Previous Article | Next Article ![]()
J Bacteriol, April 1998, p. 1959-1961, Vol. 180, No. 7
Department of Biochemistry and Microbiology,
University of Victoria, Victoria, British Columbia, Canada V8W 3P6
Received 24 September 1997/Accepted 25 January 1998
The Escherichia coli LytB protein regulates the
activity of guanosine 3',5'-bispyrophosphate synthetase I (RelA). A
Southern blot analysis of chromosomal DNA with the E. coli
lytB gene as a probe revealed the presence of lytB
homologs in all of the gram-negative bacterial species examined but not
in gram-positive species. The lytB homologs from
Enterobacter aerogenes and Pseudomonas
fluorescens complemented the E. coli lytB44 mutant
allele.
Amino acid deprivation of
Escherichia coli activates guanosine 3',5'-bispyrophosphate
(ppGpp) synthetase I (RelA), the ribosome-associated enzyme encoded by
the relA gene (see reference 5 for a
review). The resulting accumulation of ppGpp is believed to mediate the inhibition of a diverse array of metabolic processes comprising the
phenomenon known as the stringent response. The stringent response is
phenotypically suppressed by treatment of amino acid-deprived bacteria
with certain ribosome inhibitors, e.g., chloramphenicol, which inhibit
the activation of RelA. Phospholipid synthesis is one process which is
inhibited during the stringent response. Heath et al. (8)
have presented evidence indicating that this is due to the inhibitory
action of ppGpp on sn-glycerol-3-phosphate acyltransferase.
Cell wall peptidoglycan synthesis and lysis induced by treatment with
Mutations in the lytB gene of E. coli result in a
temperature-sensitive lysis-defective phenotype and
temperature-dependent penicillin tolerance (17). The
lytB mutants are as sensitive as their parent strain to the
lysis-inducing activities of
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Occurrence of Homologs of the Escherichia
coli lytB Gene in Gram-Negative Bacterial Species
and
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
-lactam antibiotics are also inhibited during the stringent
response, and this accounts for the well-known penicillin tolerance of
amino acid-deprived relA+ E. coli
(16). Peptidoglycan metabolism has been shown to be obligately coupled to phospholipid synthesis in both growing and amino
acid-deprived bacteria (6, 14-16). Therefore, the
inhibition of peptidoglycan synthesis and the induction of penicillin
tolerance during the stringent response are consequences of the
inhibition of phospholipid synthesis by ppGpp.
-lactam antibiotics at the permissive
temperature. On the other hand, although growth of the mutants is
inhibited by
-lactam antibiotics at the restrictive temperature, no
lysis occurs. The penicillin-tolerant phenotypes of the mutants at the
restrictive temperature are suppressed by inhibitors of RelA activation
such as chloramphenicol or by introduction of a mutation in the
relA gene (11). Furthermore, the lytB
mutants accumulate ppGpp at the restrictive temperature. Therefore, the
thermoinactivation of the mutant LytB protein apparently causes the
activation of RelA, and the resulting accumulation of ppGpp is
responsible for the observed penicillin tolerance. The function of LytB
is presently unknown, but it would appear that its direct or indirect
interaction with RelA is necessary to maintain RelA in an inactive form
during normal growth. The lytB gene has been identified as a
previously described open reading frame, originally designated
orf316 (4), occurring in the E. coli
ileS-lsp operon (7). The ileS-lsp operon
consists of (i) a gene, recently designated ribF, which
encodes riboflavin flavokinase (3); (ii) ileS
(isoleucyl tRNA synthetase); (iii) lsp (prolipoprotein signal peptidase); (iv) an open reading frame designated
orf149 which is proposed to encode a 17-kDa PFKB homolog;
and (v) lytB. There are no obvious functional relationships
among the identified gene products encoded by this operon. The in vivo
transcription and mRNA 5' end mapping experiments of Miller et al.
