nitrite and nitrate act as specific inducers for the synthesis of
proteins required for nitrite uptake.
 |
INTRODUCTION |
The cyanobacteria are photosynthetic
prokaryotes that generally fulfill their nitrogen requirements with
inorganic nitrogenous compounds (14). Ammonium is the
preferred source of nitrogen. This form of nitrogen does not require
active uptake and is readily incorporated into amino acids. Other forms
of inorganic nitrogen (nitrate, nitrite, and dinitrogen) must be
reduced to ammonium internally, prior to incorporation into carbon
skeletons, largely via the glutamine-synthetase/glutamate-synthase
pathway (GS/GOGAT) (9, 14). The uptake and assimilation of
such inorganic nitrogen sources are hampered by the presence of
ammonium (9, 14). In the freshwater Synechococcus
sp. strain PCC 7942, ammonium-promoted control is exerted at two
levels. The addition of ammonium promotes an immediate cessation of
nitrate and nitrite transport (24). Ammonium also prevents
the transcription of the nirA operon, resulting in the
repression of synthesis of proteins required for the assimilation of
nitrate and nitrite (26, 44). These inhibitory effects are
not direct, since ammonium must first be incorporated into the cell via
the GS/GOGAT pathway (24, 44).
A similarly negative effect by ammonium is mediated by the
ntr genes in the enterobacteria, in a two-component
regulatory system (36). However, ntrB- and
ntrC-like genes have not been found in cyanobacteria
(26, 28). The isolation of a pleiotropic mutant of the
freshwater cyanobacterium Synechococcus sp. strain PCC 7942, which is incapable of using inorganic nitrogen sources other than
ammonium, led to the identification of NtcA, a transcriptional activator (46). This DNA binding protein belongs to the
cyclic AMP receptor protein (CRP) family of transcriptional activators (47). In the absence of ammonium it binds upstream of its
own gene as well as of a number of genes involved in nitrogen
nutrition, positively regulating their expression. In
Synechococcus sp. strain PCC 7942, NtcA positively regulates
the expression of glnA and the nirA operon,
encoding proteins essential for the uptake and reduction of nitrate and
nitrite (26). A newly discovered operon, nirB,
which contains genes necessary for normal growth on nitrate and
nitrite, is also regulated by NtcA (45). In addition to some
of the genes mentioned above, NtcA appears to be involved in the
expression of the nif operon encoding the nitrogenase
subunits, as well as genes involved in the differentiation of
heterocysts in the filamentous Anabaena sp. strain PCC 7120 (12, 52). In both these freshwater cyanobacteria NtcA is
essential for growth when ammonium is absent from the medium (12,
46). However, NtcA may not control expression of the
nif operon in the marine unicellular nitrogen-fixing
Cyanothece sp. strain BH68K (1).
The availability of nutrients often limits primary productivity in
aquatic environments (31). Freshwater autotrophs are generally limited by phosphorus availability (16), whereas
nitrogen is considered to be the nutrient limiting primary productivity in marine algae (3, 6, 8). Cyanobacteria of the genus Synechococcus are ubiquitous throughout the world's oceans
(21, 48). They are of particular importance in waters
limited by nutrient availability, where these cyanobacteria contribute
significantly to primary productivity (2, 20). It is thus of
interest how this non-nitrogen-fixing cyanobacterial group meets its
nitrogen requirements in the marine environment. Yet present knowledge about both the mechanisms and regulation of nitrogen acquisition and
its assimilation in marine Synechococcus spp. is limited
(4). However, it is known that ammonium interferes with
nitrate utilization in marine cyanobacteria (13, 33).
Due to the integral differences in nutrient availability between marine
and freshwater ecosystems, it is feasible that the regulation of
nitrogen utilization differs for Synechococcus spp. from the
two environments. We thus set out to investigate the regulation of
nitrogen acquisition in a marine representative of this ecologically
important group by addressing two questions. (i) Does NtcA play a role
in the regulation of nitrogen acquisition in Synechococcus
sp. strain WH 7803? (ii) How is the uptake of oxidized inorganic
nitrogen regulated in this cyanobacterium? In this study we report on
the identification of ntcA in the marine Synechococcus sp. strain WH 7803. We show that
ntcA expression is controlled by ammonium in a manner
similar to that found for freshwater Synechococcus sp.
strain PCC 7942. However, in contrast to the freshwater
Synechococcus strain, the marine Synechococcus strain did not have the capacity for nitrite uptake in
nitrogen-depleted conditions, and the addition of ammonium did not
cause an immediate cessation of nitrite uptake.
 |
MATERIALS AND METHODS |
Culturing conditions.
Cells were grown on ASW, a defined
artificial sea water medium (53) with the addition of 5.9 mM
NaHCO3 and the Va vitamin mix (49). A modified
trace metal mix lacking inorganic nitrogen was used: cobalt nitrate was
replaced with cobalt chloride, and ferric ammonium citrate was replaced
with ferric chloride. The pH of the medium was adjusted to 8.0. This
medium contains 9 mM NaNO3 as the sole nitrogen source and
is referred to here as ASWNO3. For growth under
ammonia conditions, nitrate was replaced by 2 mM NH4Cl
(ASWNH4). Cultures grown on both ammonium and
nitrate contained 2 mM NH4Cl and 9 mM NaNO3
(ASWNH4+NO3). For
nitrogen-depleted conditions we omitted combined nitrogen sources from
the medium (ASW0). In both ASWNH4
and ASW0, sodium ions were brought to the same
concentration as in ASWNO3 by adding 9 mM NaCl.
The purest quality chemicals available from Merck were used for medium
preparation.
Cultures were grown at 25°C in continuous white light at an intensity
of 25 to 30 µmol quanta · m
2 · s
1 with constant agitation on an orbital shaker at 125 rpm. Growth of cultures was monitored by determining the absorbance at
750 nm (A750). Doubling times under these
conditions were in the range of 40 h when either NH4
or NO3 was used as the nitrogen source.
Cells were maintained for a minimum of five generations in exponential
growth phase in the appropriate medium for experiments under steady
growth conditions and prior to induction experiments. Nitrite uptake
assays and RNA analyses were carried out with cells at mid-log phase
(A750 = 0.10 to 0.12, which is the equivalent of
6 × 107 to 10 × 10
7 cells
· ml
1). For induction experiments, cells were grown in
ASWNH4, harvested by centrifugation at
10,000 × g for 10 min at 25°C, washed twice, and
then resuspended in fresh growth medium. When stated, cells were
allowed to acclimate to the conditions after transfer for 20 to 24 h. This period of acclimation was sufficient for cells to produce the
uptake phenotype typical of cells in the new medium. Growth continued
after transfer for at least 24 h in all media, showing that even
the cells transferred into ASW0 were in decent physiological condition when cells were assayed or harvested. Wyman et
al. (53) also reported that Synechococcus sp.
strain WH 7803 grew for at least 24 h after transfer to an ASW
medium devoid of combined nitrogen. Each experiment was repeated a
minimum of two or three times.
Nucleic acid extraction.
Genomic DNA for Southern blot
analyses was prepared by the method for RNA extraction described by
Scanlan et al. (41), except that the RNA was degraded with
pancreatic RNase A. Genomic DNA for PCRs was prepared according to
Scanlan (40), with the omission of the dialysis step.
