Previous Article | Next Article 
J Bacteriol, April 1998, p. 2063-2071, Vol. 180, No. 8
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Use of Bacteriophage
Recombination Functions To
Promote Gene Replacement in Escherichia coli
Kenan C.
Murphy*
Department of Molecular Genetics and
Microbiology, University of Massachusetts Medical School, Worcester,
Massachusetts 01655
Received 1 October 1997/Accepted 6 February 1998
 |
ABSTRACT |
Replacement of Escherichia coli's RecBCD function with
phage
's Red function generates a strain whose chromosome
recombines with short linear DNA fragments at a greatly elevated rate.
The rate is at least 70-fold higher than that exhibited by a
recBC sbcBC or recD strain. The value of the
system is highlighted by gene replacement with a PCR-generated DNA
fragment. The
recBCD::Plac-red kan
replacement allele can be P1 transduced to other E. coli
strains, making the hyper-Rec phenotype easily transferable.
 |
INTRODUCTION |
Gene replacement in bacteria can be
achieved by a variety of techniques. One of the easiest procedures for
gene manipulation in Escherichia coli is to place a drug
resistance marker near, within, or in place of a cloned gene of
interest. Linear DNA, containing the mutated or deleted gene flanked by
homologous regions of the chromosome, is then transformed or
electroporated into recombination-proficient strains (i.e., recBC
sbcBC or recD). Recombination between the bacterial
chromosome and both ends of the linear DNA fragment results in gene
replacement (13, 19, 34, 46). The recombinants can be easily
selected by the presence of the drug resistance marker. Unfortunately,
this replacement procedure is restricted to specific RecBCD
nuclease-deficient recombination-proficient genetic backgrounds and
thus is not universally applicable. Furthermore, the number of
mutations generated is limited by the availability of antibiotic
resistance markers.
Another general method involves integration of a plasmid containing
selectable markers and the mutant gene of interest into the bacterial
chromosome by homologous recombination, followed by resolution of the
cointegrate, which, depending on the mechanism of resolution, generates
either the wild-type locus or gene replacement. Since plasmid sequences
are removed during resolution of the cointegrate, gene replacements can
be made free from antibiotic resistance markers. Phenotypic screens
and/or Southern analyses are then used to identify the replaced allele.
The key to this procedure involves the use of vectors that cannot
replicate under conditions used for selection of the cointegrate.
Examples of such vectors for E. coli include ColE1-derived
plasmids, which do not replicate in polA mutants (10,
36), a temperature-sensitive pSC101 replicon (11), and
a phagemid-based vector (38). Thermosensitive,
pir-dependent, and repA-dependent
broad-host-range plasmids for use in gram-positive bacteria have
been described (3, 16, 22).
While the cointegration scheme, and versions of it, has been
successfully used in a variety of hosts, it has some drawbacks. The
replacement allele is actually a composite gene generated by the
cointegrate resolution event. Thus, a particular mutation may not be
transferred as expected. Also, resolution of the cointegrate occurs at
low frequency and may not always give the replacement desired. Lastly,
cloning of the gene prior to replacement is required.
This report identifies a new scheme that can generate gene replacement
in nearly any E. coli strain at high frequency, does not
depend on a cointegrate, and does not require prior cloning of the
gene. Bacteriophage
recombination functions exo,
bet, and gam are expressed from a multicopy
plasmid and used to promote gene replacement in a wild-type E. coli host following transformation with linear DNA substrates.
recombination functions promote gene replacement within the
lacZ gene at a rate 15 to 130 times higher than recBC
sbcBC or recD strains. Since homologous recombination is elevated by the addition of functions to the host, rather than induced by alteration of host functions, this procedure is widely applicable to any E. coli and possibly other bacteria as
well. Furthermore, an E. coli strain has been constructed in
which the recBCD genes of E. coli have been
replaced with a Plac-bet exo operon, together
with a kanamycin resistance determinant. Thus, any strain can be made
hyper-Rec by P1 transduction. Compared to plasmid-encoded
Red,
chromosome-encoded
Red promotes even higher rates of recombination.
Finally, by using the
Red recombination system, the wild-type
lacZ allele was replaced with a PCR-generated lacZ fragment containing an insertion of the tetracycline
resistance gene. Thus, cloning of the gene of interest before
replacement is not necessarily required.
 |
MATERIALS AND METHODS |
Chemicals and procedures.
Luria-Bertani (LB) medium has been
described elsewhere (37). DNA buffer (DB) is 10 mM Tris-HCl
(pH 7.5), 5 mM NaCl, and 1 mM EDTA. Precipitation buffer (PB) is 20 mM
Tris-HCl (pH 7.4), 10 mM NaCl, 2 mM EDTA, and 0.5 M ammonium acetate.
Isopropyl-
-D-thiogalactopyranoside (IPTG) and
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal) were purchased from Sigma. DNA transformations, P1 transductions, UV
sensitivity assays, and conjugational recombination measurements were
performed essentially as described earlier (21, 25, 27). DNA
fragments were isolated by electrophoresis on bisacrylylcystamine polyacrylamide gels and purified as described by Hansen (12) except that DNA bands were visualized by staining the gels in 0.025%
methylene blue, and phenol was equilibrated with 10 mM Tris-HCl to pH
7.0. Following elution of DNA fragments from DEAE-cellulose minicolumns, tRNA (30 µg) was added as carrier. The samples were precipitated with 2 volumes of ethanol, frozen at
80°C for 30 min,
collected by centrifugation, and resuspended in 350 µl of PB. The DNA
fragments were extracted with phenol, extracted with ether,
precipitated with ethanol, and resuspended in DB. The concentrations of
DNA fragments were obtained by running portions of the purified samples
on 0.7% agarose gels and comparing them with known amounts of digested
plasmids.
Plasmids and bacteria.
The
Red-Gam-producing plasmid
pTP223 (28), control plasmid pMC7 (20), and
recBCD-containing plasmids pCDK3 and pKM587 (8,
25) have been previously described. Plasmid pJM22 (from M. Susskind) has an 1,100-bp kanamycin resistance determinant from
Tn903 cloned into the filled-in EcoRI site of
pUR2 (35), with XbaI linkers inserted at the
junctions. Plasmids generated in this study were constructed according
to standard techniques (37) and are described in Table
1.
E. coli strains used and constructed for this study
are listed in Table
2. KM19 was
constructed as follows. pKM125 was cut
with
BamHI and
NdeI, and the 5-kb linear fragment containing the
kanamycin
resistance gene fragment, flanked by sequences upstream
of
recC and downstream of
recD, was isolated by
electrophoresis
on a 5% bisacrylylcystamine polyacrylamide gel
(
12). Following
purification, the linear fragment was
transformed into JC9387
(
recBC sbcBC), and
kanamycin-resistant transformants were selected.
KM20 was
constructed in a similar manner except that a 7-kb linear
DNA fragment, derived from a
BamHI and
NdeI digest of pKM126,
was used. This fragment contains
both the kanamycin resistance
gene and the
P
lac-red operon flanked by sequences
upstream
and downstream of the
recBCD region. KM21 was
derived by P1 transduction
of AB1157 with a lysate grown
from KM19 and selection for kanamycin-resistant
transductants. The
recBCD-deficient phenotype of this
strain was
verified by its ability to support the growth of both
red gam
+ and


phage and a deficiency of conjugational
recombination. KM22,
KM26, and KM29 were derived by P1
transductions of AB1157 (wild
type), JC9239 (
recF), and
KM354 (
recJ), respectively, with a lysate
grown from KM20
and selection for kanamycin-resistant transductants.
The genotype
of KM22 was verified by its ability to promote growth
of
both
red gam
+ and


