Previous Article | Next Article 
J Bacteriol, April 1998, p. 2144-2151, Vol. 180, No. 8
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Variation of the Ribosomal Operon 16S-23S Gene Spacer Region in
Representatives of Salmonella enterica Subspecies
Sara Pérez
Luz,1
Francisco
Rodríguez-Valera,1,*
Ruiting
Lan,2 and
Peter R.
Reeves2
Departamento de Genética y
Microbiología, Campus de San Juan, Universidad de Alicante,
03080 Alicante, Spain,1 and
Department
of Microbiology, The University of Sydney, Sydney, New South Wales,
Australia2
Received 13 November 1997/Accepted 16 February 1998
 |
ABSTRACT |
The 16S-23S spacer regions of two ribosomal operons
(rrnA and rrnE) have been sequenced in
seven representatives of the Salmonella enterica
subspecies. Isolated nucleotide substitutions were found at the same
sites as in Escherichia coli but the number of polymorphic sites was much larger, as could be expected for a more heterogeneous species. Still, as in E. coli, most of the variation found
was due to insertions and/or deletions affecting blocks of nucleotides generally located at equivalent regions of the putative secondary structure for both species. Isolated polymorphic sites generated phylogenetic trees generally consistent with the subspecies structure and the accepted relationships among the subspecies. However, the
sequences of rrnE put subspecies I closer to E. coli K-12 than to the other S. enterica subspecies.
The distribution of polymorphisms affecting blocks of nucleotides was
much more random, and the presence of equivalent sequences in distantly
related subspecies, and even in E. coli, could reflect
relatively frequent horizontal transfer. The smallest 16S-23S
spacers in other genera of the family Enterobacteriaceae
were also sequenced. As expected, the level of variation was much
larger. Still, the phylogenetic tree inferred is consistent with those
of 16S rRNA or housekeeping genes.
 |
INTRODUCTION |
Ribosomal operons have acquired
paramount relevance for the study of bacterial evolution and phylogeny.
The rRNA 16S and 23S genes are the most widely used molecular
chronometers for inferring microbial phylogeny and have been
instrumental in developing a comprehensive view of microbial phylogeny
and systematics (14). In most prokaryotes the ribosomal
genes form an operon with the order 16S-23S-5S and are cotranscribed in
a single polycistronic RNA that has to be processed to give the RNA
species present in the mature ribosome (8). The spacer
between the 16S and 23S genes is often called the internal spacer
region (ISR). These spacers contain regions with secondary structures
(6) and sometimes, very often in gram-negative bacteria,
tRNA genes. The number of ribosomal operons in bacteria varies between
1 and 11 (13). When there is more than one it is common that
they are not identical (intercistronic heterogeneity), particularly
regarding the ISR sequence (7, 9, 30). In Escherichia
coli K-12 and Salmonella enterica LT2 there are seven
operons located at equivalent loci in the genetic maps of the
chromosomes of each strain (21). In three of them the ISR
contains two tRNA genes (ISR2) for isoleucine and alanine (operons A,
D, and H in K-12 and A, D, and B in LT2) with an average size of about
450 bp. The remaining four (operons B, C, E, and G in K-12 and C, E, G,
and H in LT2) have a single tRNA gene for glutamic acid (ISR1) and are
consequently smaller (about 350 bp) (9).
The role of the spacer regions in the maturation of the polycistronic
rRNA is far from clear. Some regions have secondary structures with
stretches of canonical base pairing that are substrates for RNase III
cuts and separation of the gene products (26, 29). However,
the final stages in maturation, which include the trimming of the rRNAs
to their final size, take place in the assembling ribosomal subunit
with ribonucleoproteins as substrate. Here the interaction among the
precursor rRNA (containing stretches of the spacer still attached) and
the ribosomal proteins seems to be essential for proper processing.
The variation found among relatively close taxa is known to be very
high for the spacers of the rRNA operons (27). Even within
the
subclass of the class Proteobacteria, some species show hardly any similarity to E. coli. For example,
Haemophilus influenzae has only about 22 nucleotides
centered around the RNase III recognition site 3' to the 16S rRNA gene
and about 12 nucleotides at the equivalent site 5' to the 23S gene
which are highly similar to those of E. coli. The rest
of the spacer (except for the tRNA gene and the antiterminator called
box A [4]) is totally different in the two species. In
species of Pseudomonas only the last two sequences remain
similar (13). The extreme divergence in size and sequence of
the spacers among different groups of prokaryotes, together with their
location between highly conserved rRNA genes, makes them good markers
for bacterial classification, and their use in rapid, and even
automatic, identification has been suggested (3, 11, 13, 17,
20).
