Previous Article | Next Article 
J Bacteriol, April 1998, p. 1951-1954, Vol. 180, No. 7
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Atrazine Catabolism Genes atzABC Are
Widespread and Highly Conserved
Mervyn L.
de
Souza,1,2,3
Jennifer
Seffernick,1,3
Betsy
Martinez,1,3
Michael J.
Sadowsky,2,3,4,5 and
Lawrence P.
Wackett1,2,3,4,*
Department of
Biochemistry,1
Department of
Microbiology,4
Department of Soil,
Water, and Climate,5
Biological
Process Technology Institute,2 and
Center for Biodegradation Research and
Informatics,3 University of Minnesota, St.
Paul, Minnesota 55108
Received 22 May 1997/Accepted 28 January 1998
 |
ABSTRACT |
Pseudomonas strain ADP metabolizes the herbicide
atrazine via three enzymatic steps, encoded by the genes
atzABC, to yield cyanuric acid, a nitrogen source for many
bacteria. Here, we show that five geographically distinct
atrazine-degrading bacteria contain genes homologous to
atzA, -B, and -C. The sequence
identities of the atz genes from different
atrazine-degrading bacteria were greater than 99% in all pairwise
comparisons. This differs from bacterial genes involved in the
catabolism of other chlorinated compounds, for which the average
sequence identity in pairwise comparisons of the known members of a
class ranged from 25 to 56%. Our results indicate that globally
distributed atrazine-catabolic genes are highly conserved in diverse
genera of bacteria.
 |
TEXT |
Atrazine [2-chloro-4-(ethylamino)-6-(isopropylamino)- 1,3,5-triazine]
is a herbicide used for controlling broad-leaf and grassy weeds and is
relatively persistent in soils (51). Atrazine and other
s-triazine compounds have been detected in ground and
surface waters at levels exceeding the Environmental Protection
Agency's maximum contaminant level of 3 ppb (30).
Microbial populations exposed to synthetic chlorinated compounds, such
as atrazine, often respond by producing enzymes that degrade these
molecules. Most of our current understanding of the genes and enzymes
involved in atrazine degradation derives from studies using
Pseudomonas strain ADP, in which the first three enzymatic
steps in atrazine degradation have been defined (6, 14, 15,
48). The genes atz A, -B, and
-C, which encode these enzymes, have been cloned and
sequenced. Atrazine chlorohydrolase (AtzA), hydroxyatrazine
ethylaminohydrolase (AtzB), and N-isopropylammelide isopropylaminohydrolase (AtzC) sequentially convert atrazine to cyanuric acid (6, 14, 15, 48) (Fig.
1). Cyanuric acid and related compounds
are catabolized by many soil bacteria (10, 11, 17, 24, 26,
61), and by Pseudomonas sp. ADP, to carbon dioxide and
ammonia (35). This provides the evolutionary pressure for
the atzA, -B, and -C genes to permit
bacterial growth on the more than one billion pounds of atrazine that
have been applied to soils globally (20). Here we used a
knowledge of the atzA, -B, and -C gene
sequences to investigate the presence of homologous genes in other
atrazine-degrading bacteria. In this study, we report that five
atrazine-degrading microorganisms, which were recently isolated from
geographically separated sites exposed to atrazine, contained nearly
identical atzA, -B, and -C genes.
Atrazine-catabolizing bacteria used in this study.
Until
recently, attempts at isolating bacteria (18) or fungi
(27) that completely degrade atrazine to carbon dioxide, ammonia, and chloride were unsuccessful. While several
microorganisms were shown to dealkylate atrazine, they were
unable to displace the chlorine atom (41, 54). Since 1994, several research groups have independently isolated atrazine-degrading
bacteria that displaced the chlorine atom and mineralized atrazine
(3, 7, 13, 35, 39, 46). Six of these bacterial cultures,
listed in Table 1, were studied here, and
the Clavibacter strain had been investigated previously
(13).
Detection of atzA, -B, and -C
homologs in atrazine-degrading microorganisms by PCR analysis.