(13) suggest that the transcription of the
iles-lsp operon may be regulated in a complex fashion. The
operon may be expressed from three promoters, one preceding the
ribF gene, a second within ribF, and a third preceding orf149. Interestingly, the operon structure is
conserved in at least two other species, Enterobacter
aerogenes (10) and Pseudomonas fluorescens
(9). However, recent reports of lytB homologs
from other bacteria indicate that E. aerogenes and P. fluorescens are so far the only other examples of species in which there is a lytB association with the ileS-lsp
operon. Table 1 summarizes the sequenced
lytB homologs in the GenBank and TIGR (The Institute for
Genomic Research) databases. Note that the sequence of the E. aerogenes lytB homolog (cited in reference 10)
apparently has not been reported. The objectives of this study were to
screen genomic DNA from a collection of bacterial species for the
occurrence of lytB homologs and to determine whether the
lytB homologs from E. aerogenes and P. fluorescens could complement the E. coli lytB mutation.
TABLE 1.
Reported homologs of the E. coli lytB gene
A 1,050-bp fragment representing the entire E. coli lytB gene was amplified from plasmid pGM4 (12) by PCR. The sequences of the 5' and 3' primers used for this purpose were GATCCGGACTTGGAGGGAATTCATGCAATCCTGTTGGCC and AGGTAAACGCATGTTTTCTGCAAAAAATGCCGCTAACA, respectively. Both primers contained single point mutations introducing an EcoRI site at the 5' end and a PstI site at the 3' end. The resulting PCR product was cloned into plasmid pBDGAL-4 (Stratagene) cleaved with a combination of EcoRI and PstI to produce plasmid pXY10. The E. coli lytB probe used in Southern blot analyses was prepared from the 1,050-bp EcoRI-PstI fragment excised from pXY10. The probe was random prime labeled with digoxigenin-dUTP (Boehringer Mannheim).
All bacterial strains used in this study were from our laboratory collection. Minipreps of chromosomal DNA were prepared from bacteria by a method employing cetyltrimethylammonium bromide as described by Ausubel et al. (2). For Southern blot analysis, 3-µg samples of chromosomal DNA were digested with either EcoRI or EcoRV and separated by electrophoresis on 0.7% agarose gels. The DNA samples were depurinated, denatured, transferred to Hybond-N membranes (Amersham) with a Bio-Rad model 785 vacuum blotter, and then UV cross-linked to the membrane. Hybridization and detection of the probe were performed according to digoxigenin labeling kit protocols supplied by Boehringer Mannheim.
Figure 1 shows the results of an analysis of DNA samples from 14 gram-negative bacterial species. In Fig. 1A, high-stringency conditions (hybridization performed at 42°C followed by washes at 68°C) were used. The E. coli lytB probe hybridized equally well with EcoRI-generated DNA fragments of identical size (15 kbp) from E. coli and Shigella sonnei (Fig. 1A, lanes a and b, respectively). Slightly weaker hybridization occurred with Klebsiella pneumoniae, Salmonella typhimurium, Citrobacter freundii, and Morganella morganii (Fig. 1A, lanes c through f). These results indicate that lytB is highly conserved among these species. Discrete but weak hybridization signals were observed with DNA samples from (lane letters for Fig. 1 follow in parentheses): Proteus mirabilis (g), Serratia marcescens (h), Alkaligenes faecalis (j), Aeromonas hydrophila (m), and Chromobacterium violaceum (n). Even weaker hybridization signals occurred with Providentia rettgeri (i), Acinetobacter calcoaceticus (k), and Pseudomonas putida (l), although these results are not obvious in Fig. 1A. However, Fig. 1B shows discrete bands of 4.1, 9.4, and 8.4 kbp for P. rettgeri (i), A. calcoaceticus (k), and P. putida (l), respectively, when the stringency conditions were reduced (hybridization and washes performed at 30°C). The E. coli lytB probe was also used to locate a homolog on a 525.25-kbp CeuI fragment from the physical map of the Aeromonas salmonicida genome (18). Therefore, homologs of lytB were detected in all gram-negative bacterial species tested. On the other hand, DNA from the gram-positive bacteria Lactobacillus acidophilus, Staphylococcus aureus, Micrococcus luteus, Streptococcus lactis, and Bacillus anthracis yielded negative results under low-stringency conditions (hybridization and washes performed at 30°C). Our negative result with B. anthracis genomic DNA is notable because B. anthracis is so far the only gram-positive bacterium reported to possess a lytB homolog (1) (Table 1). This report is based on an incomplete sequence of a putative open reading frame (370 bp), and our result suggests that this open reading frame probably does not represent a lytB homolog. Sequences related to lytB were not detected in the recently completed genome sequences of Saccharomyces cerevisiae, Mycoplasma genitalium, Archaeoglobus fulgidus, and Bacillus subtilis.