High-quality plasmid DNA for sequencing and RNA probe preparation was
made with Qiagen plasmid preparation kits. RNA was extracted from
mid-log-phase cells as described in Scanlan et al. (41).
Prior to their resuspension in ice-cold extraction buffer, the cells
were harvested by gentle filtration onto 0.45-µm-pore-size
polycarbonate membrane filters (Poretics). Total RNA was quantified
spectrophotometrically and from ethidium bromide-stained RNA run on
nondenaturing agarose gels. The latter method also served to ensure the
integrity of the RNA before further analysis, as determined by discrete
rRNA bands.
Plasmid construction.
DNA digestions were carried out with
restriction enzymes from Promega. Fragment purification was carried out
with the Geneclean II kit (Bio 101, Inc.). Ligations using T4 ligase
(Promega) were carried out overnight at 15°C into either pGEM-5Zf+
(Promega) or Bluescript KS+ (Stratagene) or into pGEM-T (Promega) for
PCR products. Plasmids were transformed into DH5
competent cells prepared by rubidium chloride treatment and subsequent heat shock (39).
PCR conditions.
Degenerate primers were designed to
correspond to conserved regions of NtcA from freshwater cyanobacteria
(11). Bases in parentheses denote degeneracy. Primer 1f, 5'
AT(CAT) TT(TC) TT(TC) CC(GATC) GG(GATC) GA(TC) CC(GATC) GC 3',
corresponds to bases 395 to 416 of the ntcA gene in
Synechococcus sp. strain PCC 7942 as described previously
(47); primer 2r, 5' GG (GATC)GT (AG)AA (GATC)GC (GATC)AC
(GATC)GC (AG)TG (AG)TA 3', corresponds to bases 562 to 584 in PCC 7942;
primer 3f, 5' CA(AG) AC(GATC) GA(AG) ATG ATG AT(TCA) GA(GA) AC 3',
corresponds to bases 688 to 710 in PCC 7942; and primer 4r, 5' AT
(GATC)GC (TC)TC (GATC)GC (AGT)AT (GATC)GC (TC)TG (AG)T 3', corresponds
to bases 821 to 842 in PCC 7942.
Reactions were run in 50-µl volumes by using an MJ Research
thermocycler with 2 mM MgCl
2, 0.2 mM concentrations of each
deoxynucleoside
triphosphate (dNTP), 0.25 µM concentrations of each
primer, and
1.25 U of
Taq polymerase (Promega). The template
consisted of
ca. 1 ng of genomic DNA from
Synechococcus sp.
strain WH 7803.
Thermocycling conditions for 40 cycles were as follows:
denaturation
at 94°C for 1.2 min, annealing at 55°C for 1 min, and
elongation
at 70°C for 1.5 min.
Taq polymerase was added
after the tubes
had been heated to 95°C for 4 min.
Genomic library screening.
The 449-bp PCR product amplified
from Synechococcus sp. strain WH 7803 with primers 1f and 4r
was used as a probe for library screening and Southern blot analysis.
DNA probes were synthesized with a random primer labeling kit
(Biological Industries) with [
-32P]dATP (3,000 Ci/mmol). The probe was purified using a MicroSpin tube S-200 HR
(Pharmacia). A
Charon 35 genomic library of
Synechococcus sp. strain WH 7803, carrying inserts of
approximately 20 to 30 kb, was kindly provided by D. J. Scanlan.
The Escherichia coli host strain for infections was K803.
Plating and screening of the library were performed according to
standard procedures (39). Plaques were immobilized on
Schleicher & Schuell BA-85 nitrocellulose filters. Prehybridization and
hybridization were carried out in the presence of 6× SSC (1× SSC is
0.15 M NaCl plus 0.015 M sodium citrate), 5× Denhardt's solution,
0.5% sodium dodecyl sulfate (SDS), and 100-µg · ml
1 samples of denatured, fragmented herring sperm DNA at
60°C. The final wash was carried out in 0.5× SSC-0.5% SDS at
60°C. Bacteriophage from positive plaques were isolated, and DNA was
extracted according to standard procedures (39).
Southern blot analysis.
Genomic DNA from
Synechococcus sp. strain WH 7803, digested with a number of
restriction enzymes, was transferred to a positively charged nylon
membrane (Sartorius) by capillary action in 13× SSC. Prehybridization
and hybridization were carried out as described above for library
screening but at 55°C. Hybridization was done in the absence of
Denhardt's solution. Two final 30-min washes in 0.1× SSC-0.1% SDS
were carried out at the hybridization temperature.
DNA sequencing.
DNA sequencing was carried out with
double-stranded plasmid templates using the T7 sequencing kit
(Pharmacia) with
-35S-dATP (1,250 Ci/mmol). GC-rich
regions were resolved on an automated cycle sequencer at 60°C in the
presence of dimethyl sulfoxide. The sequence was verified by sequencing
both strands.
Primer extension.
Primers 9r (5'
TGCGTTGGCGAGGCTCACGTTGCCT 3') and 5r (5'
GGATCACCTCCAACAGGGTTCTG 3') were end labeled with T4
polynucleotide kinase (MBI Fermentas) and [
-32P]ATP.
Labeled primer (300 ng) was annealed to 15 to 50 µg of total RNA in
water by being heated to 68°C for 5 min and then transferred to ice
for 10 min. Extension reactions were carried out at 50°C for 60 min
with 0.15 U of Superscript reverse transcriptase (GIBCO BRL) per µl
in 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM
dithiothreitol, and 0.8 mM deoxynucleoside triphosphate. Ethanol-precipitated nucleic acids were resuspended in a formamide loading solution containing 300 mM NaOH. Sequencing was carried out
with the same primer as that used in the extension experiments. Sequencing ladders were labeled with [
-32P]dATP.
RPAs.
The RNase protection assays (RPAs) were carried out
with two antisense biotinylated RNA probes synthesized by using the
Ambion BrightStar BiotinScript kit. An RNA probe internal to the
ntcA gene was transcribed from a pGEM-T plasmid containing a
PCR fragment amplified from Synechococcus sp. strain WH 7803 with primers 1f and 4r. The upstream RNA probe is complementary to 304 bases upstream and 96 bases downstream of the ntcA
initiation codon. This probe was transcribed from a pGEM-T plasmid
containing a PCR fragment amplified from Synechococcus sp.
WH 7803 with primers 7f (5' AGG CTG ACG TGG ACC TCA AC 3') and 6r (5'
GTT GCG TTC GAT CAG CTC CGT G 3'). The Ambion RPAII kit was used for
the RPAs as follows. The RNA probe was incubated for 16 to 20 h at
43°C with equal amounts of total RNA from the different treatments.
The nonhybridized RNA and probe were digested with a solution of RNase
A and T1 for 30 min at 37°C. After RNase inactivation and
precipitation of the protected fragments (designated here as the
transcript-probe duplexes), they were heat denatured and run on a 5%
polyacrylamide-8 M urea gel. The denatured RNA and probe were then
transferred to a positively charged nylon membrane (BrightStar Plus
membrane; Ambion). Probe detection was carried out with the Ambion
BrightStar BiotinDetect kit followed by exposure on X-ray film (Fuji).
Single-strand RNA standards were synthesized from Century Marker
template DNA (Ambion) with the Ambion BrightStar BiotinScript kit.
Nitrite uptake.