Recently isolated atrazine-degrading bacteria were screened for the
presence of DNA homologous to the Pseudomonas strain ADP atzABC genes, which encode enzymes transforming atrazine to
cyanuric acid (Fig. 1). Total genomic DNA was isolated from each of
these bacteria as described elsewhere (49), and the PCR
technique was used to amplify sequences internal to the
atzA, -B, and -C genes as described
elsewhere (13). Custom primers were designed specifically
for atzA (5'CCATGTGAACCAGATCCT3' and
5'TGAAGCGTCCACATTACC3'), atzB
(5'TCACCGGGGATGTCGCGGGC3' and
5'CTCTCCCGCATGGCATCGGG3'), and atzC
(5'GCTCACATGCAGGTACTCCA3' and
5'GTACCATATCACCGTTTGCCA3') by using the Primer Designer
package, version 2.01 (Scientific and Educational Software, State Line,
Pa.), and were synthesized by Gibco BRL (Gaithersburg, Md.). PCR
fragments were amplified by using Taq DNA polymerase (Gibco
BRL) (22) and were separated from primers on a 1.0% agarose
gel. The results of these studies (Fig.
2) indicated that PCR amplification
consistently produced DNA fragments of 0.5 kb for all organisms when
the atzA or -B primers were used and fragments of
0.6 kb when the atzC primers were used.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
PCR analysis with primers designed to amplify internal
regions of atzA (lanes 1 to 5), atzB (lanes 6 to
10), and atzC (lanes 11 to 15). The atrazine-degrading
bacteria analyzed were Pseudomonas strain ADP
(35) (lanes 1, 6, and 11), Alcaligenes strain SGI
(7) (lanes 2, 7, and 12), Ralstonia strain M91-3
(46) (lanes 3, 8, and 13), Agrobacterium strain
J14a (39) (lanes 4, 9, and 14), and isolate 38/38
(3) (lanes 5, 10, and 15). Values to the right of the gel
are sizes (in kilobase pairs).
|
|
Southern hybridization analyses were performed on the PCR-amplified
DNA as described elsewhere (
49) to confirm the presence
of
homologous DNA. We used a 0.6-kb
ApaI/
PstI
fragment from pMD4
(
15), a 1.5-kb
BglII
fragment from pATZB-2 (
6), and a 2.0-kb
EcoRI/
AvaI fragment from pTD2.5 (
48)
as probes for
atzA, -
B,
and -
C genes,
respectively. DNA probes were labeled with [

-
32P]dCTP
by using the Rediprime Random Primer Labeling Kit (Amersham
Life
Science, Arlington Heights, Ill.) according to the manufacturer's
instructions. Southern hybridization analyses, performed under
stringent conditions, confirmed that each strain contained DNA
homologous to
atzA, -
B, and -
C (data
not shown). With strain M91-3
and isolate 38/38, however, in addition
to the expected 0.5-kb
atzB PCR product (Fig.
2, lanes 8 and
10), a 1.2-kb fragment was
also obtained. However, no hybridization to
this fragment was
seen with the
atzB probe. Similar
investigations showed that a
mixed culture obtained from Switzerland
(Table
1), capable of
degrading atrazine, also contained DNA homologous
to all three
atz genes (
12).
As a negative control, bacteria known not to degrade atrazine
were analyzed. PCR analyses were carried out with genomic DNA
from
the following randomly chosen laboratory strains:
Rhodococcus chlorophenolicus (
1),
Flavobacterium sp.
(
47),
Streptomyces coelicolor M145
(
21),
Amycolatopsis mediterranei
(
19),
Agrobacterium strain A136 and strain A348
(A136/pTiA6NC) (
60),
Arthrobacter globiformis MN1 (
45),
Bradyrhizobium
japonicum (
33),
Rhizobium sp. strain NGR 234 (
44),
Pseudomonas NRRLB12228, and
Klebsiella pneumoniae 99 (
16). None of
these strains contained DNA that
was amplified by PCR using the primers
designed to identify the
atzA, -
B, or
-
C gene (data not shown).
DNA sequences of atzA, -B, and
-C homologs in atrazine-degrading microorganisms.
DNAs amplified from the five strains in Table 1 with the
atzA, -B, and -C primers were purified
from gel slices by using the GeneClean II System (Bio 101, Inc., Vista,
Calif.) and sequenced with a PRISM Ready Reaction DyeDeoxy Terminator
Cycle Sequencing kit (Perkin-Elmer Corp., Norwalk, Conn.) and an ABI
model 373A DNA sequencer (Applied Biosystems, Foster City, Calif.). The
GCG sequence analysis software package (Genetics Computer Group,
Inc., Madison, Wis.) was used for all DNA and protein
sequence comparisons and alignments. Table
2 summarizes these data. The
PCR-amplified genes were
99% identical to the Pseudomonas
strain ADP atzA, -B, and -C genes in
all pairwise comparisons of DNA sequences. This remarkable sequence
identity suggested that each atz gene in the different
genera was derived from a common ancestor and that they have diverged
evolutionarily only to a limited extent.