phage and its proficiency at conjugational recombination
(20%
of wild-type levels). (Conjugation recombination in a
recBC host
carrying a
red-expressing
plasmid had previously been shown
to reach 10% of wild-type levels
[
32].) The
recBCD recF genotype
of KM26 and
the
recBCD recJ genotype of KM29 was verified by their
extreme UV sensitivities in the absence of IPTG (data not shown).
Preparation of electrocompetent cells.
Cultures (20 ml) were
started by placing an isolated colony from a selective medium into LB
broth, containing tetracycline (15 µg/ml) for hosts carrying pTP223
or kanamycin (25 µg/ml) for cells carrying the
recBCD::Plac-red exo
replacement allele. Plasmid-containing cells were grown on a shaker at
37°C for various times before IPTG was added to a final concentration of 1 mM. With cells containing the
recBCD::Plac-red substitution, IPTG was added to the culture at the time of inoculation. When the culture reached a density of 108 cells/ml, the
cells were collected by centrifugation, resuspended in an equal volume
of 20% glycerol, and recentrifuged at 5,000 × g for
15 min. This step was repeated. The cells were then resuspended in 10 ml of 20% glycerol, collected by centrifugation, and resuspended in
100 µl of 20% glycerol. Cells were either used immediately or frozen
in 50-µl aliquots in a dry ice-ethanol bath and stored at
80°C.
Cells stored in this way were usable weeks after freezing. Scaled-up
versions of this protocol were used to store large numbers of
electrocompetent cells.
Electroporation.
Electrocompetent cells were thawed quickly
at room temperature and placed on ice. Disposable 0.1-cm
electroporation cuvettes (Bio-Rad) were placed in an ice-water bath for
10 min prior to electroporation. DNA samples in DB (5 to 10 µl) were
mixed with 50 µl of electrocompetent cells. The mixture was pipetted
into the precooled cuvettes (which were dried thoroughly) and
electroporated with an in-house instrument (constructed by J. Goguen),
consisting of a simple design similar to commercial capacitor-discharge
units but using a vacuum relay with tungsten carbide contacts to switch between charge and discharge modes. The peak discharge field used was
20 kV/cm with an RC time constant of 4.2 ms. A 200-ohm resistor was
used in series with the cuvette to limit discharge current should
arcing occur.
Measurement of recombination frequency.
Immediately
following electroporation, 350 µl of LB was added to the cuvette and
quickly mixed with the cells by repeated pipetting. The cell suspension
was diluted 10-fold in LB and grown by rolling at 37°C for 30 to 45 min. Recombinant titers were determined by plating various dilutions of
the cultures on LB plates containing either kanamycin (20 µg/ml) or
tetracycline (2.5 µg/ml) (depending on the fragment used), previously
spread with 0.2 ml IPTG (0.1 M) and 0.2 ml X-Gal (20 mg/ml in dimethyl
formamide). Surviving titers were determined on LB plates containing
IPTG; in some experiments, X-Gal was included as well. It was found
that having IPTG on the recombinant and surviving titer plates
decreased colony counts in some experiments (when plasmid-produced Gam
was expressed in recF and recJ mutants) or
increased colony counts in others (in strains containing the
recBCD::Plac-red
substitution). However, for any one strain, the percent recombination
per survivor with or without IPTG on the plates did not vary more than
twofold in side-by-side comparisons. Plates were incubated at 37°C
for 24 to 36 h, and the fraction of kanamycin (or
tetracycline)-resistant Lac
(white) transformants
relative to the total number of survivors was calculated. In control
samples containing buffer plus electroporated cells (no DNA), no
recombinants were detected.
Exonuclease-deficient recombination-proficient
recBC sbcBC
strains, and to a lesser extent
recD strains, do not stably
maintain
ColE1-related plasmids (
1,
2,
33), largely due to
the
formation of linear plasmid multimers in these strains. As a
result,
circular plasmid transformation rates (transformants/viable
cell)
are decreased in these strains (with pBR322, decreased 2-fold
in
recD and 10-fold in
recBC sbcBC strains
[unpublished observations]).
This decrease in circular plasmid
transformation rates is also
observed with cells containing the
recBCD::P
lac-red allele
(decreased 10-fold, with or without IPTG [data not shown])
but not
when Red and Gam are supplied from pTP223 (probably as
a result of the
presence of plasmid-encoded LacI, which keeps
expression of
red and
gam under tight control in the absence of
IPTG following transformation). Thus, with JC9387, KM353, and
KM22,
circular plasmid transformation rates reflect both DNA uptake
and
circular plasmid stability and cannot be used to normalize
linear DNA
uptake. As a result, in the electroporation experiments
described
above, percent recombination is reported as the number
of linear DNA
transformants per survivor. Consequently, gene replacement
frequencies
per survivor reported here may be underestimated relative
to
replacements per competent cell, if after electroporation fewer
than
100% of the survivors take up DNA.
In the experiment following linear transformation into calcium-treated
competent cells, recombinant frequencies are reported
as transformants
per competent cell (comparisons to
recBC sbcBC and
recD strains were not included in this experiment). Also,
X-Gal and IPTG were not included in plates used to determine the
number
of kanamycin-resistant colonies. In this case, the percentage
of
lacZ colonies was determined by stabbing 25 to 30 kanamycin-resistant
colonies into a plate containing X-Gal and IPTG. In
all instances,
100% of tested colonies were white, while the
nontransformed parents
were blue.
PCRs.
PCR was used to verify strain construction and
recombinant formation. Primers (24-mers) used to verify kan
or tet insertion into lacZ were as follows: from
the lacZ sequence, GTAACCTATCCCATTACGGTCAAT and
CGGTTAAATTGCCAACGCTTATTA. Primers used to verify the
recBCD::Plac-red replacement allele were as follows: for the left end,
TTTGTTTGCGTTTACTGGCAGATA, TCGTTGACCCACTGGCGTAAATAA,
and ACGGCAACGGCCTTGAACTGAAAT (primers 7 to 9, respectively); for the right end, TCGCATCCGGCAATTACGTTTATT, CATCGCATTGCTGATTACGACTAT, and
ATCAGGATTATCAATACCATATTT (primers 10 to 12, respectively)
(see Fig. 4 for relative positions of these primers). Primers 7 and 10 were used to verify the
recBCD::kan substitution in KM19 and KM21. In PCR analysis of JC9387 (recBC sbcBC), the presumed missense mutations in recB and
recC did not alter the size of PCR product expected.
PCR mixtures consisted of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.9 mM
MgCl
2, 1 µM primers, 50 µM deoxynucleoside
triphosphates
(dNTPs), 5% dimethyl sulfoxide, and 2.5 U of AmpliTaq
DNA polymerase
(Perkin-Elmer) in a volume of 40 µl. After all
components (except
the polymerase) were added together, a sterile
pipette tip was
used to pick a colony off an agar plate and thoroughly
mix the
cells with the PCR reagents. AmpliTaq DNA polymerase was added
and mixed; the samples were overlaid with an equal volume of mineral
oil (Sigma) and placed in a thermocycler (MJ Research). All programs
consisted of an initial step at 95°C for 5 min, followed by 30
cycles
of 1 min at 94°C, 1 min at 55°C, and 5 min at 72°C. A final
extension step of 7 min at 72°C was included. Samples (10 µl)
of
the PCR mixtures were run on 0.7% agarose along with a set
of
standards (1-kb DNA ladder; Gibco-BRL) and stained with ethidium
bromide.
 |
RESULTS |
Red-Gam-promoted gene replacement.
The bacteriophage
recombination system, known as red, consists of two genes,
exo and bet. Exo is a 5'-3' exonuclease that acts
processively on double-stranded (ds) DNA (6, 17). Bet is a
single-stranded DNA (ssDNA) binding protein capable of annealing complementary ssDNA strands (15, 23). Bet can stimulate the formation of joint molecules and strand exchange by RecA but cannot promote strand invasion on its own (24).
Red-mediated
recombination is stimulated by the presence of dsDNA ends, generated by
cutting of cos by
terminase prior to packaging or by a
restriction endonuclease (29, 41, 44). RecA is not required
for Red-promoted recombination unless phage replication is inhibited
(43). The Red recombination functions are assisted by the
Gam function, which inhibits host RecBCD exonuclease (14,
25). While RecBCD is one of the key enzymes in E. coli's major recombination system, its activation is dependent on
the presence of Chi sites (5'GCTGGTGG3'), which are absent
in wild-type lambda DNA (39). Thus, Gam's role is to
prevent RecBCD-promoted digestion of
phage DNA, so that Exo and Bet
can gain access to DNA ends to promote recombination.
This study was done to examine if expression of

Red plus Gam, in
the absence of other phage functions, might promote gene
replacement in
E. coli following transformation with linear substrates.
A
linear DNA substrate was prepared from pKM131, which contains
most of
the
lacZ sequence, interrupted at an internal
BclI site
by a gene encoding kanamycin resistance (Fig.
1). After digestion
of pKM131 with
BglI, the 3.2-kb linear
lacZ::
kan fragment was
isolated and
purified as described in Materials and Methods. The
fragment, which
contains the kanamycin resistance determinant
flanked by 921 and 1,200 bp of
lacZ sequence, was electroporated
into various
E. coli hosts containing pTP223, a plasmid that expresses
gam,
bet, and
exo under control of
P
lac (
28). Recombinants
were
identified as white kanamycin-resistant colonies on plates
containing
X-Gal and IPTG and compared to the total number of
survivors.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 1.
Linear DNA transformation substrate. Plasmid pKM131
contains the 2,557-bp PvuII lacZ fragment
inserted into the PvuII site of pBR322, with a 1,100-bp
kanamycin resistance-conferring fragment inserted into the
BclI site within lacZ. When cut with
BglI, pKM131 generates a fragment containing the
kan gene, flanked by 921 and 1,200 bp of lacZ
sequence. A similar plasmid, pKM133 (not shown), contains the
tetracycline resistance determinant from pBR322, flanked by 1,256 and
1,301 bp of lacZ sequence.
|
|
Table
3 shows the results of two of these
experiments. In experiment A, the purified linear
lacZ::
kan substrate (described
above)
was mixed with electrocompetent cells at a concentration
of 3 µg/ml
and electroporated as described in Materials and Methods.
Wild-type
cells (AB1157) containing a control plasmid (pMC7) produced
no
recombinants. When
gam,
bet, and
exo
were expressed in vivo
in a wild-type host, recombinants were generated
at a frequency
of 3.6 × 10
5 per survivor, an
increase of at least 3 orders of magnitude over
cells containing the
control plasmid. In a
recJ mutant background,
the frequency
of recombination was further increased twofold.
In other experiments
(see below),

Red-promoted recombination
was stimulated 2- to
25-fold by deletion of
recJ. The lack of
dependence on RecJ
(a 5'-3' ssDNA exonuclease) is not surprising
in light of the enzymatic
activity of

Exo (a 5'-3' dsDNA exonuclease).
The stimulation of

Red-promoted recombination by a mutation
in
recJ suggests
that the RecJ exonuclease interferes with the
formation or stability of
an intermediate generated by the action
of

Red. Interestingly, two
strains known for their ability to
transform linear DNA substrates
(
recBCD sbcBC and
recD) did so
with the
lacZ::
kan fragment, but at 138- and
620-fold lower frequencies,
respectively, than

Red-Gam-producing
strains (Table
3, experiment
A). Thus, at least with these substrates,
cells expressing

Red
and Gam are more proficient than
recBC
sbcBC or
recD strains in
promoting recombination of
linear DNA with the
E. coli chromosome.
In another experiment, cells containing the Red-Gam-producing plasmid
pTP223 were electroporated with linear DNA at a final
concentration of
15 µg/ml (Table
3, experiment B). Compared to
the
recBC
sbcBC host, the

Red-Gam-producing strain showed only
a 15-fold
increase in transformation with the linear substrate.