Nitrite uptake assays were initiated by the
addition of 20 µM NaNO2 to mid-log-phase cells in growth
medium under growth conditions. The concentration of nitrite remaining
in the medium was followed after removal of the cells by centrifugation
at 20,000 × g for 4 min. Nitrite concentrations were
determined colorimetrically in duplicates as outlined by Parsons et al.
(32). The chloramphenicol (20 µg · ml
1) and
N,N'-dicyclohexylcarbodiimide (DCCD) (10 µM)
used in uptake experiments were purchased from Sigma Chemical Co.
Nucleotide sequence accession number.
The sequence data
presented here appear in the EMBL/GenBank/DDBJ nucleotide sequence data
libraries under the accession number AF017020.
 |
RESULTS |
Identification of ntcA in Synechococcus sp.
strain WH 7803.
PCR amplification with the degenerate primers
resulted in products of expected sizes for all primer combinations when
genomic DNA from the marine Synechococcus sp. strain WH 7803 was used as a template (data not shown). A 449-bp PCR product was used to probe a genomic library of Synechococcus sp. strain WH
7803 in
Charon 35. The DNA extracted from positive plaques was
subjected to restriction enzyme analysis. A 5-kb ApaI
fragment, a 1.6-kb EcoRI fragment, and a 0.9-kb
SacII fragment all produced 450-bp PCR products with primers
1f and 4r (data not shown). These fragments were subcloned, and
sequencing of the SacII DNA fragment revealed an open
reading frame of 672 nucleotides, with potential Shine-Dalgarno sequences found at 3 (AGGC) and 14 (AGCAGG) bases upstream from the
GTG initiation codon. The DNA sequence of the coding region from
Synechococcus sp. strain WH 7803 has 61.0, 56.8, 56.0, and 52.1% identity to that from Synechococcus sp. strain PCC
7942, Synechocystis sp. strain PCC 6803, Anabaena
sp. strain PCC 7120, and Cyanothece sp. strain BH68K,
respectively. The protein contains 224 amino acids and has 69 to 72%
similarity and 60 to 65% identity to the NtcA proteins from the
above-mentioned cyanobacterial strains. A comparison of amino acid
sequences shows two regions of high identity (above 80%) among the
five NtcA proteins between residues 30 and 95 and between residues 125 and 199 (Fig. 1). These regions correspond to two functional domains in the CRP family of
transcriptional regulators: (i) the N-terminal region between residues
30 and 95 encodes a
-roll structure involved in binding the effector molecule and in dimer formation, and (ii) the C-terminal region between
residues 125 and 199 contains the helix-turn-helix motif involved in
DNA binding. The putative helix-turn-helix motif in NtcA from
Synechococcus sp. strain WH 7803 is identical to that found
for NtcA from other cyanobacteria except for one conserved substitution
(isoleucine at position 191 instead of valine). Two regions of low
identity were found in the 30 N-terminal residues and in a
20-amino-acid stretch beginning at residue 101 (Fig. 1).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of putative amino acid sequences of the NtcA
proteins from Synechococcus sp. strain WH 7803, Synechococcus sp. strain PCC 7942, Synechocystis
sp. strain PCC 6803, Anabaena sp. strain PCC 7120, and
Cyanothece sp. strain BH68K (ATCC 51142). Asterisks mark the
residues identical in all five proteins. Residues unique to one protein
are in bold typeface. The putative helix-turn-helix motif is
underlined.
|
|
Once the presence of
ntcA was established in
Synechococcus sp. strain WH 7803, the number of
ntcA gene copies found in the
genome was determined. Genomic
DNA was digested with a variety
of restriction enzymes and subjected to
Southern analysis with
a homologous probe internal to the
ntcA gene. The probe hybridized
to single restriction
fragments in all cases (Fig.
2),
indicating
that
ntcA exists as a single copy in the genome
of
Synechococcus sp. strain WH 7803. The probe hybridized to
fragments that were
approximately 6, 1.8, and 1 kb when digested with
ApaI,
EcoRI,
and
SacII, respectively.
These sizes correspond with those obtained
from digests of the genomic
DNA library used.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 2.
Southern blot of genomic DNA from
Synechococcus sp. strain WH 7803 in which 5 µg of DNA was
digested with ApaI, HindIII,
EcoRI, BglII, SacII, or
PstI, or left uncut (nondigested), as shown above the gel,
and then run on a 0.7% agarose gel prior to capillary transfer. The
Southern blot was probed with the 449-bp fragment internal to the
ntcA gene from Synechococcus sp. strain WH 7803 amplified with primers 1f and 4r. The apparent sizes of the
ApaI, EcoRI, and SacII fragments are
indicated in kilobases.
|
|
ntcA expression in Synechococcus sp. strain
WH 7803 grown under different nitrogen conditions.
Use of an RNA
probe encoded from within the gene (internal probe) enables relative
quantification of the transcript levels in cells grown under different
conditions. Subjection of total cellular RNA (8 µg) to the RPA
with such a probe resulted in low levels of the transcript-probe
duplex in cells grown on ASWNH4 and
ASWNH4+NO3 (Fig.
3A). However, the levels of the
ntcA transcript were much greater in
ASWNO3-grown cells. When
ASWNH4-grown cells were transferred and
acclimated to ASWNO3 or ASW0 for
20 h, the levels of the ntcA transcript increased
dramatically in comparison to cells transferred back to
ASWNH4 (Fig. 3B). These results indicate that
ntcA transcription in Synechococcus sp. strain WH
7803 was down-regulated by ammonium rather than induced by nitrate.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
RPA showing ntcA transcript levels in
Synechococcus sp. strain WH 7803 grown on different nitrogen
sources. (A) The internal RNA probe was hybridized to 8 µg of total
RNA extracted from cultures grown on ASWNH4
(NH4+), ASWNO3
(NO3 ), and
ASWNH4+NO3
(NH4+ + NO3 ). Yeast RNA subjected to
the RPA protocol (first lane) showed that the probe is degraded
entirely when no homologous transcript is present, and yeast RNA
subjected to the RPA protocol without RNase digestion (second lane)
showed that the probe remained intact throughout the procedure. The
last lane contains single-stranded-RNA standards. (B) The internal RNA
probe was hybridized to 8 µg of total RNA extracted from cultures
transferred from ASWNH4 and acclimated for
20 h in ASWNH4 (NH4+ to
NH4+), ASWNO3
(NH4+ to NO3 ), and ASW0
(NH4+ to N). The first lane contains
single-stranded-RNA standards. In both panels, the full length (in
bases) of the transcript-probe duplex is indicated. This is shorter
than the undigested probe which contains flanking regions of the
cloning vector. The sizes of single-stranded-RNA standards are shown
between the panels (in bases).
|
|
The stability of the
ntcA transcript was monitored after the
addition of rifampin or ammonium to nitrate-grown cells by RPA
analysis
with the internal probe. The levels of the
ntcA transcript
declined rapidly and could barely be detected by 10 min after
rifampin
addition (Fig.
4A). The addition of
ammonium to nitrate-grown
cells led to the reduction of
ntcA
transcript to basal levels
along a similar time scale (data not shown).
The levels of the
transcript-probe duplex were quantified by
densitometry and plotted
as a function of time after rifampin or
ammonium addition (Fig.