|
Plasmids pBK1 (10) and pBROC128 (9) carry the
cloned lytB homologs of E. aerogenes and P. fluorescens, respectively. These plasmids were transformed into
strain WV7 [lytB44
(srl-recA)306::Tn10] to
determine whether the lytB homologs could complement the
E. coli lytB mutation. For comparison, plasmid pGM21, which
carries the E. coli ileS-lsp operon (12), was
transformed into strain WV7. Complementation was assessed by
determining the plating efficiencies of the bacteria as follows.
Dilutions of stationary-phase cultures grown in Luria broth (Difco
Laboratories) were plated onto nutrient agar (Difco Laboratories)
plates. For each strain, one set of dilutions was incubated at 30°C
and a second set was incubated at 42°C. Colonies were counted after
48 h of incubation, and plating efficiencies (numbers of colonies
at 42°C/number of colonies at 30°C) were calculated. The plating
efficiency for strain WV7 was 6.7 × 10
7. When
plasmid pGM21 was introduced into WV7, the plating efficiency was 0.28, indicating that pGM21 complemented lytB44. Plasmids pBK1 and
pBROC128 also complemented lytB44, giving rise to plating efficiencies of 0.32 and 0.78, respectively. Complementation of lytB44 was also characterized in M9 minimal medium. Figure
2 compares the growth of strain WV7 with
that of derivatives of WV7 carrying plasmids pBK1, pBROC128, and pGM21.
There were no significant differences in the growth rates of the four
strains at 30°C (Fig. 2A). In contrast, the growth of WV7 ceased
after about one doubling at 42°C (Fig. 2B). All three plasmids
carrying the lytB homologs complemented growth of WV7 at
42°C. Plasmids pGM21 and pBK1 were equally effective in this regard,
but they did not support maximum growth of WV7, whereas pBROC128 did.
We are not sure why the P. fluorescens homolog was more
effective than the E. coli lytB gene. This may be related to
the fact that the multicopy expression of the E. coli lytB
gene is growth inhibitory (19), and the E. aerogenes
lytB homolog may have the same effect, in light of its high degree
of sequence similarity to the E. coli gene. Furthermore, pBROC128 does not contain the entire P. fluorescens lytB
gene (9), and it is possible that the deletion of the
C-terminal end of LytB relieves the toxicity associated with multicopy
expression. On the other hand, it is not clear why the two toxic
homologs had no obvious inhibitory effects at 30°C. This matter is
currently under investigation. In summary, these results indicate that
the heterologous lytB homologs were functional in E. coli.
|
| |
ACKNOWLEDGMENTS |
|---|
This study was supported by a grant from the Natural Sciences and Engineering Council of Canada to E.E.I.
We thank G. Mackie for plasmid pGM21. We are grateful to the late H. C. Wu for plasmids pBK1 and pBROC128.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry and Microbiology, University of Victoria, P.O. Box 3055, Victoria, British Columbia, Canada V8W 3P6. Phone: (250) 721-7071. Fax: (250) 721-8855. E-mail: EISHUV{at}UVVM.UVIC.CA.
Present address: Department of Biochemistry and Molecular Biology,
University of British Columbia, Vancouver, British Columbia, Canada V6T
1W5.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Anderson, G. L.,
J. M. Simchock, and K. H. Wilson.
1996.
Identification of a region of genetic variability among Bacillus anthracis strains and related species.
J. Bacteriol.
178:377-384 |
| 2. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1989. . Current protocols in molecular biology. Wiley Interscience, New York, N.Y. |
| 3. | Berlyn, M. K. B., K. B. Low, and K. E. Rudd. 1996. Linkage map of Escherichia coli K-12, edition 9, p. 1715-1902. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium. Cellular and molecular biology. ASM Press, Washington, D.C. |
| 4. |
Bouvier, J., and P. Stragier.