Recently (2), the ISR sequences of the seven operons of 12 representative strains of the E. coli reference (ECOR)
collection were studied, a group of strains encompassing much of
the phylogenetic diversity within this species (28, 31). The
variation was, however, very restricted. In fact, at the level of
single nucleotide substitutions, the degree of variation found for
these spacer regions is not very different from that found for the 16S
rRNA genes of the same strains (7, 23). The main source of
heterogeneity (both intercistronic and interstrain) was the presence of
insertions and/or deletions involving blocks of nucleotides. And most
of these were already present in K-12 as intercistronic heterogeneity. There was a clear tendency toward homogenization (less intercistronic heterogeneity) in most strains. However, some apparently infrequent variations, such as the rsl sequence (6),
maintained a widespread distribution, perhaps reflecting a horizontal
transfer and recombination that counteracts the homogenization trend.
These results represent an interesting problem of molecular evolution.
First, if this sequence has indeed little functional restriction, as
the great intergenic variation seems to indicate, greater variation
should be expected. And second, there seems to be a sharp change in the rate of variation within and between species that contrasts with the
relatively smooth gradient of variation found for the ribosomal genes.
To improve our understanding of the molecular evolution of these spacer
regions, we have studied their sequence in representatives of
S. enterica subspecies. Besides the location and tRNA
genes present (21) nothing was known about the S. enterica ISRs. After E. coli, S. enterica is probably the bacterial species best known at the level
of intraspecies variation and phylogeny (32). The structure
of the subspecies seems to be very robust; very diverse types of data,
from multilocus enzyme electrophoresis to sequencing of various genes,
give results coherent with the accepted subspecies structure
(5). Sequence data also point to a very preserved clonal
structure within this species. We have also sequenced some tRNAGlu-containing spacers of other members of the family
Enterobacteriaceae to scan the variation found for wider
phylogenetic gaps.
 |
MATERIALS AND METHODS |
Strains.
The S. enterica strains utilized
were obtained from different sources as described previously
(35). The S. enterica subspecies and strains
used were as follows: subspecies I, LT2 and M298; subspecies II, M495;
subspecies IIIa, M313; subspecies IIIb, M316; subspecies IV, M318 and
M320; subspecies V, M321; and subspecies VI, M324. Citrobacter
freundii OS60 (19), Enterobacter aerogenes E482 (19), Klebsiella pneumoniae LD119
(19), Escherichia blattae ATCC 29907, Escherichia hermannii ATCC 33650, Escherichia
vulneris ATCC 33821, and Escherichia fergusonii ATCC
35469 were kindly provided by J. G. Lawrence (Washington
University).
PCR primers.
To specifically amplify the ISRs of operons
rrnA and rrnE, two primers were designed located
in genes upstream of both operons in E. coli K-12. For
rrnA the primer TCTCAACAAGGGACGGACAA, which corresponds to nucleotide positions 20 to 39 in hemG of
E. coli K-12, was used. For rrnE the primer
used was TAATGGCATCGTCCTGGCCGC. This primer is derived from
positions 1322 to 1342 of purH. Universal primers 16S14F and
23S1R have been described elsewhere (12).
DNA extraction and PCR amplification.
One colony from a
fresh culture was resuspended in 200 µl of Instagene Purification
Matrix (Bio-Rad) in Eppendorf tubes. DNA was extracted following the
manufacturer's recommendations, and the DNA concentration was
estimated with a Gene Quant RNA/DNA calculator (Pharmacia LKB
Biochrom). For PCR the DNA concentration was adjusted to 20 ng/µl.
Amplification of specific rrn operons in S. enterica strains was carried out in two steps (nested PCR). Approximately 40 ng of chromosomal DNA was subjected to PCR
amplification in a total volume of 50 µl containing 50 mM KCl, 10 mM
Tris-HCl (pH 9.0), 1.5 mM MgCl, 0.1% Triton X-100, 0.2 mM (each)
deoxyribonucleotide (dATP, dCTP, dGTP, and dTTP; Pharmacia LKB
Biotechnology), 2 U of TaqPlus DNA polymerase (Stratagene),
and 50 to 60 pmol of each primer. For the first step,
rrn-specific primers were used in combination with 23S1R.
The reaction mixtures were subjected to a "touch down"
(10) thermal cycling regime which consisted of the
following: 3 cycles of 94°C for 15 s, 65°C for 30 s, and
72°C for 3 min; 3 cycles of 94°C for 15 s, 62°C for 30 s, and 72°C for 3 min; 3 cycles of 94°C for 15 s, 59°C for
30 s, and 72°C for 3 min; 3 cycles of 94°C for 15 s,
56°C for 30 s, and 72°C for 3 min; and 23 cycles of 94°C for
15 s, 55°C for 30 s, and 72°C for 3 min; followed by an
extension step at 72°C for 5 min. The amplicon from this reaction was
diluted 1:10,000 and submitted again to PCR with the universal primers
16S14F and 23S1R as follows: 35 cycles of 94°C for 15 s, 62°C
for 30 s, and 72°C for 1 min plus an extension step of 5 min at
72°C. For all other strains of Enterobacteriaceae only the
second PCR protocol was carried out followed by cloning. All reactions
were carried out in a PTC-100 Peltier effect thermocycler (MJ Research
Inc.). The PCR products were separated in 1% agarose gels in
Tris-acetate-EDTA buffer, stained with 0.5 µg of ethidium bromide,
and visualized with UV.