4B). The half-lives of the
ntcA
transcript were calculated from
the linear region of the
semilogarithmic plot and were found to
be 1.83 ± 0.2 min
(
R2 = 0.95,
n = 9) and 1.28 ± 0.2 min (
R2 = 0.96,
n = 4)
after rifampin and ammonium addition, respectively.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 4.
ntcA transcript levels after the addition of
rifampin or ammonium. (A) RPA analysis of 8 µg of total RNA extracted
from cells grown on ASWNO3 at the indicated
times after addition of rifampin (150 µg/ml). RPA was carried out
with the internal RNA probe. Times (in minutes) after rifampin addition
are shown above the lanes. Standards are the same as for Fig. 3. (B)
The ntcA transcript levels from RPA analyses were quantified
by densitometry and plotted relative to initial amounts
(t = 0) at intervals after rifampin (150 µg/ml) and
ammonium (2 mM) addition to ASWNO3-grown cells.
The half-lives of the ntcA transcript were calculated by a
linear regression of the data from the linear portion of the decline.
The half-lives were 1.83 ± 0.2 (R2 = 0.95;
n = 9) after rifampin addition and 1.28 ± 0.2 (R2 = 0.96; n = 4) after
ammonium addition.
|
|
In order to determine whether
ntcA in
Synechococcus sp. strain WH 7803 is transcribed from variant
transcription start points
when grown on different nitrogen sources, we
performed primer
extension experiments. Total RNA (15 µg) from cells
grown on ASW
NO3 revealed a single extension
product located 75 bases upstream
of the first coding nucleotide (Fig.
5A and B). An extension product
at this
site was barely visible for ASW
NH4-grown cells
only upon
overexposure of the autoradiogram when 50 µg of RNA was
subjected
to primer extension analysis (data not shown). These results
were
verified with both primers 9r and 5r. This putative transcription
start point is located downstream of a

10 promoter-like box (TAATTT)
and a palindromic sequence (GTGTGCGTTGCTACA) (Fig.
5B). The
palindromic
sequence bears a strong resemblence (identical in 11 of 15 bases)
to the NtcA binding site found upstream of the
ntcA
gene in
Synechococcus sp. strain PCC 7942.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 5.
Identification of transcription start points. (A) Primer
extension analysis of 15 µg of total RNA from cells grown on
ASWNH4 (NH4+) and
ASWNO3 (NO3 ). RNA was
annealed to primer 9r and extended with reverse transcriptase.
Sequencing was carried out on plasmid DNA containing the upstream
region of the gene with the same primer and
[ -32P]dATP. (B) Nucleotide sequence of the upstream
region of ntcA from Synechococcus sp. strain WH
7803. The putative regulated transcription start point for cells grown
on ASWNO3 is indicated by the arrow. The
palindromic sequence and 10-promoter-like box are in uppercase and
underlined. +1 corresponds to the first nucleotide of the GTG
initiation codon. (C) RPA analysis of 30 µg of total RNA from cells
grown on ASWNH4 (NH4+) and
ASWNO3 (NO3 ) with the
upstream probe. The lengths of the transcript-probe duplexes are
indicated. See Fig. 3 for the relevance of the yeast-containing lanes.
The standards are the same as for Fig. 3.
|
|
To determine whether
ntcA is transcribed from a single
transcription start point irrespective of nitrogen source or from
additional
transcription start points that are too far upstream to be
detected
by our primer extension experiments, we performed RPAs using a
probe that overlaps both the coding (96 bases) and upstream (304
bases)
regions of the gene. With such a probe two transcript-probe
duplexes
resulted from cells grown on ASW
NO3 (Fig.
5C),
indicating
that there is indeed more than one transcription start point
for
ntcA in
Synechococcus sp. strain WH 7803. The
165-bp transcript-probe
duplex corresponds to the product received in
primer extension
analyses. The 400-bp duplex spans the length of the
coding and
upstream sections of the probe. (The full-length probe
contains
55 bases from the cloning plasmid.) Thus, we assume that the
putative
transcription start point corresponding to this larger duplex
is further upstream than the beginning of the probe, located 304
bases
upstream from the first coding nucleotide.
The 400-bp transcript-probe duplex was found at similarly low levels in
cells grown on both ASW
NH4 and
ASW
NO3 (Fig.
5C). In
comparison to the 400-bp
duplex, the 165-bp transcript-probe duplex
was found in highly elevated
levels in cells grown on ASW
NO3,
yet it was
absent from ASW
NH4-grown cells (Fig.
5C). Note
that
the 165-bp transcript-probe duplex was more abundant than it
appears
relative to the 400-bp duplex, since 2.5 times fewer
biotinylated
cytosine bases remain in the shorter transcript-probe
duplex.
Cells transferred from ASW
NH4 and
acclimated for 20 h in ASW
0 produced a profile of
ntcA transcripts similar to that of the
ASW
NO3-grown cells (data not shown), and cells
grown on ASW
NH4+NO
3 produced only
the 400-bp duplex (data not shown). These data suggest
that the 400-bp
transcript-probe duplex corresponds to a transcript
expressed
constitutively at low levels, whereas the 165-bp fragment
represents a
regulated
ntcA message transcribed in elevated levels
in the
absence of ammonium.
Uptake of nitrite in Synechococcus sp. strain WH 7803 grown under different nitrogen conditions.
To the best of our
knowledge, the genes for the uptake and assimilation of nitrate and
nitrite have not been identified or cloned for any marine
cyanobacterium to date. As such, it is not possible to correlate
ntcA expression with the transcription of the genes it is
thought to activate in Synechococcus sp. strain WH 7803. We
therefore undertook nitrite uptake assays to serve as an indication of
whether elevated ntcA expression correlates with the
activity of proteins required for uptake and assimilation of nitrogen
sources other than ammonium. Nitrite rather than nitrate assays were
undertaken since nitrite can be accurately and sensitively determined
in the presence of both ammonium and nitrate. Nitrate and nitrite are
transported by the same permease in Synechococcus sp. strain
PCC 7942 (27) and probably in a variety of marine algae
(7). Nitrate and nitrite uptake assays in intact cells measure the cells' ability to both take up and reduce these compounds (19, 25, 38). Furthermore, nitrite reductase activity is necessary for the assimilation of nitrate. Therefore, the uptake of
nitrite is likely to represent the cells' ability to utilize nitrate
as well.
In cyanobacteria nitrite uptake has both a passive and an active
component depending on the pH (
10,
29). Active uptake
is
inhibited by the ATPase inhibitor DCCD. Upon the addition of
10 µM
DCCD (30 min prior to nitrite addition) to
Synechococcus sp.
strain WH 7803 grown in ASW
NO3, the rate of
uptake was less
than 20% that of the nitrite uptake rate without DCCD
(data not
shown). This indicates that under the experimental conditions
used here nitrite uptake was mainly an active process.
Cultures grown in ASW
NH4 were not capable of
taking up nitrite, whereas cells grown in
ASW
NO3 took up the added nitrite readily
(Fig.
6). Cells grown on a combination of
ammonium and nitrate
did not take up nitrite upon its addition (Fig.
6). Within 4 to
6 h after the transfer of cells from
ASW
NH4 to ASW
NO3,
active
nitrite uptake capacity had developed (Fig.
7). Maximal uptake
rates were achieved by
20 to 24 h after transfer. However, cells
transferred to
ASW
0 did not develop the capacity for nitrite uptake
at any
stage after transfer (Fig.