A review of the literature on other bacterial catabolic pathways
indicated a much greater degree of divergence when genes
encoding
enzymes for the catabolism of other commercially relevant
chlorinated
compounds were compared (Table
3). As
with atrazine,
multiple bacterial strains that catabolize
1,2-dichloroethane,
chloroacetic acid,
2,4-dichlorophenoxyacetate, dichloromethane,
and
4-chlorobenzoate have been isolated. A comparison of the gene
sequences
encoding the initiating reactions in the catabolism
of each of those
compounds revealed that sequence divergence was
comparatively high. In
pairwise comparisons within each gene class,
the average sequence
identities ranged from 25 to 56% (divergence
was 46 to 75%). With the
atzABC genes, by contrast, there is at
most a 1% sequence
difference within the sequenced gene region
(Table
2). Moreover, the
atzB sequences were completely identical,
and the
atzC genes diverged by only 1 bp in one of the five strains
tested. This suggests that the
atz genes recently arose from
a
single origin and have become distributed globally. Similarly,
identical parathion hydrolase genes were isolated from two bacteria
representing different genera and global locations (
40,
52,
53).
The data presented here provide further support for previous studies
suggesting that hydroxyatrazine in the environment derives
from
biological processes (
36), and not solely from abiotic
reactions (
2,
9). The present data, and a recent report
by
Bouquard et al. (
8), indicate that the gene encoding
atrazine
chlorohydrolase is widespread in the United States and Europe.
Our observations argue for a single, recent evolutionary origin of the
atz genes and their subsequent global distribution.
We have
recently localized the
atzA, -
B, and
-
C genes to a large,
self-transmissible plasmid in
Pseudomonas strain ADP (
12), and
possible
mechanisms of transfer of the
atzABC genes are currently
under investigation.
 |
ACKNOWLEDGMENTS |
This work was supported in part by a grant from Novartis Crop
Protection, Greensboro, N.C. (formerly Ciba-Geigy Corporation), and by
grant 94-34339-1122 from the U.S. Department of Agriculture BARD
program (as grant US-2364-93 from BARD, the United States-Israel Binational Agricultural Research and Development Fund).
We thank Janis Mcfarland and Steven Dumford of Novartis Crop Protection
for providing s-triazine compounds, and David Gartner for
technical assistance. We also thank David Crowley, Dave Newcombe, Gerhard Stucki, Mark Radosevich, Thomas Moorman, Ron Turco, Kyria Boundy-Mills, and Zhaoukun Tong for providing atrazine-degrading microorganisms or plasmids.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, Biological Process Technology Institute and Center
for Biodegradation Research & Informatics, University of
Minnesota, 240 Gortner Labs, 1479 Gortner Ave., St. Paul, MN 55108. Phone: (612) 625-3785. Fax: (612) 625-1700. E-mail:
wackett{at}biosci.cbs.umn.edu.
 |
REFERENCES |
| 1.
|
Apajalahti, J. H. A.,
P. Kärpänoja, and M. S. Salkinoja-Salonen.
1986.
Rhodococcus chlorophenolicus sp. nov., a chlorophenol-mineralizing actinomycete.
Int. J. Syst. Bacteriol.
36:246-251[Abstract/Free Full Text].
|
| 2.
|
Armstrong, D. E., and G. Chesters.
1968.
Adsorption catalysed chemical hydrolysis of atrazine.
Environ. Sci. Technol.
2:683-689.
|
| 3.
|
Assaf, N. A., and R. F. Turco.
1994.
Accelerated biodegradation of atrazine by a microbial consortium is possible in culture and soil.
Biodegradation
5:29-35[Medline].
|
| 4.
|
Bader, R., and T. Leisinger.
1994.
Isolation and characterization of the Methylophilus sp. strain DM11 gene encoding dichloromethane dehalogenase/glutathione S-transferase.
J. Bacteriol.
176:3466-3473[Abstract/Free Full Text].
|
| 5.
|
Barth, P. T.,
L. Bolton, and J. C. Thompson.
1992.
Cloning and partial sequencing of an operon encoding two Pseudomonas putida haloalkanoate dehalogenases of opposite stereospecificity.
J. Bacteriol.
174:2612-2619[Abstract/Free Full Text].
|
| 6.
|
Boundy-Mills, K.,
M. L. de Souza,
R. M. Mandelbaum,
L. P. Wackett, and M. J. Sadowsky.
1997.
The atzB gene of Pseudomonas sp. strain ADP encodes the second enzyme of a novel atrazine degradation pathway.
Appl. Environ. Microbiol.