Purification of the PCR products.
PCR products were purified
with the QIAquick PCR Purification Kit (Qiagen) according to the
manufacturer's protocol. The DNA was recovered in 30 µl of water and
diluted to a concentration between 0.3 and 0.5 µg/µl.
Cloning of Enterobacteriaceae PCR products.
For
the Enterobacteriaceae other than S. enterica no operon-specific primers were used, and therefore all
the operons were amplified simultaneously. The PCR product was cloned
using the original TA Cloning Kit (Invitrogen) following the
manufacturer's recommendations. From each PCR product 20 colonies were
picked and grown in Luria Bertani medium at 37°C for 18 h.
Recombinant plasmids were extracted by using the QIAprep Spin Miniprep
Kit (Qiagen) following the manufacturer's recommendations. The
purified plasmids were digested with EcoRI to separate the
insert, and the product was run in agarose gels to determine insert
size. For each strain one clone containing the smallest insert was
selected for sequencing.
Sequencing of 16S-23S ISR.
Nucleotide sequences of PCR
products and plasmids were determined by using the ABI PRISM Dye
Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer) and an
ABI PRISM 377 sequencer (Perkin-Elmer) according to the manufacturer's
indications. The 16S14F and 23S1R primers were used as sequencing
primers in all cases. For every PCR product both strains were sequenced
and every sequence was repeated at least twice.
Data analysis.
Sequences were aligned by using the PCGene
program (IntelliGenetics Inc.). All other analyses were done using
the MEGA (Molecular Evolutionary Genetics Analysis) 1.01 program
obtained from the Institute of Molecular Evolutionary Genetics, The
Pennsylvania State University, University Park, Pa.
Nucleotide sequence accession numbers.
S.
enterica sequences determined here were assigned GenBank accession
numbers AFO45563 and AFO46806 to AFO46822; representatives of other
Enterobacteriaceae were assigned accession numbers AFO47420 to AFO47426.
 |
RESULTS |
We have sequenced the S. enterica rrnA and
rrnE operons as defined by the upstream sequences found in
E. coli K-12. However, except for LT2, we have no
direct evidence about the location of the operons in the genomic map of
the strains studied. In fact, for Salmonella typhi a
highly plastic chromosomal organization has been previously described
(22). In E. coli strains the general organization of the rrn operons in the genome seems to be
quite conserved. Not only is the combination of four ISR1- and three ISR2-containing operons kept throughout the ECOR collection but the
type of operon (as defined by the tRNA genes in the ISR) present at
each locus is also highly conserved (2). However, in
S. enterica there seems to be variation at this level.
LT2 has an ISR1 present in rrnE and an ISR2 in
rrnA. However, in M313 (subspecies IIIa) and M318 and M320
(both subspecies IV) the primer for rrnA gave operons with
ISR1 present. It is possible that, in these three strains, a
two-tRNA-containing operon was present at another locus to keep the
four ISR1- and three ISR2-containing operon distribution found in
E. coli and LT2. However, in all these strains the
operon present at the rrnE locus was an ISR1 as well. When an ISR1 was retrieved with the primer for rrnA the sequence
found was very similar to the rrnE sequence determined for
the same strain. Specifically, in M313 and M318 the two ISR1 sequences differed by only 6 and 1 nucleotides, respectively. In M320 the ISR1
obtained with the primer for rrnA differed in 4 aligned
nucleotides but lacked two of the insertions found in the ISR1 of
rrnE (see below). That does not necessarily mean that the
ISR1 spacers present at the putative rrnA locus derive from
the rrnE operon, since, at least in E. coli,
intercistronic heterogeneity in many strains is low (2) and
any of the ISR1-containing operons could have a sequence very similar
to that of rrnE. To simplify the terminology the ISRs
obtained with the rrnE and rrnA primers are
identified in the text and figures by the letters E and A,
respectively, and the strain designation.
Variability among the ISR1 operons.
The alignment of the ISR1
operons (containing a single tRNA gene) is shown in Fig.
1. Figure 1 includes the
nine sequences retrieved from the strains with the primers designed for
rrnE as well as three sequences obtained with the primers
for operon rrnA. Two types of sequence variation were found.