7). In further experiments we
allowed a 20- to 24-h acclimation period when cells that were
fully adapted to the
new conditions after transfer were desired.
The addition of nitrite to
cells thus acclimated in ASW
0 led to
the induction of
active nitrite uptake after a period of delay
(Fig.
8A). The addition of chloramphenicol (a
specific inhibitor
of protein synthesis) 30 min prior to nitrite
addition canceled
the inducible effect of nitrite on uptake (Fig.
8A).
This indicates
that de novo protein synthesis was required for active
nitrite
uptake to develop after the addition of the nitrogen source.
Nitrite
uptake rates in ASW
NO3-acclimated cells
declined exponentially
upon the addition of chloramphenicol (Fig.
8B),
indicating that
continual protein synthesis was required for sustained
nitrite
uptake.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
Nitrite uptake by Synechococcus sp. strain WH
7803 grown on different nitrogen sources. Nitrite (20 µM) was added
at time zero, and the amount remaining in the medium was monitored over
time. Data were normalized as femtomoles of nitrite taken up per cell.
No nitrite remained in the medium of
ASWNO3-grown cells at 100 min after its
addition; thus, this datum point is meaningless and has been omitted
from the graph.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7.
Nitrite uptake rates at intervals after the transfer of
cells from ASWNH4 to
ASWNO3 (NO3 ), to
ASW0 ( N), or back to ASWNH4
(NH4+). For each time point the amount of nitrite taken
up from the medium was monitored for 20 min, and the uptake rate was
then determined. Uptake rates were normalized as femtomoles of nitrite
taken up per cell per hour. The dotted and dashed lines denote the
average uptake rates for cells transferred to
ASWNH4 and ASW0, respectively, and
the solid line is a line of best fit through the data for cells
transferred to ASWNO3.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 8.
Effect of nitrite and chloramphenicol addition on
nitrite uptake by cells transferred from ASWNH4
and acclimated for 20 h to ASW0 (A) and
ASWNO3 (B). Chloramphenicol (CAP) was added 30 min prior to the addition of 20 µM nitrite at 0 min. The amount of
nitrite remaining in the medium was monitored with time. Data were
normalized as femtomoles of nitrite taken up per cell.
|
|
To determine whether nitrate and nitrite act as specific inducers for
the development of active nitrite uptake, it was necessary
to find a
nitrogen source that is utilized by the cell but that
does not inhibit
the capacity for nitrite uptake. The amino acid
leucine can be utilized
by a wide variety of cyanobacteria (
30),
including
Synechococcus sp. strain WH 7803 (
23). The
addition
of leucine to ASW
NO3-grown cells did
not lead to a reduction in
nitrite uptake rates for up to 24 h
after its addition. Cells
acclimated for 20 h in ASW
0
developed the capacity for nitrite
uptake upon addition of nitrate in
combination with leucine (data
not shown). These data indicate that
leucine did not interfere
with nitrite uptake capacity or its
induction. The addition of
leucine alone to ASW
0-acclimated
cells did not lead to the induction
of nitrite uptake capacity. Thus,
despite the fact that leucine
is a utilizable nitrogen source it did
not lead to nitrite uptake,
indicating that nitrogen starvation is not
behind the lack of
nitrite uptake in ASW
0-acclimated cells.
Our data also suggest
that the presence of either nitrite or nitrate is
required for
the induction of nitrite uptake capacity.
Addition of ammonium to cells capable of nitrite uptake brought about a
gradual decline in uptake capacity (Fig.
9). At 4
and 10 h after ammonium
addition, the cells retained 90 and 50%
of their nitrite uptake
capacities, respectively. Cells were still
capable of active nitrite
uptake 24 h after ammonium addition,
as confirmed by the addition
of DCCD (data not shown). The addition
of chloramphenicol to nitrite
uptake-active cells led to a faster
decrease in uptake rates than did
the addition of ammonium. These
data show that no immediate shutdown of
the nitrite uptake system
occurred in
Synechococcus sp.
strain WH 7803 upon ammonium addition.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 9.
Nitrite uptake rates at intervals after the addition of
ammonium (2 mM) or chloramphenicol (20 µg · ml 1)
to cells grown steadily on ASWNO3. Nitrite
taken up from the medium was monitored for 20 min, and the uptake rate
per cell was determined for each datum point. Rates were calculated as
a percentage of the initial uptake rate. The initial uptake rate was
0.13 fmol of NO2 per cell per h.
|
|
 |
DISCUSSION |
NtcA is a member of the CRP family of transcriptional activators
(47). This family of proteins is characterized by an
amino-terminal
-roll structure involved in effector molecule binding
and dimer formation and a carboxy-terminal helix-turn-helix motif
involved in DNA binding (42, 51). The helix-turn-helix motif
in the available amino acid sequences of NtcA from other cyanobacteria is 100% conserved (1, 11). In Synechococcus sp.
strain WH 7803, NtcA has one conserved substitution in this motif. The
presence of isoleucine rather than valine at position 191 in the
helix-turn-helix motif is unlikely to detract from its function in DNA
binding. This position in the DNA binding motif, when filled with
either isoleucine or valine, is one of three residues highly conserved across families of DNA binding proteins and is involved in determining the angle between the two helices (50).
NtcA-regulated genes possess a palindromic consensus sequence in their
upstream regions (12, 26, 34, 35) to which the
helix-turn-helix motif is thought to bind. The palindromic sequence in
a number of these genes from both Synechococcus sp. strain
PCC 7942 (ntcA, nirA, and glnA) and
Anabaena sp. strain PCC 7120 (glnA and
nirA) is positioned 21 to 22 bases upstream of the putative
10 promoter sequence and is centered 39.5 to 40.5 bases upstream of
the regulated transcription start point (12, 26). In
Synechococcus sp. strain WH 7803, the
10-like promoter box
and the palindromic consensus sequence found upstream of
ntcA conform to this precise positioning with respect to the putative transcription start point (Fig. 5B). This strongly suggests that elevated synthesis of NtcA in Synechococcus sp. strain
WH 7803 is autoregulated in a way similar to those of the freshwater Synechococcus sp. strain PCC 7942 and Anabaena
sp. strain PCC 7120 (26, 35). The positioning of the
10
promoter sequence and the transcription start point relative to the
palindromic sequence is not retained in ntcA,
rbcL, and genes encoding proteins involved in heterocyst
formation and nitrogenase expression in Anabaena sp. strain
PCC 7120 (34, 35).
A palindromic sequence identical in 12 of 15 bases to that found in
this study was found upstream of the ureD gene (encoding an
accessory protein required for urease activity) in the marine Synechococcus sp. strain WH 7805 (5). The
presence of putative NtcA-binding sites upstream of ntcA in
strain WH 7803 and ureD in strain WH 7805 suggests that NtcA
plays a role in nitrogen acquisition in marine Synechococcus
species.
The constitutively expressed ntcA message extended far
upstream of the coding region of the gene, raising the possibility that
it is expressed as part of a polycistronic message.
The two transcript populations detected by RPA analyses with the
upstream probe were transcribed under different nitrogen conditions.