Red-promoted
recombinant formation was decreased 68-fold by
a
recA
mutation and 4-fold by a
recF mutation but increased 12-fold
by a
recJ mutation.
In addition to electroporation, simple addition of linear DNA to
calcium-treated competent cells containing the

Red-Gam-expressing
plasmid was also examined. Table
4 shows
the results from one
such experiment. The linear
lacZ::
kan fragment or an equimolar
amount of its parent circular plasmid was added to wild-type cells
containing pTP223 or a control plasmid. In the absence of

Red
and
Gam, no linear DNA transformants were obtained.

Red and
Gam
expression, in either AB1157 or W3110 wild-type strains, resulted
in a
linear transformation rate per competent cell of 0.013 or
0.056%,
respectively. As seen with electroporation experiments
described above,
calcium-mediated linear DNA transformation was
stimulated by a mutation
in
recJ (25-fold in this experiment).
For each
transformation, between 25 and 30 kanamycin-resistant
colonies were
tested for activity of
lacZ (which is functional
in the
recipient strains). All tested candidates were
lacZ mutants,
indicating replacement of the endogenous
lacZ gene with the
fragment-borne
allele. Thus, while similar patterns of linear DNA
transformations
are seen in

Red-Gam-producing hosts following
calcium-mediated
transformation, higher total numbers of transformants
are obtainable
following electroporation of the linear substrates
(presumably
because of the higher numbers of cells capable of DNA
uptake during
electroporation).
In other experiments, pTP232, a plasmid that expresses only

Red (no
Gam), did not promote linear DNA transformation of the
lacZ::
kan substrate following
electroporation into wild-type cells
(data not shown). Thus,
inactivation of RecBCD nuclease by

Gam
(or by mutation) is required
to observe

Red-promoted recombination,
as has been observed
previously (
29,
42). The P22 recombination
system consisting
of
arf,
erf,
abc1, and
abc2, which can substitute
for growth and recombination of
red gam phage (
28,
29),
was also tested for
its ability to promote linear DNA transformation.
The P22 system,
supplied by pTP178 (
9), produced only 5 to
10% of the
recombinants per survivor (or competent cell) exhibited
by

Red
(data not shown). While the reason for this lower rate
of linear DNA
transformation by the P22 recombination system is
not clear, it may in
part have to do with the role of Abc2, a
protein which modifies the
host's RecBCD enzyme. A suggested role
of Abc2 is to harness the
exonuclease activity of RecBCD to promote
Chi-independent recombination
during a P22 infection (references
26,
27, and
31 and unpublished data). As such, Abc-modified
RecBCD becomes part of P22's recombination system. Overproduction
of
RecBCD, together with all the components of P22's recombination
system, may be required to attain the levels of linear DNA
transformation
observed with

Red and Gam.
Recombinant formation is IPTG dependent.
Red-Gam-producing
cells were grown for various amounts of time in the presence of IPTG,
made competent, and transformed with equimolar amounts of linear
lacZ::kan fragment and its parent supercoiled plasmid. As shown in Fig. 2,
in the absence of IPTG, no recombinants were found. Longer exposure to
IPTG resulted in greater amounts of recombinants per competent cell.
The highest rate of linear DNA transformation was achieved with a
45-min IPTG induction period, the highest-exposure period tested. Thus,
even higher rates of linear DNA transformation may be achievable with longer periods of IPTG induction. Thus, the hyper-Rec phenotype of
cells containing the
Red-Gam-producing plasmid is easily controlled
with IPTG.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
Linear transformation promoted by Red is IPTG
dependent. Wild-type cells (W3110) containing Red-Gam-producing
plasmid (pTP223) were incubated for various times in the presence of 1 mM IPTG prior to collection of the cells by centrifugation. Cells were
made competent and transformed with equimolar amounts of
lacZ::kan fragment (0.12 µg) and
parent plasmid pKM131 (0.3 µg). Ratios of transformation titers
(fragment/plasmid) were plotted as a function of time of exposure to
IPTG.
|
|
Characterization of the recombinants.
If a double
crossover occurred between the
lacZ::kan linear DNA substrate and the
E. coli chromosome, the recombinant would contain a 1.1-kb
insertion of the kan-containing fragment into the
chromosomal lacZ locus. The PCR products from the
lacZ region in three of the white kanamycin-resistant
transformants described in Table 3 were compared to the PCR product of
their kanamycin-sensitive blue parent. Figure
3 (lane 2) shows that the PCR product
from AB1157 containing pTP223 produces a band of approximately 2 kb (as
expected from the predicted PCR product of 1,972 bp), while all
three white recombinants produced a 3.1-kb band (lanes 3 to 5)
indicative of replacement of the chromosomal lacZ gene by
the kan insertion allele. In another analysis, 10 of 10 white kanamycin-resistant transformants all produced the recombinant
3.1-kb band after PCR analysis (data not shown). In addition,
sam-ples of recombinants produced with recA and
recJ strains containing pTP223 also showed the 3.1-kb
recombinant band after PCR analysis (data not shown). While these
analyses do not rule out other types of chromosomal insertions
into (or deletions of) lacZ, the majority of recombinant products involve simple replacements, likely generated by a
double-crossover event.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 3.
PCR analysis of
lacZ::kan recombinants. PCRs were
performed as described in Materials and Methods. Lanes: 1 and 7, 1-kb
DNA ladder standards (Gibco-BRL); 2, PCR product from AB1157 containing
pTP223; 3 to 5, PCR products from three independent linear
transformants of AB1157 containing pTP223; 6, control reaction (no
cells). The positions of 1- and 2-kb DNA standards are shown by
arrows.
|
|
Replacement of kan for recC.
A region other
than lacZ was also tested for gene replacement promoted by
Red and Gam. Digestion of pKM121 with PstI generates a
6.3-kb linear fragment containing the kanamycin resistance gene flanked
by 2,476 bp upstream and 2,771 bp downstream of recC. The
fragment was purified on polyacrylamide gels, mixed with AB1157 containing pTP223 (Red plus Gam) and JC9387 (recBC sbcBC) at
a concentration of 2 µg/ml, and electroporated as described in
Materials and Methods. Recombinants were scored as kanamycin-resistant
transformants. In AB1157 containing a control plasmid, no transformants
were found. The recBC sbcBC strain produced recombinants at
a frequency of 1.8 × 10
4 per survivor. In AB1157
containing pTP223 (Red plus Gam), gene replacement occurred at a
frequency of 0.75 × 10
4 per survivor. (However,
gene replacement with this fragment deletes recC, generating
a strain with fivefold reduced viability relative to JC9387 [not
shown]. For this reason, the true frequency of
Red-promoted
recombination in this strain may be closer to 3.7 × 10
4.) From these data, it is clear that other regions of
the chromosome besides lacZ are amenable to
Red-promoted
recombination. The
Red-Gam-producing strain did not generate
recombinants at a higher frequency than the recBC sbcBC
strain, as was seen with the lacZ::kan
fragment described above. One possible explanation for this result is
that the
Red system is better equipped than the host RecF pathway
to recombine linear DNA substrates that contain small regions of
homology (~1,000 bp), a relative advantage that disappears with
increasing amounts of homologous DNA. However, I cannot rule out
context effects (for example, higher rates of transcription of
lacZ relative to recC). Experiments to examine these types of questions are under way.
Moving the Plac-red operon from the plasmid
to the chromosome.
Induction of plasmid-encoded gam,
bet, and exo results in linear multimerization of
the plasmid (30). It is possible that these linear multimers
act as competitive inhibitors for
Red-promoted recombination of
electroporated linear DNA substrates. A similar scenario was seen
previously when control plasmids in a recD strain, which
induces linear multimerization of plasmids, inhibited RecBC-promoted conjugational recombination (25). This hypothesis was tested by placing the Plac-red operon into the
chromosome. Since RecBCD must be deactivated to promote
Red-dependent recombination, the chromosomal region of JC9387
(recBC sbcBC) encoding recC, ptr,
recB, and recD was replaced with the
Plac-red operon (see Materials and Methods).
Since RecBCD is absent in this strain, Gam is predicted not to be
required for efficient recombination.
Figure
4 shows the region of the
chromosome containing the
recBCD genes, the
recBCD::
kan and
recBCD::P
lac-red kan substitutions, and the PCR primers used to verify the strain
constructions.
Primers 7, 8, and 9 were included in a PCR with colonies
of JC9387
(
recBC sbcBC) and KM20
(
recBCD::P
lac-red
sbcBC). These
primers flank the left junction point of the
substitution and
are predicted to generate a PCR product of 1,982 kb
from wild-type
E. coli sequence (via primers 7 and 8) and a
738-bp PCR fragment
from KM20 (via primers 7 and 9). As seen in Fig.
5
(lanes 2 and
3), the PCR fragments generated in these reactions are
consistent
with its genotype. A second set of primers (
10,
11, and
12)
was used to verify the right endpoint of the replacement
allele.
PCR products of 2,018 and 1,223 bp are predicted from wild-type
E. coli sequence and the replacement allele, respectively.
In
both cases, the expected products were observed (Fig.
5, lanes
5 and 6), verifying the
structure of the replacement allele in
KM20. This same analysis was
performed on KM22, with identical
results (data not shown). In another
PCR with primers 7 and 10,
KM19 gave the 2.0-kb product expected for
replacement of the
recBCD region with the
kan
insert (data not shown). The gene for kanamycin
resistance flanks the
P
lac-red operon in KM20, allowing
the
recBCD::P
lac-red
substitution to be easily transferred
into other
E. coli
strains. The
recBCD::P
lac-red
substitution,
as well as a control
recBCD deletion, were
transferred into wild-type,
recF, and
recJ hosts
by P1 transduction. The recombination proficiency
of these strains was
tested with electroporated linear substrates
(Table
5).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Structures of recBCD deletions and
Plac-red substitution. Shown are the
recBCD regions in wild-type cells (A), KM19 and KM21
( recBCD::kan) (B), and KM20 and KM22
( recBCD::Plac-red kan)
(C). Included are the relative positions of the PCR primers used to
verify the structures of the wild-type and both substitution alleles.
In panel C, transcription of red and kan occurs
leftward (same direction as argA but opposite the direction
of thyA).
|
|