One variation affected aligned residues only and was used to analyze
level of divergence and to infer relationships. The other involves
insertions and/or deletions or block substitutions and will be
discussed separately (see below). The polymorphic nucleotides of ISR1
and their relation to the secondary structure are shown in Fig.
2. In the S. enterica
ISR1s that were retrieved the maximum pairwise nucleotide divergence
was 18% and the average divergence was 9.8%. This is about three
times higher than that found for the rrnE operon in
E. coli (2.6%) (2), perhaps reflecting the
wider phylogenetic span (genetic variability) included in S. enterica (25). Although the number of polymorphic sites
is much larger in the ISR1 spacers of S. enterica, the
variation in this region, similar to that of E. coli,
is rather restricted and is concentrated at some hypervariable sites,
including those already detected in E. coli. For the 70 nucleotides downstream of the 16S rRNA gene, in addition to the 8 polymorphic sites which are also present in E. coli
(2), S. enterica strains have 14 additional
polymorphic sites (a total of 22 polymorphic sites).

View larger version (53K):
[in this window]
[in a new window]

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of the nucleotide sequences of ISR1 and ISR2
spacers. Letters (A and E) indicate the specific primers (for
rrnA and rrnE, respectively) used for the PCR
amplification of the sequences. The numbers indicate the strains, and
the roman numerals in parentheses indicate the subspecies to which each
strain belongs. K-12 rrnE was been used as the reference
strain. Nucleotides conserved in all Enterobacteriaceae
studied here are labelled with an asterisk. The variable region between
tRNAIle and tRNAAla of the ISR2 spacers is
shown as shaded or in boldface or italics to indicate each of the three
types of sequence found. Box A is underlined.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
Secondary structure of the rrnE ISR of
S. enterica LT2 based on the model suggested by Brosius
et al. (6). Variable positions in the S. enterica strains studied are indicated by circles. Block
substitutions and insertions are boxed. B and C boxes show alternative
sequences found in some operons and strains and putative secondary
structures. The ends of the 16S and 23S rRNAs and tRNA genes are
shaded. RNase III cutting sites are indicated (RIII).
Dashed arrows indicate pairs of direct repeats.
|
|
A phylogenetic tree constructed by the neighbor-joining method and
comparing the ISR1 sequences retrieved is shown in Fig.
3. The main clusters reflect the
subspecies structure and are
generally concordant with a tree of three
housekeeping (HK) genes
(
5). Subspecies I, VI, II, IV, and
IIIb form a cluster as do
the five HK genes studied by Boyd et al.
(
5), and subspecies
V and IIIa appear clearly distant from
the rest, which is also
the case for the HK gene tree. Some sequences
found in
S. enterica,
such as those of E298 and ELT2,
are more similar to
rrnE of
E. coli K-12
than they are to other
S. enterica strains.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 3.
Dendrogram based on ISR1 sequences showing the
relationships among E. coli K-12 and representatives of
S. enterica subspecies. The tree was constructed by the
neighbor-joining method. Boot-strap values were calculated from 500 trees. Each number on a branch indicates the percentage of trees in
which the node was supported. Bar, percent sequence divergence.
|
|
As found in
E. coli rrn operons, there are
polymorphisms clustered in hypervariable regions in which substitutions
affecting
blocks of nucleotides occur, sometimes with insertions and
deletions
of highly variable lengths. At positions 66 to 86 (Fig.
1 and
2), some
E. coli ISR1-containing operons present the
rsl sequence
(
6), an insertion of 106 nucleotides. In the
S. enterica strains
studied the
last 10 nucleotides are highly polymorphic, although
all the
alternative sequences found were of equivalent length,
similar to that
of the
E. coli ISR1 without the
rsl
sequence.
The second of such variable regions is located downstream
from
the tRNA
Glu gene and corresponds to an insertion found
previously in
rrnE and
rrnC of ECOR 40 (
2) which contains a perfect direct repeat
of the last 11 bases of the tRNA
Glu gene (Fig.
2). Sequences A318, E318,
E320 (all representatives
of subspecies IV), and ELT2 (subspecies I)
have this insertion.
In nucleotides 234 to 274 there is a secondary
structure loop
(Fig.
2) that has been shown to be hypervariable in
E. coli (
2,
12,
16), in which species there
are at least three versions
which have little similarity to one another
except that each maintains
the same size and general structure of the
loop (
2). In the
strains of
S. enterica
studied the version found in ECOR 35 and
ECOR 40 predominates; E321 has
a version that is almost identical
to version I (
2) of
E. coli, which is present in most operons
and strains
in this species. ISRs A318, E318, and E320 have yet
another different
and longer loop (box B in Fig.
2) that has not
been found in
E. coli. The secondary structure loop from nucleotide
307 to nucleotide 338 (Fig.