The 400-bp transcript-probe duplex corresponded to an ntcA
message that was constitutively expressed. Transcription of this
constitutive mRNA was weak, and the level of this transcript did not
change with changes in nitrogen source availability. The transcription
of ntcA from the regulated transcription start point (corresponding to the 165-bp transcript-probe duplex) was
down-regulated by ammonium. A nitrogen source was not required for the
expression of the regulated transcript. This pattern of expression is
identical to that reported for ntcA from
Synechococcus sp. strain PCC 7942 (26).
The elevated level of ntcA expression from the regulated
transcription start point in the absence of a nitrogen source suggests the presence of an active NtcA protein. Yet Synechococcus
sp. strain WH 7803 was not capable of nitrite uptake. For uptake to occur, de novo protein synthesis was required. This contrasts with the
situation in Synechococcus sp. strain PCC 7942, where the
cell both expresses ntcA at elevated levels and has the
capacity for nitrate and nitrite utilization in nitrogen-deficient
conditions (compare references 26 and
14). Thus, although NtcA activity is likely to be
necessary, its activity appears to be insufficient for the synthesis of
proteins required for nitrite utilization in Synechococcus
sp. strain WH 7803.
Data available to date from freshwater cyanobacteria suggest that the
capacity for nitrate and nitrite utilization in the absence of a
combined nitrogen source is dependent on the ability of the organism to
fix molecular nitrogen. Non-nitrogen fixers are capable of immediate
utilization of nitrate and nitrite in the absence of a nitrogen source,
whereas nitrogen-fixing cyanobacteria can utilize nitrate and nitrite
only when these compounds are available (14, 17, 18, 33,
43). Our data show that the marine non-nitrogen-fixing
Synechococcus sp. strain WH 7803 was incapable of nitrite
uptake upon transfer to a medium lacking a nitrogen source. The lack of
induction of nitrite uptake in the presence of leucine further suggests
that nitrite and nitrate may act as specific inducers for the de novo
synthesis of proteins required for uptake in Synechococcus
sp. strain WH 7803. Marine Synechococcus spp. often inhabit
nitrogen-depleted environments for extended periods. Thus the lack of
synthesis of proteins required for utilization of inorganic nitrogen in
the absence of a specific substrate may be metabolically advantageous.
In two marine Synechococcus strains (WH 7803 and WH 8018),
the presence of ammonium interfered with the uptake of nitrate from the
medium (13). We have shown here that the presence of ammonium also interfered with nitrite uptake.
The short half-life of the ntcA transcript in
Synechococcus sp. strain WH 7803 upon ammonium addition
corresponds to reports for other genes involved in nitrogen nutrition
in cyanobacteria (22, 37, 44). This suggests a common theme
of rapid regulation by ammonium at the level of transcription of genes
required for the utilization of nitrogen sources other than ammonium.
Such a fast turnover in transcript levels would enable the cell to respond immediately to changes in ammonium availability. However, the
addition of ammonium to cells capable of nitrite uptake led to a
gradual decline in nitrite uptake capacity in Synechococcus sp. strain WH 7803. The gradual decline may be due to nonspecific protein degradation coupled with a specific lack of new synthesis of
proteins required for nitrite utilization due to the presence of
ammonium. Thus even though the cell responds within minutes to ammonium
addition by stopping transcription, the physiological response takes
hours to have much of an effect in Synechococcus sp. strain
WH 7803.
 |
ACKNOWLEDGMENTS |
This work was supported by German Ministry for Science and
Technology grant GR1307 and Ecological Foundation of the Keren Kayemet
Le'Israel grant 190/1/702/6. This study was further supported by the
"Moshe Shilo" Minerva Center for Marine Biogeochemistry, Minerva
Stiftung-Gesellschaft fuer die Forschung, Munich, Germany.
We thank D. J. Scanlan and J. Newman for providing us with the
Charon 35 genomic library and for helpful discussions. We also thank E. Flores, D. Scanlan, B. Brahamsha, and two anonymous reviewers for
helpful comments on the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Interuniversity
Institute for Marine Sciences, H. Steinitz Marine Biology Laboratory, P.O. Box 469, Eilat 88103, Israel. Phone: 972-76-360-122. Fax: 972-76-374-329. E-mail: anton{at}vms.huji.ac.il.
 |
REFERENCES |
| 1.
|
Bradley, R. L., and K. J. Reddy.
1997.
Cloning, sequencing, and regulation of the global nitrogen regulator gene ntcA in the unicellular diazotrophic cyanobacterium Cyanothece sp. strain BH68K.
J. Bacteriol.
179:4407-4410[Abstract/Free Full Text].
|
| 2.
|
Burkill, P. H.,
R. J. G. Leakey,
N. J. P. Owens, and R. F. C. Mantoura.
1993.
Synechococcus and its importance to the microbial food web of the northwestern Indian Ocean.
Deep-Sea Res.
40:773-782.
|
| 3.
|
Carpenter, E. J., and D. G. Capone.
1983.
.
Nitrogen in the marine environment.
Academic Press, Inc., New York, N.Y.
|
| 4.
|
Carr, N. G., and N. H. Mann.
1994.
The oceanic cyanobacterial picoplankton, p. 27-48. In
D. A. Bryant (ed.), The molecular biology of cyanobacteria.
Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 5.
| Collier, J. L., and B. Palenik. Unpublished
data.
|
| 6.
|
Dugdale, R. C.
1967.
Nutrient limitation in the sea: dynamics, identification and significance.
Limnol. Oceanogr.
12:685-695.
|
| 7.
|
Falkowski, P. G.
1983.
Enzymology of nitrogen assimilation, p. 839-868. In
E. J. Carpenter, and D. G. Capone (ed.), Nitrogen in the marine environment.
Academic Press, Inc., New York, N.Y.
|
| 8.
|
Falkowski, P. G.
1997.
Evolution of the nitrogen cycle and its influence on the biological sequestration of CO2 in the ocean.
Nature
387:272-275.
|
| 9.
|
Flores, E., and A. Herrero.
1994.
Assimilatory nitrogen metabolism and its regulation, p. 487-517. In
D. A. Bryant (ed.), The molecular biology of cyanobacteria.
Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 10.
|
Flores, E.,
A. Herrero, and M. G. Guerrero.
1987.
Nitrite uptake and its regulation in the cyanobacterium Anacystis nidulans.
Biochim. Biophys. Acta
896:103-108.
|
| 11.
|
Frias, J. E.,
A. Merida,
A. Herrero,
J. Martin-Nieto, and E. Flores.
1993.
General distribution of the nitrogen control gene ntcA in cyanobacteria.
J. Bacteriol.
175:5710-5713[Abstract/Free Full Text].
|
| 12.
|
Frias, J. E.,
E. Flores, and A. Herrero.
1994.
Requirement of the regulatory protein NtcA for the expression of nitrogen assimilation and heterocyst development genes in the cyanobacterium Anabaena sp. PCC 7120.
Mol. Microbiol.
14:823-832[Medline].
|
| 13.
|
Glibert, P. M., and R. T. Ray.
1990.
Different patterns of growth and nitrogen uptake in two clones of marine Synechococcus spp.
Mar. Biol. (Berlin)
107:273-280.
|
| 14.
|
Guerrero, M. G., and C. Lara.
1987.
Assimilation of inorganic nitrogen, p. 163-186. In
P. Fay, and C. Van Baalen (ed.), The cyanobacteria.
Elsevier Science Publishers B.V., Amsterdam, The Netherlands.
|
| 15.
|
Harrison, W. G.
1990.