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5.
PCR analysis of the
recBCD::Plac-red allele.
Lanes: 1, 1-kb DNA ladder standards (Gibco-BRL); 2 to 4, PCR products
generated with primers 7, 8, and 9 (Fig. 4) from JC9387 (recBC
sbcBC), KM20
( recBCD::Plac-red
sbcBC), and the control reaction (no cells), respectively; 5 to 7, PCR products generated with primers 10, 11, and 12 (Fig. 4) from JC9387
(recBC sbcBC), KM20
( recBCD::Plac-red
sbcBC), and the control reaction (no cells), respectively. The
positions of 1- and 2-kb DNA standards are shown by arrows.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 5.
Electroporation of a linear DNA fragment
(lacZ::tet)a
into cells containing the
recBCD::Plac-bet
exo substitution
|
|
Since these strains are kanamycin resistant, a
lacZ::
tet-containing plasmid,
pKM133 (Table
1), was prepared. After digestion
of pKM133 with
PvuII, the 3.9-kb linear
lacZ::
tet fragment was
isolated and
purified as described in Materials and Methods. The
fragment, which
contains the tetracycline resistance determinant
flanked by 1,256 and
1,301 bp of
lacZ sequence, was electroporated
into strains
containing the
recBCD::P
lac-red
substitution.
As seen in Table
5, no recombinants were obtained with
wild-type
cells. When the
recBCD::P
lac-red
substitution was transferred
into a
recBC sbcBC background
(KM20), recombinants appeared at
a frequency of 2.3 × 10
4 per survivor, a 53-fold increase relative to JC9387,
its
recBC sbcBC parent. When a
recBCD allele
(no
red) was transferred into
an
sbcBC background
(KM19), no increase in recombination relative
to JC9387 (
recBC
sbcBC) was observed. When the
recBCD::P
lac-red substitution was moved into a wild-type background (KM22),
recombination
proficiency with the linear
lacZ::
tet fragments was retained
(63-fold
higher relative to
recBC sbcBC). Thus,
sbcBC is not required for

Red-promoted recombination, as
expected. In constructs where
the
recBCD region was deleted
without inserting the P
lac-red operon (KM21), no
recombinants were detected. Similar to the pattern
seen with
plasmid-encoded

Red and Gam, RecF was required (decreased
17-fold
in a
recF background) and RecJ was inhibitory (increased
5-fold in a
recJ background). A
recD strain
(KM353) showed a frequency
of recombination similar to that for the
recBC sbcBC strain (JC9387).
As with the plasmid-encoded

Red-promoted recombinants described
above, the structures of these
recombinants were tested by PCR
analysis. All of 12 white
tetracycline-resistant colonies from
electroporation of KM22 with the
lacZ::
tet substrate generated
a 3.4-kb
fragment following PCR analysis of the chromosomal
lacZ locus (data not shown), verifying that most the recombinants were
formed by simple replacement of
lacZ, an event likely
generated
by a double-crossover mechanism.
In summary, even though the copy number of the
P
lac-red operon was reduced significantly when
the operon was moved
from a multicopy plasmid to the chromosome, the
frequency of recombinants
per survivor increased fivefold (compare
AB1157 containing pTP223
in Table
3, experiment B, with KM22 in Table
5). This comparison
may not be fair, however, since the
lacZ::
tet fragment used for
Table
5 has
20% more homologous DNA relative to the
lacZ::
kan fragment used for Table
3
(see the legend to Fig.
1 for details).
A more appropriate comparison
is between the ratios of recombination
rates promoted by