63:916-923[Abstract].
|
| 7.
| Boundy-Mills, K. L., L. P. Wackett, and
M. J. Sadowsky. Unpublished data.
|
| 8.
|
Bouquard, C.,
J. Ouazzani,
J.-C. Prome,
Y. Michel-Briand, and P. Plesiat.
1997.
Dechlorination of atrazine by a Rhizobium sp. isolate.
Appl. Environ. Microbiol.
63:862-866[Abstract].
|
| 9.
|
Burkhard, N., and J. A. Guth.
1981.
Chemical hydrolysis of 2-chloro-4,6-bis(alkylamino)-1,3,5-triazine herbicides and their breakdown in soil under the influence of adsorption.
Pestic. Sci.
17:241-245.
|
| 10.
|
Cook, A. M.
1987.
Biodegradation of s-triazine xenobiotics.
FEMS Microbiol. Rev.
46:93-116.
|
| 11.
|
Cook, A. M.,
P. Beilstein,
H. Grossenbacher, and R. Huetter.
1985.
Ring cleavage and degradative pathway of cyanuric acid in bacteria.
Biochem. J.
231:25-30[Medline].
|
| 12.
| de Souza, M. L. Unpublished data.
|
| 13.
|
de Souza, M. L.,
D. Newcombe,
S. Alvey,
D. E. Crowley,
A. Hay,
M. J. Sadowsky, and L. P. Wackett.
1998.
Molecular basis of a bacterial consortium: interspecies catabolism of atrazine.
Appl. Environ. Microbiol.
64:178-184[Abstract/Free Full Text].
|
| 14.
|
de Souza, M. L.,
M. J. Sadowsky, and L. P. Wackett.
1996.
Atrazine chlorohydrolase from Pseudomonas sp. strain ADP: gene sequence, enzyme purification, and protein characterization.
J. Bacteriol.
178:4894-4900[Abstract/Free Full Text].
|
| 15.
|
de Souza, M. L.,
L. P. Wackett,
K. L. Boundy-Mills,
R. T. Mandelbaum, and M. J. Sadowsky.
1995.
Cloning, characterization, and expression of a gene region from Pseudomonas sp. strain ADP involved in the dechlorination of atrazine.
Appl. Environ. Microbiol.
61:3373-3378[Abstract].
|
| 16.
|
Eaton, R. W., and J. S. Karns.
1991.
Cloning and comparison of the DNA encoding ammelide aminohydrolase and cyanuric acid amidohydrolase from three s-triazine-degrading bacterial strains.
J. Bacteriol.
173:1363-1366[Abstract/Free Full Text].
|
| 17.
|
Erickson, E. L., and K. H. Lee.
1989.
Degradation of atrazine and related s-triazines.
Crit. Rev. Environ. Contam.
19:1-13.
|
| 18.
|
Geller, A.
1980.
Studies on the degradation of atrazine by bacterial communities enriched from various biotopes.
Arch. Environ. Contam. Toxicol.
9:289-305[Medline].
|
| 19.
|
Ghisalba, O., and J. Nuesch.
1981.
A genetic approach to the biosynthesis of the rifamycin-chromophore in Nocardia mediterranei. IV. Identification of 3-amino-5-hydroxybenzoic acid as a direct precursor of the seven-carbon amino started-unit.
J. Antibiot.
34:64-71[Medline].
|
| 20.
|
Gianessi, L. P.
1987.
Lack of data stymies informed decisions on agricultural pesticides.
Resources
89:1-4.
|
| 21.
|
Hopwood, D. A.,
M. J. Bibb,
K. F. Chater,
T. Kieser,
C. J. Bruton,
H. M. Kieser,
D. J. Lydiate,
C. P. Smith,
J. M. Ward, and H. S. Schrempf.
1985.
.
Genetic manipulation of Streptomyces: a laboratory manual.
John Innes Institute, Norwich, United Kingdom.
|
| 22.
|
Innis, M. A.,
D. H. Gelfand,
J. J. Sinsky, and T. J. White.
1990.
.
PCR protocols: a guide to methods and applications.
Academic Press, Inc., New York, N.Y.
|
| 23.
|
Janssen, D. B.,
F. Pries,
J. van der Ploeg,
B. Kazemier,
P. Terpstra, and B. Witholt.
1989.
Cloning of 1,2-dichloroethane degradation genes of Xanthobacter autotrophicus GJ10 and expression and sequencing of the dhlA gene.
J. Bacteriol.
171:6791-6799[Abstract/Free Full Text].
|
| 24.
|
Jessee, J. A.,
R. E. Benoit,
A. C. Hendricks,
G. C. Allen, and J. L. Neal.
1983.