2) concentrates 18 polymorphisms with
most
strains diverging widely from the sequence found in
E. coli and the two representatives of subspecies I. Finally, the
region
downstream from nucleotide 358 is also highly polymorphic. In
E. coli there are two alternative versions of 17 and 8 nucleotides
depending on the strains and operons (
2). In
S. enterica two
ISRs, ELT2 and E298, had sequences very
similar to the 17-mer
version of
E. coli (the most
abundant in this species). Two ISRs,
E495 and E316, had a large
insertion of approximately 145 bp occupying
this region. This insertion
could form a long secondary structure
loop (Fig.
2). The rest (E324,
A313, E313, E321, A318, E318, E320,
and A320) all have a stretch of 10 bp vaguely reminiscent of the
octamer found in a few strains of
E. coli.
Most polymorphisms, particularly those affecting clusters of
nucleotides, are located outside the regions that are involved
in
secondary structure with nucleotide stretches upstream or downstream
of
the 16S or 23S gene, respectively, in the transcript (Fig.
2). This is
understandable considering the role of these regions
as RNase III
targets and the requirements for concerted variation
with regions
distantly located in the operon.
Variability among the ISR2.
The rrnA-specific
PCR primer generated amplicons with an ISR2 (containing
tRNAIle and tRNAAla genes) only in
six of the nine strains studied here. Therefore, the alignment of the
sequences for the ISR2-containing operons shown in Fig. 1 comprises
only 6 S. enterica sequences plus the sequence for the
E. coli K-12 rrnA operon included for
comparison. The ISR2-containing operons obtained have very little
sequence diversity for the 150-odd bases that comprise the
tRNAIle plus the 70 bp located upstream from this gene.
This region is also very similar to the E. coli
ISR2-containing operons. Downstream from the tRNAIle,
variability is very high, and in fact, this stretch in all the S. enterica strains diverged considerably from that in
E. coli, in which all the strains and operons studied
have an identical sequence of 43 bp (2). In S. enterica this stretch, i.e., downstream from the
tRNAile, is much larger in all strains (about 120 bp).
Among the six strains of Salmonella studied, four (LT2 and
M298, both subspecies I; M495, subspecies II; and M321, subspecies V)
had nearly identical sequences (one nucleotide different) of 112 bp.
M324 (subspecies VI) and M316 (subspecies IIIb) had stretches of 111 and 114 bp, respectively, but with widely divergent sequences. The
three types of sequence have little in common except overall length and
the first 5 and last 11 nucleotides. A316 is different throughout the
whole sequence, while A324 differs mostly in the first 50 nucleotides
of this stretch, being for the last 60-odd bases identical to that of
ALT2 and the other sequences. Downstream of the tRNAAla
there is little heterogeneity at the level of isolated nucleotide substitutions, and again the sequence is rather similar to that of
E. coli. The hypervariable loop located near the 5' end
of the 23S gene (Fig. 2, box C) is also present in the ISR2 spacers. Here the variability is extremely high to the point that none of
the sequences determined was identical to any of the others. ALT2,
A298, and A316 have 20-mer stretches that are highly similar to the
19-mer stretch found in rrnE in E. coli
K-12. A321 has a long loop similar to that which was also found in this
region in E316 and E495 (both ISR1). A495 has a very short stretch of 7 bp, again with a completely different sequence from that found in the
rrnA operon of E. coli K-12. Finally, A324
has still another sequence of 11 bp, which is similar to the sequence
present in rrnA of K-12.
ISR1 spacers in other Enterobacteriaceae.
To get an
impression of how the spacer sequence varies with increasing
phylogenetic distance, we sequenced the smallest ISRs present in the
ribosomal operons of seven strains of different species of
Enterobacteriaceae. In fact operons belonging to C. freundii and Enterobacter aerogenes had spacers of 235 and 198 bp, respectively, that did not contain a tRNA gene and thus
cannot be considered functionally equivalent to the other ribosomal
operons. A tree which compares these sequences with those of
rrnE of E. coli K-12 and S. enterica LT2 is shown in Fig. 4. The
conserved positions for all the Enterobacteriaceae studied
are shown in Fig. 1. Only the regions around the RNase III recognition
site and box A are conserved for all of the species studied. Generally speaking, the clustering was similar to that developed from other gene
comparisons (1, 19, 32). Escherichia fergusonii
is a sister species to E. coli, and S. enterica appears as its closest relative in the ISR1 tree. These
relationships are also evident in a comparison of HK genes. K. pneumoniae and E. vulneris form a cluster that
also appears in a phylogenetic tree generated by comparing
gapA and ompA genes (19). At the level
of the ISR1 this cluster is already widely divergent.
Klebsiella is the closest genus to E. coli
and Salmonella by 16S rRNA sequence (1).
E. blattae and E. hermannii are very
divergent, which is consistent with the genus Escherichia
being polyphyletic as has been shown by other authors (19).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 4.