Red and
RecF pathways, when

Red is produced
from a plasmid rather than the
chromosome, a ratio which increases
from 15-fold to 63-fold (at linear
DNA concentrations of 15 µg/ml;
compare Table
3, experiment B, and
Table
5). This ratio is even
higher (130-fold) in circumstances where
lower concentrations
of DNA are used (Table
3, experiment A).
Properties of E. coli (
recBCD
Plac-red).
KM22, containing the
recBCD Plac-red allele, was
compared to wild-type cells and KM21 (
recBCD) for
viability, UV sensitivity, and proficiency at conjugational
recombination. By determining the number of visible cells that
eventually form CFU, KM22 (in the presence of IPTG) was found to be
similar to wild-type cells, displaying nearly 100% viability (data not
shown). In the absence of IPTG, KM22 showed about 50% viability, while
KM21 (
recBCD) showed only 10% viability (data not
shown). A comparison of the UV survival patterns among these strains is
shown in Fig. 6. This experiment reveals
that
Red can suppress the UV sensitivity of KM21
(
recBCD). In fact, expression of
Red in KM22
increased the level of survival (relative to wild-type cells) as much
as 10-fold at 30 J/m2. In the absence of IPTG, KM22 showed
decreased survival rates, but still higher than that exhibited by KM21,
likely caused by low-level expression of
red. Finally,
KM22 was proficient at conjugational recombination (20% of wild-type
levels) compared to KM21 (1% of wild-type levels) (data not shown).
Thus, single-copy
red in place of recBCD in
the E. coli chromosome suppresses many of the defects
exhibited by the
recBCD strain, making hosts containing
the
recBCD Plac-red allele easy to
work with for strain construction.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 6.
UV resistance of cells containing the
recBCD::Plac-red allele.
AB1157 (wild type; circles), KM21( recBCD; triangles), and
KM22 ( recBCD::Plac-red;
squares) were grown to 2 × 108 cells/ml, spun down,
resuspended in minimal medium, and kept on ice. Cells were diluted in
minimal medium, spread on LB plates, exposed to the indicated doses of
UV, and grown overnight in the dark. KM22 was grown and plated in the
presence (closed squares) and absence (open squares) of 1 mM IPTG.
Unirradiated plates were used to determine the total number of cells
plated.
|
|
Gene replacement with a PCR product.
The DNA from one of the
PCRs used to verify the structure of the
lacZ::tet replacement into KM22
described above (containing ~1 to 2 µg of DNA) was purified by
phenol extraction, concentrated by ethanol precipitation, and
electroporated into KM22. This fragment has the tetracycline resistance
gene from pBR322 (1.4 kb) flanked by 1,054 and 918 bp of
lacZ sequence. Following electroporation of a portion of
this PCR-generated DNA sample into KM22, white tetracycline-resistant
transformants were generated at a frequency of 6.5 × 10
5 per survivor. No transformants were generated
when an equal amount of the purified PCR product was
electroporated into a recBC sbcBC strain. Thus, the higher
efficiency of the
recBCD::Plac-red substitution, relative to recBC sbcBC, allows greater
success of linear transformation with DNA fragments generated by PCR, showing that gene replacement can be performed in E. coli
without prior cloning of the gene of interest.
 |
DISCUSSION |
It is known that the bacteriophage
recombination
system Red, in the absence of E. coli's RecBCD
activity, can act on linear DNA substrates to promote general
homologous recombination. Given the break-join mechanism proposed for
Red-mediated recombination (40), as well as the absence
of any hotspot requirements, it seemed likely that
Red would be
well suited for the promotion of gene replacement in E. coli. This report shows that
Red, together with
's
anti-RecBCD function Gam, when produced from a plasmid, is capable of
promoting high levels of recombination between linear DNA fragment and
the E. coli chromosome. What is noteworthy is that wild-type
cells expressing
Red and Gam, or cells containing the
recBCD::Plac-red
substitution, consistently showed higher levels of recombinants per
survivor than recBC sbcBC or recD strains, hosts
typically used for gene replacement in E. coli, when cells
were transformed with linear DNA containing ~2,000 bp of homology.
The levels of
Red-promoted recombination varied between 15- and
130-fold greater than that seen with the recBC sbcBC strain,
depending on the amount of DNA electroporated, the extent of flanking
homology, and how the
Red functions were supplied.
With the linear DNA lacZ substrates containing about 1,000 bp of homology on each end, wild-type cells expressing plasmid-encoded
Red and Gam were more efficient at linear DNA transformation than a
recBC sbcBC strain, especially with lower concentrations of
DNA (Table 3, experiment A). This result may reflect the ability of
Red to work more efficiently, possibly because of the higher copy
number of Exo and Bet relative to whatever functions act to initiate
recombination events via the RecF pathway. Alternatively, the higher
efficiency of
Red functions may reflect a higher affinity for DNA
ends or greater catalytic activity relative to the comparable functions
of the RecF pathway. The higher efficiency of the
Red system (and
possibly other phage recombination systems) may reflect the
circumstances of phage biology, where recombination may be restricted
to small regions of homology (e.g., terminal redundancy) and has to
take place within a short interval of the life cycle right after
infection or just prior to packaging.
Regions other than lacZ can act as a substrate for
Red-promoted recombination. A
recC::kan fragment containing 2,400 and 2,700 bp of homologous E. coli DNA sequences was
electroporated both into wild-type cells expressing plasmid-encoded Red
and Gam and into recBC sbcBC cells. In this case,
Red
was as good as, but not better than, the RecF pathway in promoting gene
replacement. However, in another experiment, a wild-type strain
expressing
Red was 100 times more efficient than a recD
strain in generating linear transformation leading to deletion of the
nei gene (endonuclease 8) in E. coli
(45). In this case, flanking homology was ~2,500 bp on one
side and ~3,500 bp on the other. DNA dose-response curves for both
the
Red and RecF-promoted linear DNA transformation should reveal
if
Red's higher efficiency is dependent on the levels of DNA, the
length of homologous DNA, or both.
In an effort to increase the rate of linear transformation,
the
Red functions were moved from the plasmid into the
chromosome. It was speculated that since
Red promotes
rolling-circle replication of plasmids, perhaps the linear
multimers compete with
Bet and Exo for electroporated substrates. I
found that chromosomally encoded
Red promoted recombination 63-fold
higher than in a recBC sbcBC strain, a 4.2-fold increase in
the relative rates of linear transformation compared to plasmid-encoded
Red. This result is interpreted as follows: the decrease in copy
number of
Red is more than compensated for by the absence of
competitive plasmid multimers, resulting in a higher rate of linear DNA
transformation when
Red is encoded by the chromosome rather than a
plasmid. Alternatively (or in addition), the increase may reflect the
inability of Gam to totally inactivate RecBCD, as has been observed
previously during conjugational recombination (27). This
latter possibility can be answered by placing both Red and Gam in a
chromosomal region other than recBCD.
A recent study taking advantage of the RecBCD pathway of
recombination used Chi sites properly situated on each side of a 6.5-kb linear DNA fragment to promote gene replacement in
E. coli (7). The advantage of this system is that
it uses the RecBCD pathway of recombination, which does not require any
modification of (or addition to) the host functions. Thus, Chi-promoted
gene replacement may be applicable to other bacteria, if their
respective Chi hotspot sequences can be identified, as has been
done with Lactococcus lactis (4). The
disadvantages of Chi-promoted recombination is the requirement for
specific sequences in the linear DNA substrate, as well as the
relatively low frequency of gene replacement (2 × 10
5 to 7 × 10
5). It is noteworthy
that the frequencies of
Red-promoted gene replacement in wild-type
hosts reported here were 2- to 10-fold higher than those reported for
RecBCD, even though the
Red substrates used here contained shorter
regions of homology relative to the substrate used in the RecBCD study
(2.1 kb of homology versus 3 kb). The advantage of
Red-promoted gene replacement was highlighted here by the ability
to transform E. coli with a PCR-generated fragment
containing only about 1,000 bp of homology on each end; a
recBC sbcBC strain was not transformed with this
substrate. Thus, by prudent selection of PCR primers and
protocols, one is likely to be able to construct any type of gene
replacement, insertion, or deletion desirable.
Assuming that the lacZ::kan fragment
and its parent plasmid pKM131 are transformed with equal efficiency,
the highest replacement frequency per competent cell reported here was
3.3 × 10
3 (transformation of recJ hosts
bearing
Red-Gam-producing plasmid [Table 4]). This replacement
frequency is about 100-fold less than that observed with conjugation
recombination. It is possible that this frequency can be driven even
higher by increased expression of
Red in vivo and/or by
electroporation with greater amounts of linear DNA substrates
(unpublished data).
Any E. coli strain transduced with the
recBCD
Plac-red substitution should be proficient for
gene replacement following electroporation with linear DNA substrates;