Anaerobic degradation of cyanuric acid, cysteine, and atrazine by a facultatively anaerobic bacterium.
Appl. Environ. Microbiol.
45:97-102[Abstract/Free Full Text].
|
| 25.
|
Jones, D. H. A.,
P. T. Barth,
D. Byrom, and C. M. Thomas.
1992.
Nucleotide sequence of the structural gene encoding a 2-haloalkanoic acid dehalogenase of Pseudomonas putida strain AJ1 and purification of the encoded protein.
J. Gen. Microbiol.
138:675-683[Abstract/Free Full Text].
|
| 26.
|
Jutzi, K.,
A. M. Cook, and R. Hutter.
1982.
The degradative pathway of the s-triazine melamine.
Biochem. J.
208:679-684[Medline].
|
| 27.
|
Kaufman, D. D., and J. Blake.
1970.
Degradation of atrazine by soil fungi.
Soil Biol. Biochem.
2:73-80.
|
| 28.
|
Kawasaki, H.,
T. Toyama,
T. Maeda,
H. Nishino, and K. Tonomura.
1994.
Cloning and sequence analysis of a plasmid-encoded 2-haloacid dehalogenase gene from Pseudomonas putida no. 109.
Biosci. Biotechnol. Biochem.
58:160-163[Medline].
|
| 29.
|
Kawasaki, H.,
K. Tsuda,
I. Matsushita, and K. Tonomura.
1992.
Lack of homology between two haloacetate dehalogenase genes encoded on a plasmid from Moraxella sp. strain B.
J. Gen. Microbiol.
138:1317-1323[Abstract/Free Full Text].
|
| 30.
| Kello, D. 1989. WHO drinking water quality
guidelines for selected herbicides. Food Addit. Contam.
6(Suppl.):S79-S85.
|
| 31.
|
Kulakova, A. N.,
M. J. Larkin, and L. A. Kulakov.
1997.
The plasmid-located haloalkane dehalogenase gene from Rhodococcus rhodochrous NCIMB 13064.
Microbiology
143:109-115[Abstract/Free Full Text].
|
| 32.
|
LaRoche, S. D., and T. Leisinger.
1990.
Sequence analysis and expression of the bacterial dichloromethane dehalogenase structural gene, a member of the glutathione S-transferase supergene family.
J. Bacteriol.
172:164-171[Abstract/Free Full Text].
|
| 33.
|
Lohrke, S. M.,
J. H. Orf,
E. Martinez-Romero, and M. J. Sadowsky.
1995.
Host-controlled restriction of nodulation by Bradyrhizobium japonicum strains in serogroup 110.
Appl. Environ. Microbiol.
61:2378-2383[Abstract].
|
| 34.
|
Maltseva, O.,
C. McGowan,
R. Fulthorpe, and P. Oriel.
1996.
Degradation of 2,4-dichlorophenoxyacetic acid by haloalkaliphilic bacteria.
Microbiology
142:1115-1122[Abstract/Free Full Text].
|
| 35.
|
Mandelbaum, R. T.,
D. L. Allan, and L. P. Wackett.
1995.
Isolation and characterization of a Pseudomonas sp. that mineralizes the s-triazine herbicide atrazine.
Appl. Environ. Microbiol.
61:1451-1457[Abstract].
|
| 36.
|
Mandelbaum, R. T.,
L. P. Wackett, and D. L. Allan.
1993.
Rapid hydrolysis of atrazine to hydroxyatrazine by soil bacteria.
Environ. Sci. Technol.
27:1943-1946.
|
| 37.
|
Matheson, V. G.,
L. J. Forney,
Y. Suwa,
C. H. Nakatsu,
A. J. Sexsone, and W. E. Holben.
1996.
Evidence for acquisition in nature of a chromosomal 2,4-dichlorophenoxyacetic acid/ -ketoglutarate dioxygenase gene by different Burkholderia spp.
Appl. Environ. Microbiol.
62:2457-2463[Abstract].
|
| 38.
|
McGowan, C.,
R. Fulthorpe,
A. Wright,
J. Tiedje, and O. Maltseva.
1996.
.
Interspecies gene transfer in the evolution of 2,4-D degrading bacteria. GenBank accession number U43196
.
|
| 39.
|
Moscinski, J. K.,
K. Jayachandran, and T. B. Moorman.
1996.
Mineralization of the herbicide atrazine by Agrobacterium radiobacter, abstr. Q-414, p. 458.
Abstracts of the 96th General Meeting of the American Society for Microbiology 1996.