Nitrogen utilization in chlorophyll and primary productivity maximum layers: an analysis based on the f-ratio.
Mar. Ecol. Prog. Ser.
60:85-90.
|
| 16.
|
Hecky, R. E., and P. Kilham.
1988.
Nutrient limitation of phytoplankton in freshwater and marine environments: a review of recent evidence on the effects of enrichment.
Limnol. Oceanogr.
33:796-822.
|
| 17.
|
Herrero, A.,
E. Flores, and M. G. Guerrero.
1981.
Regulation of nitrate reductase levels in the cyanobacteria Anacystis nidulans, Anabaena sp. strain 7119, and Nostoc sp. strain 6719.
J. Bacteriol.
145:175-180[Abstract/Free Full Text].
|
| 18.
|
Herrero, A.,
E. Flores, and M. G. Guerrero.
1985.
Regulation of nitrate reductase cellular levels in the cyanobacteria Anabaena variabilis and Synechocystis sp.
FEMS Microbiol. Lett.
26:21-25.
|
| 19.
|
Herrero, A., and M. G. Guerrero.
1986.
Regulation of nitrite reductase in the cyanobacterium Anacystis nidulans.
J. Gen. Microbiol.
132:2463-2468.
|
| 20.
|
Iturriaga, R., and B. G. Mitchell.
1986.
Chrococcoid cyanobacteria: a significant component in the food web dynamics of the open ocean.
Mar. Ecol. Prog. Ser.
28:291-297.
|
| 21.
|
Johnson, P. W., and J. M. Sieburth.
1979.
Chrococcoid cyanobacteria in the sea: a ubiquitous and diverse phototrophic biomass.
Limnol. Oceanogr.
24:928-935.
|
| 22.
|
Kikuchi, H.,
M. Aichi,
I. Suzuki, and T. Omata.
1996.
Positive regulation by nitrite of the nitrate assimilation operon in the cyanobacteria Synechococcus sp. strain PCC 7942 and Plectonema boryanum.
J. Bacteriol.
178:5822-5825[Abstract/Free Full Text].
|
| 23.
|
Kramer, J. G.
1990.
The effect of irradiance and specific inhibitors on protein and nucleic acid synthesis in the marine cyanobacterium Synechococcus sp. WH 7803.
Arch. Microbiol.
154:280-285.
|
| 24.
|
Lara, C.,
R. Rodriguez, and M. G. Guerrero.
1993.
Nitrate transport in the cyanobacterium Anacystis nidulans.
Physiol. Plant.
89:582-587.
|
| 25.
|
Lara, C.,
R. Rodriguez, and M. G. Guerrero.
1993.
Sodium-dependent nitrate transport and energetics of cyanobacteria.
J. Phycol.
29:389-395.
|
| 26.
|
Luque, I.,
E. Flores, and A. Herrero.
1994.
Molecular mechanism for the operation of nitrogen control in cyanobacteria.
EMBO J.
13:2862-2869[Medline].
|
| 27.
|
Luque, I.,
E. Flores, and A. Herrero.
1994.
Nitrate and nitrite transport in the cyanobacterium Synechococcus sp. PCC 7942 are mediated by the same permease.
Biochim. Biophys. Acta
1184:296-298.
|
| 28.
|
Mann, N. H.
1995.
How do cells express nutrient limitation at the molecular level?
NATO ASI Ser. G
38:171-190.
|
| 29.
|
Martin-Nieto, J.,
A. Herrero, and E. Flores.
1989.
Regulation of nitrate and nitrite reductases in dinitrogen-fixing cyanobacteria and Nif mutants.
Arch. Microbiol.
151:475-478.
|
| 30.
|
Montesinos, M. L.,
A. Herrero, and E. Flores.
1997.
Amino acid transport in taxonomically diverse cyanobacteria and identification of two genes encoding elements of a neutral amino acid permease putatively involved in recapture of leaked hydrophobic amino acids.
J. Bacteriol.
179:853-862[Abstract/Free Full Text].
|
| 31.
|
Parsons, T. R.,
M. Takahashi, and B. Hargrave.
1984.
.
Biological oceanographic processes, 3rd ed.
Pergamon Press, Inc., Elmsford, N.Y.
|
| 32.
|
Parsons, T. R.,
Y. Maita, and C. M. Lalli.
1984.
.
A manual of chemical and biological methods of sea water analysis.
Pergamon Press, Inc., Elmsford, N.Y.
|
| 33.
|
Rai, A. N.,
M. Borthakur, and B. Bergman.
1992.
Nitrogenase derepression, its regulation and metabolic changes associated with diazotrophy in the nonheterocystous cyanobacterium Plectonema boryanum PCC 73110.
J. Gen. Microbiol.
138:481-491.
|
| 34.
|
Ramasubramanian, T. S.,
T. F. Wei, and J. W. Golden.
1994.
Two Anabaena sp. strain PCC 7120 DNA-binding factors interact with vegetative cell- and heterocyst-specific genes.
J. Bacteriol.
176:1214-1223[Abstract/Free Full Text].
|
| 35.
|
Ramasubramanian, T. S.,
T. F. Wei,
A. K. Oldham, and J. W. Golden.
1996.
Transcription of the Anabaena sp. strain PCC 7120 ntcA gene: multiple transcripts and NtcA binding.
J. Bacteriol.
178:922-926[Abstract/Free Full Text].
|
| 36.
|
Reitzer, L. J., and B. Magasanik.
1987.
Ammonia assimilation and the biosynthesis of glutamine, glutamate, aspartate, asparagine, L-alanine, and D-alanine, p. 302-320. In
F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium.
American Society for Microbiology, Washington, D.C.
|
| 37.
|
Reyes, J. C.,
M. I. Muro-Pastor, and F. J. Florencio.
1997.
Transcription of glutamine synthetase (glnA and glnN) from the cyanobacterium Synechocystis sp. strain PCC 6803 is differently regulated in response to nitrogen availability.
J. Bacteriol.
179:2678-2689[Abstract/Free Full Text].
|
| 38.
|
Rodriguez, R.,
C. Lara, and M. G. Guerrero.
1992.
Nitrate transport in the cyanobacterium Anacystis nidulans R2. Kinetic and energetic aspects.
Biochem. J.
282:639-643.
|
| 39.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 40.
|
Scanlan, D. J.,
S. A. Bloye,
N. H. Mann,
D. A. Hodgson, and N. G. Carr.
1990.
Construction of lacZ promoter probe vectors for use in Synechococcus: application to the identification of CO2-regulated promoters.
Gene
90:43-49[Medline].
|
| 41.
|
Scanlan, D. J.,
N. H. Mann, and N. G. Carr.
1993.
The response of the picoplanktonic marine cyanobacterium Synechococcus species WH 7803 to phosphate starvation involves a protein homologous to the periplasmic phosphate-binding protein of Escherichia coli.
Mol. Microbiol.
10:181-191[Medline].
|
| 42.
|
Shaw, D. J.,
D. W. Rice, and J. R. Guest.
1983.
Homology between CAP and Fnr, a regulator of anaerobic respiration in Escherichia coli.
J. Mol. Biol.
166:241-247[Medline].
|
| 43.
|
Sivak, M. N.,
C. Lara,
J. M. Romero,
R. Rodriguez, and M. G. Guerrero.
1989.
Relationship between a 47-kDa cytoplasmic membrane polypeptide and nitrate transport in Anacystis nidulans.