Dendrogram based on the sequence of the smallest
ISRs-present in the rrn operons of different
Enterobacteriaceae. Computation and bar are as described in
the legend to Fig. 3.
|
|
 |
DISCUSSION |
The relative lack of functional restriction of the rRNA operon
spacers would make us expect a rather high level of sequence variation.
Still, some data in the literature hints at unexpected levels of
conservation in other spacer sequences. For example, in the classical
studies by Milkman and coworkers of the trp operon of
E. coli (24, 34) there is information
showing that the variation in the noncoding areas is similar to, or
only slightly higher than, that in the coding ones; the main difference
was that in the coding areas the variation seemed to concentrate on the
third base of each codon (silent mutations). If the noncoding or spacer
areas of the bacterial genomes really are devoid of function, something
that is by no means certain, it could be considered an argument in
favor of the neutral hypothesis for molecular evolution (18), i.e., if variation is found with similar frequencies
in functional and nonfunctional regions it could be because most of it
is neutral.
Altogether, the results of this work strengthen the view based on a
previous work with E. coli (2) in the sense
that, at the level of isolated nucleotide substitutions, the ISRs do
not differ so much from the rRNA genes themselves. The main difference is the presence of relatively large insertions and/or deletions. These
drastically alter the primary structure of the spacer sequence and in
the long run can probably also affect the secondary structure and even
the function of the different regions of the spacer DNA. This
phenomenon is by no means exclusive to the ISR sequences. For example,
the spacer between the genes rpsU and dnaG only
varies in 15 of 108 alignable nucleotides between E. coli K-12 and S. enterica LT2 (33).
However, in S. enterica there is an insertion of 120 bp
that is not present in E. coli. Other bacterial species have been shown to differ due to insertion and/or deletion events affecting the central region of the rrn spacer (12,
36). Since it appears that the size of the spacer must vary
within certain limits, it is foreseeable that the accumulation of
insertions could eventually lead to deletions affecting other areas and
thus to the gradual substitution of the overall spacer sequence, as is
found when relatively wide phylogenetic distances are analyzed at this
level.
The phylogeny generated by the ISR1 sequences is roughly consistent
with that of 16S rRNA or housekeeping genes in
Enterobacteriaceae, as has been shown for other bacterial
groups (20). However, the distribution of clustered
polymorphisms did not form a coherent picture with any of the
relationship trees inferred from HK sequences or multilocus enzyme
electrophoresis. Even the barrier between the two main clusters of
S. enterica subspecies, i.e., subspecies IIIa and V and
subspecies I, II, IIIb, IV, and VI, appears inconsistent with the
distribution of some of the polymorphisms. For example, the long loop
of box C (Fig. 2) is found in M316 (subspecies IIIb) and M495
(subspecies II) and a similar loop is present in the ISR2 of M321
(subspecies V). The same applies to the sequence located between the
two tRNA genes in ISR2 of A321 (subspecies V) that is also present in a
representative of subspecies II (A495) and in those of subspecies I
(LT2 and A298). The presence of some of these sequences in relatively
separated lineages of S. enterica and even
E. coli hints at a relatively widespread horizontal
transfer and recombination within and between species. In a previous
work (2) a model was suggested in which two opposing forces
act upon the rrn operons. Homogenization processes would
lead to little intercistronic heterogeneity and conservation of the
operon sequence. On the other hand, horizontal transfer from other
strains (that homogenize different versions of the operon sequence),
followed by recombination, acts as a continuous source of variation and intercistronic heterogeneity. The diversity found in the different operons and strains results from the equilibrium between these two
opposed processes (2). In S. enterica
recombination seems to be even more widespread, acting among different
subspecies and perhaps even species (E. coli).
It is remarkable that in terms of the ISR1 sequences there is no sharp
discrimination between E. coli and S. enterica, i.e., some sequences found in S. enterica are more similar to E. coli than they are
to other Salmonella strains. The main difference between the
two species was found in the inter-tRNA gene stretch of the ISR2
spacers. Otherwise it would be difficult to delimit both species as
separate entities by ISR sequences. For example, E298 (subspecies I)
has only 19 nucleotide differences from the rrnE gene of
K-12, which is much less than the number of nucleotide differences
found for the rrnE gene of some strains of E. coli (2) or those between the rrnE of E289
and other ISR1s of S. enterica strains. As shown in
Fig. 1 the subspecies II (M495) and subspecies I (M298 and LT2)
representatives have, over most of the ISR1, an E. coli-like sequence, although LT2 and E495 have Salmonella features like the sequence downstream of
TRNAGlu found in ELT2 or the insertion of box C (Fig. 2) in
E495. This mosaic-like structure is normally attributed to
recombination, although the possibility of these features corresponding
to ancestral traits cannot be totally disregarded.