American Society for Microbiology, Washington, D.C.
|
| 40.
|
Mulbry, W. W.
1989.
Parathion hydrolase specified by the Flavobacterium opd gene: relationship between gene and protein.
J. Bacteriol.
171:6740-6746[Abstract/Free Full Text].
|
| 41.
|
Nagy, I.,
F. Compernolle,
K. Ghys,
J. Vanderleyden, and R. De Mot.
1995.
A single cytochrome P-450 system is involved in degradation of the herbicides EPTC (S-ethyl dipropylthiocarbamate) and atrazine by Rhodococcus sp. strain NI86/21.
Appl. Environ. Microbiol.
61:2056-2060[Abstract].
|
| 42.
|
Nardi-Dei, V.,
T. Kurihara,
T. Okamura,
J.-Q. Liu,
H. Koshikawa,
H. Ozaki,
Y. Terashima,
N. Esaki, and K. Soda.
1994.
Comparative studies of genes encoding thermostable L-2-halo acid dehalogenase from Pseudomonas sp. strain YL, other dehalogenases, and two related hypothetical proteins from Escherichia coli.
Appl. Environ. Microbiol.
60:3375-3380[Abstract/Free Full Text].
|
| 43.
|
Nardi-Dei, V.,
T. Kurihara,
C. Park,
N. Esaki, and K. Soda.
1997.
Bacterial DL-2-haloacid dehalogenase from Pseudomonas sp. strain 113: gene cloning and structural comparison with D- and L-2-haloacid dehalogenases.
J. Bacteriol.
179:4232-4238[Abstract/Free Full Text].
|
| 44.
|
Price, N. P. J.,
B. Relic,
E. Talmont,
A. Lewin,
D. Prome,
S. G. Pueppke,
F. Maillet,
J. Denarie,
J. C. Prome, and W. J. Broughton.
1992.
Broad-host-range Rhizobium species strain NGR234 secretes a family of carbamoylated, and fucosylated, nodulation signals that are O-acetylated or sulfated.
Mol. Microbiol.
6:3575-3584[Medline].
|
| 45.
|
Qi, B.
1991.
.
M.S. thesis.
University of Minnesota, St. Paul.
|
| 46.
|
Radosevich, M.,
S. J. Traina,
Y. Hao, and O. H. Tuovinen.
1995.
Degradation and mineralization of atrazine by a soil bacterial isolate.
Appl. Environ. Microbiol.
61:297-302[Abstract].
|
| 47.
|
Saber, D. L., and R. L. Crawford.
1985.
Isolation and characterization of Flavobacterium strains that degrade pentachlorophenol.
Appl. Environ. Microbiol.
50:1512-1518[Abstract/Free Full Text].
|
| 48.
|
Sadowsky, M. J.,
Z. Tong,
M. L. de Souza, and L. P. Wackett.
1998.
AtzC is a new member of the amidohydrolase protein superfamily and is homologous to other atrazine-metabolizing enzymes.
J. Bacteriol.
180:152-158[Abstract/Free Full Text].
|
| 49.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 50.
|
Schneider, B.,
R. Muller,
R. Frank, and F. Lingens.
1991.
Complete nucleotide sequences and comparison of the structural genes of two 2-haloalkanoic acid dehalogenases from Pseudomonas sp. strain CBS3.
J. Bacteriol.
173:1530-1535[Abstract/Free Full Text].
|
| 51.
|
Seiler, A.,
P. Brenneisen, and D. H. Green.
1992.
Benefits and risks of plant protection products possibilities of protecting drinking water: case atrazine.
Water Supply
10:31-42.
|
| 52.
|
Serdar, C. M.,
D. C. Murdock, and M. F. Rohde.
1989.
Parathion hydrolase gene from Pseudomonas diminuta MG: subcloning, complete nucleotide sequence, and expression of the mature portion of the enzyme in Escherichia coli.
Bio/Technology
7:1151-1155.
|
| 53.
|
Sethunathan, N., and T. Yoshida.
1973.
A Flavobacterium sp. that degrades diazinon and parathion.
Can. J. Microbiol.
19:873-875[Medline].
|
| 54.
|
Shao, Z. Q., and R. Behki.
1995.
Cloning of the genes for degradation of the herbicides EPTC (S-ethyl dipropylthiocarbamate) and atrazine from Rhodococcus sp. strain TE1.
Appl. Environ. Microbiol.
61:2061-2065[Abstract].
|
| 55.
|
Stamper, D. M.,
K. B. Hallberg,
M. Radosevich,
S. J. Traina, and O. H. Tuovinen.
1997.