1990.
Nucleotide sequence of the lsp-dapB interval in Escherichia coli.
Nucleic Acids Res.
19:180 |
| 5. | Cashel, M., D. R. Gentry, V. J. Hernandez, and K. E. Rudd. 1996. The stringent response, p. 1458-1496. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium. Cellular and molecular biology. ASM Press, Washington, D.C. |
| 6. |
Ehlert, K., and J.-V. Höltje.
1996.
Role of precursor translocation in coordination of murein and phospholipid synthesis in Escherichia coli.
J. Bacteriol.
178:6766-6771 |
| 7. |
Gustafson, C. E.,
S. Kaul, and E. E. Ishiguro.
1993.
Identification of the Escherichia coli lytB gene, which is involved in penicillin tolerance and control of the stringent response.
J. Bacteriol.
175:1203-1205 |
| 8. |
Heath, R. J.,
S. Jackowski, and C. O. Rock.
1994.
Guanosine tetraphosphate inhibition of fatty acid and phospholipid synthesis in Escherichia coli is relieved by overexpression of glycerol-3-phosphate acyltransferase (plsB).
J. Biol. Chem.
269:26584-26590 |
| 9. |
Isaki, L.,
R. Beers, and H. C. Wu.
1990.
Nucleotide sequence of the Pseudomonas fluorescens signal peptidase II gene (lsp) and flanking genes.
J. Bacteriol.
172:6512-6517 |
| 10. |
Isaki, L.,
M. Kawakami,
R. Beers,
R. Hom, and H. C. Wu.
1990.
Cloning and nucleotide sequence of the Enterobacter aerogenes signal peptidase II (lsp) gene.
J. Bacteriol.
172:469-472 |
| 11. |
Kusser, W., and E. E. Ishiguro.
1987.
Suppression of mutations conferring penicillin tolerance by interference with the stringent control mechanism of Escherichia coli.
J. Bacteriol.
169:4396-4398 |
| 12. |
Mackie, G. A., and G. D. Parsons.
1982.
Identification of gene products from cloned fragments of the left arm of dapB2.
Can. J. Biochem.
60:338-346[Medline].
|
| 13. |
Miller, K. W.,
J. Bouvier,
P. Stragier, and H. C. Wu.
1987.
Identification of the genes in the Escherichia coli ileS-lsp operon. Analysis of multiple polycistronic mRNAs made in vivo.
J. Biol. Chem.
262:389-393 |
| 14. |
Rodionov, D. G., and E. E. Ishiguro.
1995.
Direct correlation between overproduction of guanosine 3',5'-bispyrophosphate (ppGpp) and penicillin tolerance in Escherichia coli.
J. Bacteriol.
177:4224-4229 |
| 15. |
Rodionov, D. G., and E. E. Ishiguro.
1996.
Dependence of peptidoglycan metabolism on phospholipid synthesis during growth of Escherichia coli.
Microbiology
142:2871-2877 |
| 16. |
Rodionov, D. G.,
A. G. Pisabarro,
M. A. De Pedro,
W. Kusser, and E. E. Ishiguro.
1995.
-Lactam-induced bacteriolysis of amino acid-deprived Escherichia coli is dependent on phospholipid synthesis.
J. Bacteriol.
177:992-997 |
| 17. |
Shimmin, L. C.,
D. Vanderwel,
R. E. Harkness,
B. R. Currie,
A. Galloway, and E. E. Ishiguro.
1986.
Temperature-sensitive -lactam-tolerant mutants of Escherichia coli.
J. Gen. Microbiol.
130:1315-1323.
|
| 18. | Umelo, E. R. O. 1997. . The physical and genetic map of the A. salmonicida A449 chromosome: molecular characterization of recA and a novel fla operon. Ph.D. dissertation. University of Victoria, Victoria, Canada. |
| 19. | Yang, X., and E. E. Ishiguro. Unpublished data. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»