On the other hand, the average (most frequent bases at polymorphic
sites) sequence found in S. enterica is significantly
different from the average sequence in E. coli. This
can be interpreted as indicating that both species are linked by a
continuum of diversity rather than having the sharp discontinuity
expected for sexual and isolated populations (15).
 |
ACKNOWLEDGMENTS |
Financial support was from CICYT PM95-0111 to F.R.-V. and from
the Australian Research Council to P.R.R. Part of the work was carried
out while F.R.-V. was a Visiting Academic at the Department of
Microbiology, The University of Sydney, supported by a Generalitat Valenciana scholarship.
We are grateful to K. Hernández for secretarial assistance and
S. Ingham for graphics.
 |
FOOTNOTES |
*
Corresponding author. Present address: Unidad de
Microbiologia, Centro de Biología Molecular y Celular, Campus
de San Juan, Apartado 18, 03550 San Juan, Alicante, Spain. Phone: 34 6 5919451. Fax: 34 6 5919457. E-mail: FRVALERA{at}UMH.ES.
 |
REFERENCES |
| 1.
|
Ahmad, S,
W. G. Weisburg, and R. A. Jensen.
1990.
Evolution of aromatic amino acid biosynthesis and application to the fine-tuned phylogenetic positioning of enteric bacteria.
J. Bacteriol.
172:1051-1061[Abstract/Free Full Text].
|
| 2.
| Antón, A. I., A. J. Martínez-Murcia, and F. Rodríguez-Valera. Sequence
diversity in the 16S-23S intergenic spacer region (ISR) of the rRNA
operons in representatives of the Escherichia coli ECOR
collection. J. Mol. Evol., in press.
|
| 3.
|
Barry, T.,
G. Colleran,
M. Glennon,
L. K. Dunican, and P. Gannon.
1991.
The 16S/23S ribosomal spacer region as target for DNA probes to identify eubacteria.
PCR Methods Appl.
1:51-56[Medline].
|
| 4.
|
Berg, K. L.,
C. Squires, and C. L. Squires.
1989.
Ribosomal RNA operon anti-termination function of leader and spacer region box B-box A sequences and their conservation in diverse microorganisms.
J. Mol. Biol.
209:345-358[Medline].
|
| 5.
|
Boyd, E. F.,
F.-S. Wang,
T. S. Whittam, and R. K. Selander.
1996.
Molecular genetic relationships of the salmonellae.
Appl. Environ. Microbiol.
62:804-808[Abstract].
|
| 6.
|
Brosius, J.,
T. J. Dull,
D. D. Sleeter, and H. F. Noller.
1981.
Gene organization and primary structure of a ribosomal RNA operon from Escherichia coli.
J. Mol. Biol.
148:107-127[Medline].
|
| 7.
|
Cilia, V.,
B. Lafay, and R. Christen.
1996.
Sequence heterogeneities among 16S ribosomal RNA sequences and their effect on phylogenetic analyses at the species level.
Mol. Biol. Evol.
13:451-461[Abstract].
|
| 8.
|
Condon, C.,
J. Philips,
A. Fu,
C. Squires, and C. L. Squires.
1992.
Comparison of the expression of the seven ribosomal RNA operons in Escherichia coli.
EMBO J.
11:4175-4185[Medline].
|
| 9.
|
Condon, C.,
C. Squires, and C. L. Squires.
1995.
Control of rRNA transcription in Escherichia coli.
Microbiol. Rev.
59:623-645[Abstract/Free Full Text].
|
| 10.
|
Don, R. H.,
P. T. Cox,
B. J. Wainwright,
K. Baker, and J. S. Mattick.
1991.
`Touchdown' PCR to circumvent spurious priming during gene amplification.
Nucleic Acids Res.
19:4008[Free Full Text].
|
| 11.
|
García-Martínez, J.,
A. J. Martínez-Murcia,
F. Rodríguez-Valera, and A. Zorraquino.
1996.
Molecular evidence supporting the existence of two major groups in uropathogenic Escherichia coli.
FEMS Immunol. Med. Microbiol.
14:231-244[Medline].
|
| 12.
|
Gürtler, V., and H. D. Barrie.
1995.
Typing of Staphylococcus aureus strains by PCR-amplification of variable-length 16S-23S rDNA spacer regions: characterization of spacer sequences.
Microbiology
141:1255-1265[Abstract/Free Full Text].
|
| 13.
|
Gürtler, V., and V. A. Stanisich.
1996.
New approaches to typing and identification of bacteria using the 16S-23S rDNA spacer region.
Microbiology
142:3-16[Free Full Text].
|
| 14.
|
Gutell, R. R.,
N. Larsen, and C. R. Woese.
1994.
Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective.
Microbiol. Rev.
58:10-26[Abstract/Free Full Text].
|
| 15.
|
Guttman, D. S., and D. E. Dykhuizen.