Phylogenetic and biochemical characterization of an atrazine-mineralizing bacterial isolate, abstr. R-4, p. 525.
Abstracts of the 97th General Meeting of the American Society for Microbiology.
American Society for Microbiology, Washington, D.C.
|
| 56.
|
Streber, W. R.,
K. M. Timmis, and M. Z. Zenk.
1987.
Analysis, cloning, and high-level expression of 2,4-dichlorophenoxyacetate monooxygenase gene tfdA of Alcaligenes eutrophus JMP134.
J. Bacteriol.
169:2905-2955.
|
| 57.
|
Stucki, G.,
C. W. Yu,
T. Baumgartner, and J. F. Gonsalez-Valero.
1995.
Microbial atrazine mineralization under carbon limited and denitrifying conditions.
Water Res.
1:291-296.
|
| 58.
|
Suwa, Y.,
A. D. Wright,
F. Fukimori,
K. A. Nummy,
R. P. Hausinger,
W. E. Holben, and L. J. Forney.
1996.
Characterization of a chromosomally encoded 2,4-dichlorophenoxyacetic acid/ -ketoglutarate dioxygenase from Burkholderia sp. strain RASC.
Appl. Environ. Microbiol.
62:2464-2469[Abstract].
|
| 59.
|
van der Ploeg, J.,
G. van Hall, and D. B. Janssen.
1991.
Characterization of the haloacid dehalogenase from Xanthobacter autotrophicus GJ10 and sequencing of the dhlB gene.
J. Bacteriol.
173:7925-7933[Abstract/Free Full Text].
|
| 60.
|
Watson, B.,
T. C. Currier,
M. P. Gordon,
M. D. Chilton, and E. W. Nester.
1975.
Plasmid required for virulence of Agrobacterium tumefaciens.
J. Bacteriol.
123:255-264[Abstract/Free Full Text].
|
| 61.
|
Wolf, D. C., and J. P. Martin.
1975.
Microbial decomposition of ring-14C atrazine, cyanuric acid and 2-chloro-4,6-diamino-s-triazine.
J. Environ. Qual.
4:134-139.
[Abstract/Free Full Text] |
J Bacteriol, April 1998, p. 1951-1954, Vol. 180, No. 7
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Andeer, P. F., Stahl, D. A., Bruce, N. C., Strand, S. E.
(2009). Lateral Transfer of Genes for Hexahydro-1,3,5-Trinitro-1,3,5-Triazine (RDX) Degradation. Appl. Environ. Microbiol.
75: 3258-3262
[Abstract]
[Full Text]
-
Krutz, L. J., Shaner, D. L., Accinelli, C., Zablotowicz, R. M., Henry, W. B.
(2008). Atrazine Dissipation in s-Triazine-Adapted and Nonadapted Soil from Colorado and Mississippi: Implications of Enhanced Degradation on Atrazine Fate and Transport Parameters. J. Environ. Qual.
37: 848-857
[Abstract]
[Full Text]
-
Ghosh, D., Roy, K., Williamson, K. E., White, D. C., Wommack, K. E., Sublette, K. L., Radosevich, M.
(2008). Prevalence of Lysogeny among Soil Bacteria and Presence of 16S rRNA and trzN Genes in Viral-Community DNA. Appl. Environ. Microbiol.
74: 495-502
[Abstract]
[Full Text]
-
Seffernick, J. L., Aleem, A., Osborne, J. P., Johnson, G., Sadowsky, M. J., Wackett, L. P.
(2007). Hydroxyatrazine N-Ethylaminohydrolase (AtzB): an Amidohydrolase Superfamily Enzyme Catalyzing Deamination and Dechlorination. J. Bacteriol.
189: 6989-6997
[Abstract]
[Full Text]
-
Shapir, N., Mongodin, E. F., Sadowsky, M. J., Daugherty, S. C., Nelson, K. E., Wackett, L. P.
(2007). Evolution of Catabolic Pathways: Genomic Insights into Microbial s-Triazine Metabolism. J. Bacteriol.
189: 674-682
[Full Text]
-
Shapir, N., Rosendahl, C., Johnson, G., Andreina, M., Sadowsky, M. J., Wackett, L. P.
(2005). Substrate Specificity and Colorimetric Assay for Recombinant TrzN Derived from Arthrobacter aurescens TC1. Appl. Environ. Microbiol.
71: 2214-2220
[Abstract]
[Full Text]
-
Garcia-Gonzalez, V., Govantes, F., Porrua, O., Santero, E.