the exceptions, of course, are those containing mutations in genes
involved in assisting
Red-promoted recombination (e.g.,
recA). In strains intolerant of a
recBCD
allele (e.g., polA and dam strains), induction of
Red-promoted recombination has the potential to suppress
lethalities. KM22 (
recBCD
Plac-red) is fully viable and grows well even in
the absence of IPTG, though the circular plasmid transformation rate in
this strain is 10-fold lower than in wild-type cells (a result likely
due to plasmid linear multimerization, as seen in recBC
sbcBC strains). If necessary, the replaced allele should be moved
to a background of choice. In cases where the host lacks an efficient
system of backcrossing, one could use pTP223 to transiently generate
proficiency for gene replacement, followed by plating on fusaric acid
plates to select for loss of the plasmid following nonselective growth
(18). Finally, it is possible that plasmid-encoded
Red
and Gam would stimulate gene replacement in other bacteria as well, if
the
Gam function is active at inhibiting the hosts' RecBCD enzyme.
To this end, anti-RecBCD functions from phages other than those that
infect E. coli, such as the abc function from
phage P22 (27), may be useful for gene replacement in other bacterial species.
 |
ACKNOWLEDGMENTS |
This work was supported by Public Health Service grant AI18234
and a small grant project (105061) from the University of Massachusetts Medical Center.
I thank Anthony Poteete, Anita Fenton, and Milan Jucovic for comments
on the manuscript. I thank Jon Goguen for construction and advice on
use of the electroporation apparatus.
 |
FOOTNOTES |
*
Mailing address: Molecular Genetics and Microbiology,
University of Massachusetts Medical Center, Worcester, MA 01655. Phone: (508) 856-6069. Fax: (508) 856-5920. E-mail:
kenan.murphy{at}ummed.edu.
 |
REFERENCES |
| 1.
|
Bassett, C. L., and S. R. Kushner.
1984.
Exonucleases I, III, and V are required for stability of ColE1-related plasmids in Escherichia coli.
J. Bacteriol.
157:661-664[Abstract/Free Full Text].
|
| 2.
|
Biek, D. P., and S. N. Cohen.
1986.
Identification and characterization of recD, a gene affecting plasmid maintenance and recombination in Escherichia coli.
J. Bacteriol.
167:594-603[Abstract/Free Full Text].
|
| 3.
|
Biswas, I.,
A. Gruss,
S. D. Ehrlich, and E. Maguin.
1993.
High-efficiency gene inactivation and replacement system for gram-positive bacteria.
J. Bacteriol.
175:3628-3635[Abstract/Free Full Text].
|
| 4.
|
Biswas, I.,
E. Maguin,
S. D. Ehrlich, and A. Gruss.
1995.
A 7-base-pair sequence protects DNA from exonucleolytic degradation in Lactococcus lactis.
Proc. Natl. Acad. Sci. USA
92:2244-2248[Abstract/Free Full Text].
|
| 5.
|
Brent, R., and M. Ptashne.
1981.
Mechanism of action of the lexA gene product.
Proc. Natl. Acad. Sci. USA
78:4202-4208.
|
| 6.
|
Carter, D. M., and C. M. Radding.
1971.
Role of exonuclease and protein of phage lambda in genetic recombination. II. Substrate specificity and the mode of action of lambda exonuclease.
J. Biol. Chem.
246:2502-2510[Abstract/Free Full Text].
|
| 7.
|
Dabert, P., and G. R. Smith.
1997.
Gene replacement with linear DNA fragments in wild type Escherichia coli: enhancement by chi sites.
Genetics
145:877-889[Abstract].
|
| 8.
|
Dykstra, C. C.,
D. Prasher, and S. R. Kushner.
1984.
Physical and biochemical analysis of the cloned recB and recC genes of Escherichia coli K-12.
J. Bacteriol.
157:21-27[Abstract/Free Full Text].
|
| 9.
|
Fenton, A. C., and A. R. Poteete.
1984.
Genetic analysis of the erf region of the bacteriophage P22 chromosome.
Virology
134:148-160[Medline].
|
| 10.
|
Gutterson, N. I., and D. E. Koshland.
1983.
Replacement and amplification of bacterial genes with sequences altered in vitro.
Proc. Natl. Acad. Sci. USA
80:4894-4898[Abstract/Free Full Text].
|
| 11.
|
Hamilton, C. M.,
M. Aldea,
B. K. Washburn,
P. Babitzke, and S. R. Kushner.
1989.
New method for generating deletions and gene replacements in Escherichia coli.
J. Bacteriol.
171:4617-4622[Abstract/Free Full Text].
|
| 12.
|
Hansen, J. N.
1981.
Use of solubilized acrylamide gels for the use of DNA fragments suitable for sequence analysis.
Anal. Biochem.
116:146-151[Medline].
|
| 13.
|
Jasin, M., and P. Schimmel.
1984.
Deletions of an essential gene in Escherichia coli by site-specific recombination with linear DNA fragments.
J. Bacteriol.
159:783-786[Abstract/Free Full Text].
|
| 14.
|
Karu, A. E.,
Y. Sakaki,
H. Echols, and S. Lynn.
1975.
The protein specified by bacteriophage .
J. Biol. Chem.
250:7377-7387[Abstract/Free Full Text].
|
| 15.
|
Kmiec, E., and W. K. Holloman.
1981.
protein of bacteriophage promotes renaturation of DNA.
J. Biol. Chem.
256:12636-12639[Abstract/Free Full Text].
|
| 16.
|
Leenhouts, K.,
G. Buist,
A. Bolhuis,
A. tenBerge,
J. Kiel,
I. Mierau,
M. Dabrowska,
G. Venema, and J. Kok.
1996.
A general system for generating unlabelled gene replacements in bacterial chromosomes.
Mol. Gen. Genet.
253:217-224[Medline].
|
| 17.
|
Little, J. W.
1967.
An exonuclease induced by bacteriophage . II. Nature of the enzymic reaction.
J. Biol. Chem.
242:679[Abstract/Free Full Text].
|
| 18.
|
Maloy, S. R., and W. D. Nunn.
1981.
Selection for loss of tetracycline resistance by Escherichia coli.
J. Bacteriol.
145:1110-1112[Abstract/Free Full Text].
|
| 19.
|
Marinus, M. G.,
M. Carraway,
A. Z. Frey,
L. Brown, and J. A. Arraj.
1983.
Insertion mutations in the dam gene of Escherichia coli K-12.
Mol. Gen. Genet.
191:288-289[Medline].
|
| 20.
|
Mauer, R.,
B. J. Meyers, and M. Ptashne.
1980.
Gene regulation at the right operator (OR) of bacteriophage . I. OR3 and autogenous control by repressor.
J. Mol. Biol.
139:147-161[Medline].
|
| 21.
|
Miller, J. H.
1972.
.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 22.
|
Miller, V. L., and J. J. Mekalanos.
1988.
A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR.
J. Bacteriol.
170:2575-2583[Abstract/Free Full Text].
|
| 23.
|
Muniyappa, K., and C. M. Radding.
1986.
The homologous recombination system of phage : pairing activities of protein.
J. Biol. Chem.
261:7472-7478[Abstract/Free Full Text].
|
| 24.
|
Muniyappa, K.,
S. L. Shaner,
S. S. Tang, and C. M. Radding.
1984.
Mechanism of the concerted action of RecA protein and helix destabilizing proteins in homologous recombination.
Proc. Natl. Acad. Sci. USA
81:2757-2761[Abstract/Free Full Text].
|
| 25.
|
Murphy, K. C.
1991.
Gam protein inhibits the helicase and -stimulated recombination activities of Escherichia coli RecBCD enzyme.
J. Bacteriol.
173:5808-5821[Abstract/Free Full Text].
|
| 26.
|
Murphy, K. C.
1994.
Biochemical characterization of P22 phage-modified Escherichia coli RecBCD enzyme.
J. Biol. Chem.
269:22507-22516[Abstract/Free Full Text].
|
| 27.
|
Murphy, K. C., and L. J. Lewis.
1993.
Properties of Escherichia coli expressing bacteriophage P22 Abc (anti-RecBCD) proteins, including inhibition of Chi activity.
J. Bacteriol.
175:1756-1766[Abstract/Free Full Text].
|
| 28.
|
Poteete, A. R., and A. C. Fenton.
1984.
Lambda red-dependent growth and recombination of phage P22.
Virology
134:161-167[Medline].
|
| 29.
|
Poteete, A. R., and A. C. Fenton.
1993.
Efficient double-strand break-stimulated recombination promoted by the general recombination systems of phages and P22.
Genetics
134:1013-1021[Abstract].
|
| 30.
|
Poteete, A. R.,
A. C. Fenton, and K. C. Murphy.
1988.
Modulation of Escherichia coli RecBCD activity by the bacteriophage Gam and P22 Abc functions.
J. Bacteriol.
170:2012-2021[Abstract/Free Full Text].
|
| 31.
|
Poteete, A. R.,
A. C. Fenton, and A. V. Semerjian.
1991.
Bacteriophage P22 accessory recombination function.
Virology
182:316-323[Medline].
|
| 32.
|
Poteete, A. R., and M. R. Volkert.
1988.
Activation of recF-dependent recombination in Escherichia coli by bacteriophage and P22-encoded functions.
J. Bacteriol.
170:4379-4381[Abstract/Free Full Text].
|
| 33.
|
Ream, L. W.,
N. J. Crisona, and A. J. Clark.
1978.
ColE1 plasmid stability in Exol and ExoV strains of Escherichia coli K-12, p. 78-80. In
D. Schlessinger (ed.), Microbiology 1978.
American Society for Microbiology, Washington, D.C.
|
| 34.
|
Russell, C. B.,
D. S. Thaler, and F. W. Dahlquist.
1989.
Chromosomal transformation of Escherichia coli recD strains with linearized plasmids.
J. Bacteriol.
171:2609-2613[Abstract/Free Full Text].
|
| 35.
|
Ruther, U.
1980.
Construction and properties of a new cloning vehicle, allowing direct screening for recombinant plasmids.
Mol. Gen. Genet.
178:475-477[Medline].
|
| 36.
|
Saarilahti, H. T., and E. T. Palva.
1985.
In vivo transfer of chromosomal mutations onto multicopy plasmids utilizing polA strains: cloning of an ompR2 mutation in Escherichia coli K-12.
FEMS Microbiol. Lett.
26:27-33.
|
| 37.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 38.
|
Slater, S., and R. Maurer.
1993.
Simple phage-based system for generating allele replacements in Escherichia coli.
J. Bacteriol.
175:4260-4262[Abstract/Free Full Text].
|
| 39.
|
Stahl, F. W.,
J. M. Crasemann, and M. M. Stahl.
1975.
Rec-mediated recombinational hot spot activity in bacteriophage lambda. III. Chi mutations are site-mutations stimulating rec-mediated recombination.
J. Mol. Biol.
94:203-212[Medline].
|
| 40.
|
Stahl, F. W.,
M. S. Fox,
D. Faulds, and M. M. Stahl.
1990.
Break-join recombination in phage .
Genetics
125:463-474[Abstract].
|
| 41.
|
Stahl, F. W.,
I. Kobayashi, and M. M. Stahl.
1985.
In phage , cos is a recombinator in the Red pathway.
J. Mol. Biol.
181:199-209[Medline].
|
| 42.
|
Stahl, F. W., and M. M. Stahl.
1974.
A role for recBC nuclease in the distribution of crossovers along unreplicated chromosomes of phage .
Mol. Gen. Genet.
131:27-30[Medline].
|
| 43.
|
Stahl, F. W.,
M. M. Stahl, and R. E. Malone.
1978.