Biochem. Biophys. Res. Commun.
158:257-262[Medline].
|
| 44.
|
Suzuki, I.,
T. Sugiyama, and T. Omata.
1993.
Primary structure and transcriptional regulation of the gene for nitrite reductase from the cyanobacterium Synechococcus PCC 7942.
Plant Cell Physiol.
34:1311-1320[Abstract/Free Full Text].
|
| 45.
|
Suzuki, I.,
N. Horie,
T. Sugiyama, and T. Omata.
1995.
Identification and characterization of two nitrogen-regulated genes of the cyanobacterium Synechococcus sp. strain PCC 7942 required for maximum efficiency of nitrogen assimilation.
J. Bacteriol.
177:290-296[Abstract/Free Full Text].
|
| 46.
|
Vega-Palas, M. A.,
F. Madueno,
A. Herrero, and E. Flores.
1990.
Identification and cloning of a regulatory gene for nitrogen assimilation in the cyanobacterium Synechococcus sp. strain PCC 7942.
J. Bacteriol.
172:643-647[Abstract/Free Full Text].
|
| 47.
|
Vega-Palas, M. A.,
E. Flores, and A. Herrero.
1992.
NtcA, a global nitrogen regulator from the cyanobacterium Synechococcus that belongs to the CRP family of bacterial regulators.
Mol. Microbiol.
6:1853-1859[Medline].
|
| 48.
|
Waterbury, J. B.,
S. W. Watson,
R. R. L. Guillard, and L. E. Brand.
1979.
Widespread occurrence of a unicellular, marine, planktonic cyanobacterium.
Nature
277:293-294.
|
| 49.
|
Waterbury, J. B., and J. M. Willey.
1988.
Isolation and growth of marine planktonic cyanobacteria.
Methods Enzymol.
167:100-105.
|
| 50.
|
Weber, I. T.,
D. B. McKay, and T. A. Steitz.
1982.
Two helix DNA binding motif of CAP found in lac repressor and gal repressor.
Nucleic Acids Res.
10:5085-5102[Abstract/Free Full Text].
|
| 51.
|
Weber, I. T., and T. A. Steitz.
1987.
Structure of a complex of catabolite gene activator protein and cyclic AMP refined at 2.5 Å resolution.
J. Mol. Biol.
198:311-326[Medline].
|
| 52.
|
Wei, T.-F.,
T. S. Ramasubramanian, and J. W. Golden.
1994.
Anabaena sp. strain PCC 7120 ntcA gene required for growth on nitrate and heterocyst development.
J. Bacteriol.
176:4473-4482[Abstract/Free Full Text].
|
| 53.
|
Wyman, M.,
R. P. F. Gregory, and N. G. Carr.
1985.
Novel role for phycoerythrin in a marine cyanobacterium, Synechococcus strain DC2.
Science
230:818-820[Abstract/Free Full Text].
|
J Bacteriol, April 1998, p. 1878-1886, Vol. 180, No. 7
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wawrik, B., Callaghan, A. V., Bronk, D. A.
(2009). Use of Inorganic and Organic Nitrogen by Synechococcus spp. and Diatoms on the West Florida Shelf as Measured Using Stable Isotope Probing. Appl. Environ. Microbiol.
75: 6662-6670
[Abstract]
[Full Text]
-
Riding, R.
(2009). An atmospheric stimulus for cyanobacterial-bioinduced calcification ca. 350 million years ago?. PALAIOS
24: 685-696
[Abstract]
[Full Text]
-
Scanlan, D. J., Ostrowski, M., Mazard, S., Dufresne, A., Garczarek, L., Hess, W. R., Post, A. F., Hagemann, M., Paulsen, I., Partensky, F.
(2009). Ecological Genomics of Marine Picocyanobacteria. Microbiol. Mol. Biol. Rev.
73: 249-299
[Abstract]
[Full Text]
-
Wyman, M., Bird, C.
(2007). Lack of Control of Nitrite Assimilation by Ammonium in an Oceanic Picocyanobacterium, Synechococcus sp. Strain WH 8103. Appl. Environ. Microbiol.
73: 3028-3033
[Abstract]
[Full Text]
-
Garcia-Fernandez, J. M., de Marsac, N. T., Diez, J.
(2004). Streamlined Regulation and Gene Loss as Adaptive Mechanisms in Prochlorococcus for Optimized Nitrogen Utilization in Oligotrophic Environments. Microbiol. Mol. Biol. Rev.
68: 630-638
[Abstract]
[Full Text]
-
Valladares, A., Muro-Pastor, A. M., Herrero, A., Flores, E.
(2004). The NtcA-Dependent P1 Promoter Is Utilized for glnA Expression in N2-Fixing Heterocysts of Anabaena sp. Strain PCC 7120. J. Bacteriol.
186: 7337-7343
[Abstract]
[Full Text]
-
Bird, C., Wyman, M.
(2003). Nitrate/Nitrite Assimilation System of the Marine Picoplanktonic Cyanobacterium Synechococcus sp. Strain WH 8103: Effect of Nitrogen Source and Availability on Gene Expression. Appl. Environ. Microbiol.
69: 7009-7018
[Abstract]
[Full Text]
-
Vogel, J., Axmann, I. M., Herzel, H., Hess, W. R.
(2003). Experimental and computational analysis of transcriptional start sites in the cyanobacterium Prochlorococcus MED4. Nucleic Acids Res
31: 2890-2899
[Abstract]
[Full Text]
-
Fuller, N. J., Marie, D., Partensky, F., Vaulot, D., Post, A. F., Scanlan, D. J.
(2003). Clade-Specific 16S Ribosomal DNA Oligonucleotides Reveal the Predominance of a Single Marine Synechococcus Clade throughout a Stratified Water Column in the Red Sea. Appl. Environ. Microbiol.
69: 2430-2443
[Abstract]
[Full Text]
-
Anbar, A. D., Knoll, A. H.
(2002). Proterozoic Ocean Chemistry and Evolution: A Bioinorganic Bridge?. Science
297: 1137-1142
[Abstract]
[Full Text]
-
Zehr, J. P., Ward, B. B.
(2002). Nitrogen Cycling in the Ocean: New Perspectives on Processes and Paradigms. Appl. Environ. Microbiol.
68: 1015-1024
[Full Text]
-
Lindell, D., Post, A. F.
(2001). Ecological Aspects of ntcA Gene Expression and Its Use as an Indicator of the Nitrogen Status of Marine Synechococcus spp.. Appl. Environ. Microbiol.
67: 3340-3349
[Abstract]
[Full Text]
-
Herrero, A., Muro-Pastor, A. M., Flores, E.
(2001). Nitrogen Control in Cyanobacteria. J. Bacteriol.
183: 411-425
[Full Text]
-
Wyman, M.
(1999). Diel Rhythms in Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase and Glutamine Synthetase Gene Expression in a Natural Population of Marine Picoplanktonic Cyanobacteria (Synechococcus spp.). Appl. Environ. Microbiol.
65: 3651-3659
[Abstract]
[Full Text]
-
Partensky, F., Hess, W. R., Vaulot, D.
(1999). Prochlorococcus, a Marine Photosynthetic Prokaryote of Global Significance. Microbiol. Mol. Biol. Rev.
63: 106-127
[Abstract]
[Full Text]