(2005). Regulation of the Pseudomonas sp. Strain ADP Cyanuric Acid Degradation Operon. J. Bacteriol.
187: 155-167
[Abstract]
[Full Text]
-
Sherley, M., Gordon, D. M., Collignon, P. J.
(2004). Evolution of multi-resistance plasmids in Australian clinical isolates of Escherichia coli. Microbiology
150: 1539-1546
[Abstract]
[Full Text]
-
Garcia-Gonzalez, V., Govantes, F., Shaw, L. J., Burns, R. G., Santero, E.
(2003). Nitrogen Control of Atrazine Utilization in Pseudomonas sp. Strain ADP. Appl. Environ. Microbiol.
69: 6987-6993
[Abstract]
[Full Text]
-
Parales, R. E., Bruce, N. C., Schmid, A., Wackett, L. P.
(2002). Biodegradation, Biotransformation, and Biocatalysis (B3). Appl. Environ. Microbiol.
68: 4699-4709
[Full Text]
-
Shapir, N., Osborne, J. P., Johnson, G., Sadowsky, M. J., Wackett, L. P.
(2002). Purification, Substrate Range, and Metal Center of AtzC: the N-Isopropylammelide Aminohydrolase Involved in Bacterial Atrazine Metabolism. J. Bacteriol.
184: 5376-5384
[Abstract]
[Full Text]
-
Sajjaphan, K., Shapir, N., Judd, A. K., Wackett, L. P., Sadowsky, M. J.
(2002). Novel psbA1 Gene from a Naturally Occurring Atrazine-Resistant Cyanobacterial Isolate. Appl. Environ. Microbiol.
68: 1358-1366
[Abstract]
[Full Text]
-
Martinez, B., Tomkins, J., Wackett, L. P., Wing, R., Sadowsky, M. J.
(2001). Complete Nucleotide Sequence and Organization of the Atrazine Catabolic Plasmid pADP-1 from Pseudomonas sp. Strain ADP. J. Bacteriol.
183: 5684-5697
[Abstract]
[Full Text]
-
Turnbull, G. A., Ousley, M., Walker, A., Shaw, E., Morgan, J. A. W.
(2001). Degradation of Substituted Phenylurea Herbicides by Arthrobacter globiformis Strain D47 and Characterization of a Plasmid-Associated Hydrolase Gene, puhA. Appl. Environ. Microbiol.
67: 2270-2275
[Abstract]
[Full Text]
-
Seffernick, J. L., de Souza, M. L., Sadowsky, M. J., Wackett, L. P.
(2001). Melamine Deaminase and Atrazine Chlorohydrolase: 98 Percent Identical but Functionally Different. J. Bacteriol.
183: 2405-2410
[Abstract]
[Full Text]
-
Vuilleumier, S., Ivos, N., Dean, M., Leisinger, T.
(2001). Sequence variation in dichloromethane dehalogenases/glutathione S-transferases. Microbiology
147: 611-619
[Abstract]
[Full Text]
-
Das, P. C., McElroy, W. K., Cooper, R. L.
(2001). Alteration of Catecholamines in Pheochromocytoma (PC12) Cells in Vitro by the Metabolites of Chlorotriazine Herbicide. Toxicol Sci
59: 127-137
[Abstract]
[Full Text]
-
Seffernick, J. L., Johnson, G., Sadowsky, M. J., Wackett, L. P.
(2000). Substrate Specificity of Atrazine Chlorohydrolase and Atrazine-Catabolizing Bacteria. Appl. Environ. Microbiol.
66: 4247-4252
[Abstract]
[Full Text]
-
Topp, E., Mulbry, W. M., Zhu, H., Nour, S. M., Cuppels, D.
(2000). Characterization of S-Triazine Herbicide Metabolism by a Nocardioides sp. Isolated from Agricultural Soils. Appl. Environ. Microbiol.
66: 3134-3141
[Abstract]
[Full Text]
-
Topp, E., Zhu, H., Nour, S. M., Houot, S., Lewis, M., Cuppels, D.
(2000). Characterization of an Atrazine-Degrading Pseudaminobacter sp. Isolated from Canadian and French Agricultural Soils. Appl. Environ. Microbiol.
66: 2773-2782
[Abstract]
[Full Text]
-
de Souza, M. L., Wackett, L. P., Sadowsky, M. J.
(1998). The atzABC Genes Encoding Atrazine Catabolism Are Located on a Self-Transmissible Plasmid in Pseudomonas sp. Strain ADP. Appl. Environ. Microbiol.
64: 2323-2326
[Abstract]
[Full Text]