Red-mediated recombination of phage lambda in a recA recB host.
Mol. Gen. Genet.
159:207-211.
|
| 44.
|
Thaler, D. S.,
M. M. Stahl, and F. W. Stahl.
1987.
Double-chain-cut sites are recombination hotspots in the Red pathway of phage .
J. Mol. Biol.
195:75-87[Medline].
|
| 45.
| Volkert, M. Personal communication.
|
| 46.
|
Winans, S. C.,
S. J. Elledge,
J. H. Krueger, and G. C. Walker.
1985.
Site-directed insertion and deletion mutagenesis with cloned fragments in Escherichia coli.
J. Bacteriol.
161:1219-1221[Abstract/Free Full Text].
|
J Bacteriol, April 1998, p. 2063-2071, Vol. 180, No. 8
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhang, J., Nagel, C.-H., Sodeik, B., Lippe, R.
(2009). Early, Active, and Specific Localization of Herpes Simplex Virus Type 1 gM to Nuclear Membranes. J. Virol.
83: 12984-12997
[Abstract]
[Full Text]
-
Krishnan, K., Flower, A. M.
(2008). Suppression of {Delta}bipA Phenotypes in Escherichia coli by Abolishment of Pseudouridylation at Specific Sites on the 23S rRNA. J. Bacteriol.
190: 7675-7683
[Abstract]
[Full Text]
-
Mizoguchi, H., Sawano, Y., Kato, J.-i., Mori, H.
(2008). Superpositioning of Deletions Promotes Growth of Escherichia coli with a Reduced Genome. DNA Res
15: 277-284
[Abstract]
[Full Text]
-
Yu, B. J., Kang, K. H., Lee, J. H., Sung, B. H., Kim, M. S., Kim, S. C.
(2008). Rapid and efficient construction of markerless deletions in the Escherichia coli genome. Nucleic Acids Res
36: e84-e84
[Abstract]
[Full Text]
-
Erume, J., Berberov, E. M., Kachman, S. D., Scott, M. A., Zhou, Y., Francis, D. H., Moxley, R. A.
(2008). Comparison of the Contributions of Heat-Labile Enterotoxin and Heat-Stable Enterotoxin b to the Virulence of Enterotoxigenic Escherichia coli in F4ac Receptor-Positive Young Pigs. Infect. Immun.
76: 3141-3149
[Abstract]
[Full Text]
-
Sun, W., Wang, S., Curtiss, R. III
(2008). Highly Efficient Method for Introducing Successive Multiple Scarless Gene Deletions and Markerless Gene Insertions into the Yersinia pestis Chromosome. Appl. Environ. Microbiol.
74: 4241-4245
[Abstract]
[Full Text]
-
Gilberthorpe, N. J., Poole, R. K.
(2008). Nitric Oxide Homeostasis in Salmonella typhimurium: ROLES OF RESPIRATORY NITRATE REDUCTASE AND FLAVOHEMOGLOBIN. J. Biol. Chem.
283: 11146-11154
[Abstract]
[Full Text]
-
Datta, S., Costantino, N., Zhou, X., Court, D. L.
(2008). Identification and analysis of recombineering functions from Gram-negative and Gram-positive bacteria and their phages. Proc. Natl. Acad. Sci. USA
105: 1626-1631
[Abstract]
[Full Text]
-
DeVito, J. A.
(2008). Recombineering with tolC as a Selectable/Counter-selectable Marker: remodeling the rRNA Operons of Escherichia coli. Nucleic Acids Res
36: e4-e4
[Abstract]
[Full Text]
-
Hobman, J. L., Patel, M. D., Hidalgo-Arroyo, G. A., Cariss, S. J. L., Avison, M. B., Penn, C. W., Constantinidou, C.
(2007). Comparative Genomic Hybridization Detects Secondary Chromosomal Deletions in Escherichia coli K-12 MG1655 Mutants and Highlights Instability in the flhDC Region. J. Bacteriol.
189: 8786-8792
[Abstract]
[Full Text]
-
Fukushima, S., Itaya, M., Kato, H., Ogasawara, N., Yoshikawa, H.
(2007). Reassessment of the In Vivo Functions of DNA Polymerase I and RNase H in Bacterial Cell Growth. J. Bacteriol.
189: 8575-8583
[Abstract]
[Full Text]
-
Tischer, B. K., Kaufer, B. B., Sommer, M., Wussow, F., Arvin, A. M., Osterrieder, N.
(2007). A Self-Excisable Infectious Bacterial Artificial Chromosome Clone of Varicella-Zoster Virus Allows Analysis of the Essential Tegument Protein Encoded by ORF9. J. Virol.
81: 13200-13208
[Abstract]
[Full Text]
-
Chiu, Y.-F., Tung, C.-P., Lee, Y.-H., Wang, W.-H., Li, C., Hung, J.-Y., Wang, C.-Y., Kawaguchi, Y., Liu, S.-T.
(2007). A comprehensive library of mutations of Epstein Barr virus. J. Gen. Virol.
88: 2463-2472
[Abstract]
[Full Text]
-
Gilberthorpe, N. J., Lee, M. E., Stevanin, T. M., Read, R. C., Poole, R. K.
(2007). NsrR: a key regulator circumventing Salmonella enterica serovar Typhimurium oxidative and nitrosative stress in vitro and in IFN-{gamma}-stimulated J774.2 macrophages. Microbiology
153: 1756-1771
[Abstract]
[Full Text]
-
Rivero-Muller, A., Lajic, S., Huhtaniemi, I.
(2007). Assisted large fragment insertion by Red/ET-recombination (ALFIRE)--an alternative and enhanced method for large fragment recombineering. Nucleic Acids Res
0: gkm250v1-8
[Abstract]
[Full Text]
-
Joo, L. M., Macfarlane-Smith, L. R., Okeke, I. N.
(2007). Error-Prone DNA Repair System in Enteroaggregative Escherichia coli Identified by Subtractive Hybridization. J. Bacteriol.
189: 3793-3803
[Abstract]
[Full Text]
-
Chan, W., Costantino, N., Li, R., Lee, S. C., Su, Q., Melvin, D., Court, D. L., Liu, P.
(2007). A recombineering based approach for high-throughput conditional knockout targeting vector construction. Nucleic Acids Res
0: gkm163v1-13
[Abstract]
[Full Text]
-
Reading, N. C., Torres, A. G., Kendall, M. M., Hughes, D. T., Yamamoto, K., Sperandio, V.
(2007). A Novel Two-Component Signaling System That Activates Transcription of an Enterohemorrhagic Escherichia coli Effector Involved in Remodeling of Host Actin. J. Bacteriol.
189: 2468-2476
[Abstract]
[Full Text]
-
Semprini, S., Troup, T.J., Kotelevtseva, N., King, K., Davis, J.R.E., Mullins, L.J., Chapman, K.E., Dunbar, D.R., Mullins, J.J.
(2007). Cryptic loxP sites in mammalian genomes: genome-wide distribution and relevance for the efficiency of BAC/PAC recombineering techniques. Nucleic Acids Res
35: 1402-1410
[Abstract]
[Full Text]
-
Huen, M. S. Y., Li, X.-t., Lu, L.-Y., Watt, R. M., Liu, D.-P., Huang, J.-D.
(2006). The involvement of replication in single stranded oligonucleotide-mediated gene repair. Nucleic Acids Res
34: 6183-6194
[Abstract]
[Full Text]
-
Priyadarshini, R., Popham, D. L., Young, K. D.
(2006). Daughter Cell Separation by Penicillin-Binding Proteins and Peptidoglycan Amidases in Escherichia coli.. J. Bacteriol.
188: 5345-5355
[Abstract]
[Full Text]
-
Xie, Y., Yao, Y., Kolisnychenko, V., Teng, C.-H., Kim, K. S.
(2006). HbiF Regulates Type 1 Fimbriation Independently of FimB and FimE. Infect. Immun.
74: 4039-4047
[Abstract]
[Full Text]
-
Ekborg, N. A., Taylor, L. E., Longmire, A. G., Henrissat, B., Weiner, R. M., Hutcheson, S. W.
(2006). Genomic and Proteomic Analyses of the Agarolytic System Expressed by Saccharophagus degradans 2-40.. Appl. Environ. Microbiol.
72: 3396-3405
[Abstract]
[Full Text]
-
Bloor, A. E., Cranenburgh, R. M.
(2006). An Efficient Method of Selectable Marker Gene Excision by Xer Recombination for Gene Replacement in Bacterial Chromosomes. Appl. Environ. Microbiol.
72: 2520-2525
[Abstract]
[Full Text]
-
Zhou, Y., Shi, T., Mozola, M. A., Olson, E. R., Henthorn, K., Brown, S., Gussin, G. N., Friedman, D. I.
(2006). Evidence that the Promoter Can Influence Assembly of Antitermination Complexes at Downstream RNA Sites. J. Bacteriol.
188: 2222-2232
[Abstract]
[Full Text]
-
Sakoh, M., Ito, K., Akiyama, Y.
(2005). Proteolytic Activity of HtpX, a Membrane-bound and Stress-controlled Protease from Escherichia coli. J. Biol. Chem.
280: 33305-33310
[Abstract]
[Full Text]
-
Nachin, L., Nannmark, U., Nystrom, T.
(2005). Differential Roles of the Universal Stress Proteins of Escherichia coli in Oxidative Stress Resistance, Adhesion, and Motility. J. Bacteriol.
187: 6265-6272
[Abstract]
[Full Text]
-
Hayes, S., Asai, K., Chu, A. M., Hayes, C.
(2005). NinR- and Red-Mediated Phage-Prophage Marker Rescue Recombination in Escherichia coli: Recovery of a Nonhomologous imm{lambda} DNA Segment by Infecting {lambda}imm434 Phages. Genetics
170: 1485-1499
[Abstract]
[Full Text]
-
De Spiegeleer, P., Sermon, J., Vanoirbeek, K., Aertsen, A., Michiels, C. W.
(2005). Role of Porins in Sensitivity of Escherichia coli to Antibacterial Activity of the Lactoperoxidase Enzyme System. Appl. Environ. Microbiol.
71: 3512-3518
[Abstract]
[Full Text]
-
Onufryk, C., Crouch, M.-L., Fang, F. C., Gross, C. A.
(2005). Characterization of Six Lipoproteins in the {sigma}E Regulon. J. Bacteriol.
187: 4552-4561
[Abstract]
[Full Text]
-
Meynial-Salles, I., Cervin, M. A., Soucaille, P.
(2005). New Tool for Metabolic Pathway Engineering in Escherichia coli: One-Step Method To Modulate Expression of Chromosomal Genes. Appl. Environ. Microbiol.
71: 2140-2144
[Abstract]
[Full Text]
-
Wong, Q. N. Y., Ng, V. C. W., Lin, M. C. M., Kung, H.-f., Chan, D., Huang, J.-D.
(2005). Efficient and seamless DNA recombineering using a thymidylate synthase A selection system in Escherichia coli. Nucleic Acids Res
33: e59-e59
[Abstract]
[Full Text]
-
Ghosh, A. S., Young, K. D.
(2005). Helical Disposition of Proteins and Lipopolysaccharide in the Outer Membrane of Escherichia coli. J. Bacteriol.
187: 1913-1922
[Abstract]
[Full Text]
-
Skovgaard, O., Lobner-Olesen, A.
(2005). Reduced initiation frequency from oriC restores viability of a temperature-sensitive Escherichia coli replisome mutant. Microbiology
151: 963-973
[Abstract]
[Full Text]
-
Nakatogawa, H., Murakami, A., Mori, H., Ito, K.
(2005). SecM facilitates translocase function of SecA by localizing its biosynthesis. Genes Dev.
19: 436-444
[Abstract]
[Full Text]
-
Roux, A., Beloin, C., Ghigo, J.-M.
(2005). Combined Inactivation and Expression Strategy To Study Gene Function under Physiological Conditions: Application to Identification of New Escherichia coli Adhesins. J. Bacteriol.
187: 1001-1013
[Abstract]
[Full Text]
-
Meberg, B. M., Paulson, A. L., Priyadarshini, R., Young, K. D.
(2004). Endopeptidase Penicillin-Binding Proteins 4 and 7 Play Auxiliary Roles in Determining Uniform Morphology of Escherichia coli. J. Bacteriol.
186: 8326-8336
[Abstract]
[Full Text]
-
Metzgar, D., Bacher, J. M., Pezo, V., Reader, J., Doring, V., Schimmel, P., Marliere, P., de Crecy-Lagard, V.
(2004). Acinetobacter sp. ADP1: an ideal model organism for genetic analysis and genome engineering. Nucleic Acids Res
32: 5780-5790
[Abstract]
[Full Text]
-
Golubov, A., Neubauer, H., Nolting, C., Heesemann, J., Rakin, A.
(2004). Structural Organization of the pFra Virulence-Associated Plasmid of Rhamnose-Positive Yersinia pestis. Infect. Immun.
72: 5613-5621
[Abstract]
[Full Text]
-
Wickstrum, J. R., Egan, S. M.
(2004). Amino Acid Contacts between Sigma 70 Domain 4 and the Transcription Activators RhaS and RhaR. J. Bacteriol.
186: 6277-6285
[Abstract]
[Full Text]
-
Kang, Y., Durfee, T., Glasner, J. D., Qiu, Y., Frisch, D., Winterberg, K. M., Blattner, F. R.
(2004). Systematic Mutagenesis of the Escherichia coli Genome. J. Bacteriol.
186: 4921-4930
[Abstract]
[Full Text]
-
Poteete, A. R.
(2004). Modulation of DNA Repair and Recombination by the Bacteriophage {lambda} Orf Function in Escherichia coli K-12. J. Bacteriol.
186: 2699-2707
[Abstract]
[Full Text]
-
Grompone, G., Bidnenko, V., Ehrlich, S. D., Michel, B.
(2004). PriA Is Essential for Viability of the Escherichia coli Topoisomerase IV parE10(Ts) Mutant. J. Bacteriol.
186: 1197-1199
[Abstract]
[Full Text]
-
Tadokoro, A., Hayashi, H., Kishimoto, T., Makino, Y., Fujisaki, S., Nishimura, Y.
(2004). Interaction of the Escherichia coli Lipoprotein NlpI with Periplasmic Prc (Tsp) Protease. J Biochem
135: 185-191
[Abstract]
[Full Text]
-
Costantino, N., Court, D. L.
(2003). Enhanced levels of {lambda} Red-mediated recombinants in mismatch repair mutants. Proc. Natl. Acad. Sci. USA
100: 15748-15753
[Abstract]
[Full Text]
-
Li, X.-t., Costantino, N., Lu, L.-y., Liu, D.-p., Watt, R. M., Cheah, K. S. E., Court, D. L., Huang, J.-D.
(2003). Identification of factors influencing strand bias in oligonucleotide-mediated recombination in Escherichia coli. Nucleic Acids Res
31: 6674-6687
[Abstract]
[Full Text]
-
Cotta-de-Almeida, V., Schonhoff, S., Shibata, T., Leiter, A., Snapper, S. B.
(2003). A New Method for Rapidly Generating Gene-Targeting Vectors by Engineering BACs Through Homologous Recombination in Bacteria. Genome Res
13: 2190-2194
[Abstract]
[Full Text]
-
Akiyama, Y., Ito, K.
(2003). Reconstitution of Membrane Proteolysis by FtsH. J. Biol. Chem.
278: 18146-18153
[Abstract]
[Full Text]
-
Gust, B., Challis, G. L., Fowler, K., Kieser, T., Chater, K. F.
(2003). PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc. Natl. Acad. Sci. USA
100: 1541-1546
[Abstract]
[Full Text]
-
van der Weyden, L., Adams, D. J., Bradley, A.
(2002). Tools for targeted manipulation of the mouse genome. Physiol. Genomics
11: 133-164
[Abstract]
[Full Text]
-
Bunny, K., Liu, J., Roth, J.
(2002). Phenotypes of lexA Mutations in Salmonella enterica: Evidence for a Lethal lexA Null Phenotype Due to the Fels-2 Prophage. J. Bacteriol.
184: 6235-6249
[Abstract]
[Full Text]
-
Barbosa, M. D. F. S., Lin, S., Markwalder, J. A., Mills, J. A., DeVito, J. A., Teleha, C. A., Garlapati, V., Liu, C., Thompson, A., Trainor, G. L., Kurilla, M. G., Pompliano, D. L.
(2002). Regulated Expression of the Escherichia coli lepB Gene as a Tool for Cellular Testing of Antimicrobial Compounds That Inhibit Signal Peptidase I In Vitro. Antimicrob. Agents Chemother.
46: 3549-3554
[Abstract]
[Full Text]
-
Jeong, K. J., Lee, S. Y.
(2002). Excretion of Human {beta}-Endorphin into Culture Medium by Using Outer Membrane Protein F as a Fusion Partner in Recombinant Escherichia coli. Appl. Environ. Microbiol.
68: 4979-4985
[Abstract]
[Full Text]
-
Merlin, C., McAteer, S., Masters, M.
(2002). Tools for Characterization of Escherichia coli Genes of Unknown Function. J. Bacteriol.
184: 4573-4581
[Abstract]
[Full Text]
-
Poteete, A. R., Fenton, A. C., Wang, H. R.
(2002). Recombination-Promoting Activity of the Bacteriophage {lambda} Rap Protein in Escherichia coli K-12. J. Bacteriol.
184: 4626-4629
[Abstract]
[Full Text]
-
Kanehara, K., Ito, K., Akiyama, Y.
(2002). YaeL (EcfE) activates the sigma E pathway of stress response through a site-2 cleavage of anti-sigma E, RseA. Genes Dev.
16: 2147-2155
[Abstract]
[Full Text]
-
Watanabe, S., Yamaoka, N., Takada, Y., Fukunaga, N.
(2002). The cold-inducible icl gene encoding thermolabile isocitrate lyase of a psychrophilic bacterium, Colwellia maris. Microbiology
148: 2579-2589
[Abstract]
[Full Text]
-
Bishop, A. C., Xu, J., Johnson, R. C., Schimmel, P., de Crecy-Lagard, V.
(2002). Identification of the tRNA-Dihydrouridine Synthase Family. J. Biol. Chem.
277: 25090-25095
[Abstract]
[Full Text]
-
Spek, E. J., Vuong, L. N., Matsuguchi, T., Marinus, M. G., Engelward, B. P.
(2002). Nitric Oxide-Induced Homologous Recombination in Escherichia coli Is Promoted by DNA Glycosylases. J. Bacteriol.
184: 3501-3507
[Abstract]
[Full Text]
-
Poteete, A. R., Wang, H. R., Foster, P. L.
(2002). Phage {lambda} Red-Mediated Adaptive Mutation. J. Bacteriol.
184: 3753-3755
[Abstract]
[Full Text]
-
Moller, T., Franch, T., Udesen, C., Gerdes, K., Valentin-Hansen, P.
(2002). Spot 42 RNA mediates discoordinate expression of the E. coli galactose operon. Genes Dev.
16: 1696-1706
[Abstract]
[Full Text]
-
Borden, A., O'Grady, P. I., Vandewiele, D., Fernandez de Henestrosa, A. R., Lawrence, C. W., Woodgate, R.
(2002). Escherichia coli DNA Polymerase III Can Replicate Efficiently past a T-T cis-syn Cyclobutane Dimer if DNA Polymerase V and the 3' to 5' Exonuclease Proofreading Function Encoded by dnaQ Are Inactivated. J. Bacteriol.
184: 2674-2681
[Abstract]
[Full Text]
-
Uzzau, S., Figueroa-Bossi, N., Rubino, S., Bossi, L.
(2001). Epitope tagging of chromosomal genes in Salmonella. Proc. Natl. Acad. Sci. USA
10.1073/pnas.261348198v1
[Abstract]
[Full Text]
-
Day, W. A. Jr., Fernandez, R. E., Maurelli, A. T.
(2001). Pathoadaptive Mutations That Enhance Virulence: Genetic Organization of the cadA Regions of Shigella spp.. Infect. Immun.
69: 7471-7480
[Abstract]
[Full Text]
-
Kar, S., Adhya, S.
(2001). Recruitment of HU by piggyback: a special role of GalR in repressosome assembly. Genes Dev.
15: 2273-2281
[Abstract]
[Full Text]
-
Matsuoka, M., Takahama, K., Ogawa, T.
(2001). Gene replacement in cyanobacteria mediated by a dominant streptomycin-sensitive rps12 gene that allows selection of mutants free from drug resistance markers. Microbiology
147: 2077-2087
[Abstract]
[Full Text]
-
Quiberoni, A., Biswas, I., El Karoui, M., Rezaiki, L., Tailliez, P., Gruss, A.
(2001). In Vivo Evidence for Two Active Nuclease Motifs in the Double-Strand Break Repair Enzyme RexAB of Lactococcus lactis. J. Bacteriol.
183: 4071-4078
[Abstract]
[Full Text]
-
Ellis, H. M., Yu, D., DiTizio, T., Court, D. L.
(2001). High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides. Proc. Natl. Acad. Sci. USA
10.1073/pnas.121164898v1
[Abstract]
[Full Text]
-
Price-Carter, M., Tingey, J., Bobik, T. A., Roth, J. R.
(2001). The Alternative Electron Acceptor Tetrathionate Supports B12-Dependent Anaerobic Growth of Salmonella enterica Serovar Typhimurium on Ethanolamine or 1,2-Propanediol. J. Bacteriol.
183: 2463-2475
[Abstract]
[Full Text]
-
Strauss, B. S., Roberts, R., Francis, L., Pouryazdanparast, P.
(2000). Role of the dinB Gene Product in Spontaneous Mutation in Escherichia coli with an Impaired Replicative Polymerase. J. Bacteriol.
182: 6742-6750
[Abstract]
[Full Text]
-
Chaveroche, M.-K., Ghigo, J.-M., d'Enfert, C.
(2000). A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Res
28: e97-e97
[Abstract]
[Full Text]
-
Bhende, P. M., Egan, S. M.
(2000). Genetic Evidence that Transcription Activation by RhaS Involves Specific Amino Acid Contacts with Sigma 70. J. Bacteriol.
182: 4959-4969
[Abstract]
[Full Text]
-
Poteete, A. R., Fenton, A. C.
(2000). Genetic Requirements of Phage lambda Red-Mediated Gene Replacement in Escherichia coli K-12. J. Bacteriol.
182: 2336-2340
[Abstract]
[Full Text]
-
Reddy, M., Gowrishankar, J.
(2000). Characterization of the uup Locus and Its Role in Transposon Excisions and Tandem Repeat Deletions in Escherichia coli. J. Bacteriol.
182: 1978-1986
[Abstract]
[Full Text]
-
Battistoni, A., Pacello, F., Folcarelli, S., Ajello, M., Donnarumma, G., Greco, R., Grazia Ammendolia, M., Touati, D., Rotilio, G., Valenti, P.
(2000). Increased Expression of Periplasmic Cu,Zn Superoxide Dismutase Enhances Survival of Escherichia coli Invasive Strains within Nonphagocytic Cells. Infect. Immun.
68: 30-37
[Abstract]
[Full Text]
-
Martinez-Morales, F., Borges, A. C., Martinez, A., Shanmugam, K. T., Ingram, L. O.
(1999). Chromosomal Integration of Heterologous DNA in Escherichia coli with Precise Removal of Markers and Replicons Used during Construction. J. Bacteriol.
181: 7143-7148
[Abstract]
[Full Text]
-
Poteete, A. R., Fenton, A. C., Murphy, K. C.
(1999). Roles of RuvC and RecG in Phage lambda Red-Mediated Recombination. J. Bacteriol.
181: 5402-5408
[Abstract]
[Full Text]
-
Loh, T., Murphy, K. C., Marinus, M. G.
(2001). Mutational Analysis of the MutH Protein from Escherichia coli. J. Biol. Chem.
276: 12113-12119
[Abstract]
[Full Text]
-
Grimaud, R., Ezraty, B., Mitchell, J. K., Lafitte, D., Briand, C., Derrick, P. J., Barras, F.
(2001). Repair of Oxidized Proteins. IDENTIFICATION OF A NEW METHIONINE SULFOXIDE REDUCTASE. J. Biol. Chem.
276: 48915-48920
[Abstract]
[Full Text]
-
Yu, D., Ellis, H. M., Lee, E-C., Jenkins, N. A., Copeland, N. G., Court, D. L.
(2000). An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. USA
97: 5978-5983
[Abstract]
[Full Text]
-
Ellis, H. M., Yu, D., DiTizio, T., Court, D. L.
(2001). High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides. Proc. Natl. Acad. Sci. USA
98: 6742-6746
[Abstract]
[Full Text]
-
Uzzau, S., Figueroa-Bossi, N., Rubino, S., Bossi, L.
(2001). Epitope tagging of chromosomal genes in Salmonella. Proc. Natl. Acad. Sci. USA
98: 15264-15269
[Abstract]
[Full Text]