1994.
Clonal divergence in Escherichia coli as a result of recombination, not mutation.
Science
266:1380-1383[Abstract/Free Full Text].
|
| 16.
|
Harvey, S.,
C. W. Hill,
C. Squires, and C. L. Squires.
1988.
Loss of the spacer loop sequence from the rrnB operon in the Escherichia coli K12 subline that bears the relA1 mutation.
J. Bacteriol.
170:1235-1238[Abstract/Free Full Text].
|
| 17.
|
Jensen, M. A.,
J. A. Webster, and N. Straus.
1993.
Rapid identification of bacteria on the basis of polymerase chain reaction-amplified ribosomal DNA spacer polymorphisms.
Appl. Environ. Microbiol.
59:945-952[Abstract/Free Full Text].
|
| 18.
|
Kimura, M.
1983.
.
The neutral theory of molecular evolution.
Cambridge University Press, London, United Kingdom.
|
| 19.
|
Lawrence, J. G.,
H. Ochman, and D. L. Hartl.
1991.
Molecular and evolutionary relationships among enteric bacteria.
J. Gen. Microbiol.
137:1911-1921[Abstract/Free Full Text].
|
| 20.
|
Leblond-Bourget, N.,
H. Philippe,
I. Mangin, and B. Decaris.
1996.
16S rRNA and 16S to 23S internal transcribed spacer sequence analyses reveal inter- and intraspecific Bifidobacterium phylogeny.
Int. J. Syst. Bacteriol.
46:102-111[Abstract/Free Full Text].
|
| 21.
|
Lehner, A. F.,
S. Harvey, and C. W. Hill.
1984.
Mapping and spacer identification of rRNA operons of Salmonella typhimurium.
J. Bacteriol.
160:682-686[Abstract/Free Full Text].
|
| 22.
|
Liu, S.-H., and K. E. Sanderson.
1996.
Highly plastic chromosomal organization in Salmonella typhi.
Proc. Natl. Acad. Sci. USA
93:10303-10308[Abstract/Free Full Text].
|
| 23.
| Martinez-Murcia, A. J., A. I. Antón, and
F. Rodríguez-Valera. Concerted evolution by homogenization
of the rRNA multigene family may induce sequence convergences
responsible for chronometric distortions and conflicting phylogenetic
trees. Submitted for publication.
|
| 24.
|
Milkman, R., and M. M. Bridges.
1993.
Molecular evolution of the Escherichia coli chromosome. IV. Sequence comparisons.
Genetics
133:455-468[Abstract].
|
| 25.
|
Nelson, K.,
T. S. Whittam, and R. K. Selander.
1991.
Nucleotide polymorphism and evolution in the glyceraldehyde-3-phosphate dehydrogenase gene (gapA) in natural populations of Salmonella and Escherichia coli.
Proc. Natl. Acad. Sci. USA
88:6667-6671[Abstract/Free Full Text].
|
| 26.
|
Noller, H., and M. Nomura.
1996.
Ribosomes, p. 167-186. In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed.
ASM Press, Washington, D.C.
|
| 27.
|
Normand, P.,
C. Ponsonnet,
X. Nesme,
M. Neyra, and P. Simonet.
1996.
ITS analysis of prokaryotes., p. 1-12. In
A. D. L. Akkermans, J. D. van Elsas, and F. J. de Bruijn (ed.), Molecular microbial ecology manual.
Kluwer Academic Publishers, Norwell, Mass.
|
| 28.
|
Ochman, H., and R. K. Selander.
1984.
Standard reference strains of Escherichia coli from natural populations.
J. Bacteriol.
157:690-693[Abstract/Free Full Text].
|
| 29.
|
Pace, N. R., and A. B. Burgin.
1990.
Processing and evolution of the rRNAs, p. 417-425. In
W. E. Hill, A. Dahlberg, R. A. Garrett, P. B. Moore, D. Schlessinger, and J. R. Warner (ed.), The ribosome. Structure, function, & evolution.
American Society for Microbiology, Washington, D.C.
|
| 30.
|
Sechi, L. A., and L. Daneo-Moore.
1993.
Characterization of intergenic spacers in two rrn operons of Enterococcus hirae ATCC 9790.
J. Bacteriol.
175:3213-3219[Abstract/Free Full Text].
|
| 31.
|
Selander, R. K.,
D. A. Cougant, and T. S. Whittam.
1987.
Genetic structure and variation in natural populations of Escherichia coli, p. 1625-1648. In
F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology.
American Society for Microbiology, Washington, D.C.
|
| 32.
|
Selander, R. K.,
J. Li,
E. F. Boyd,
F.-S. Wang, and K. Nelson.
1994.
DNA sequence analysis of the genetic structure of populations of Salmonella enterica and Escherichia coli. In F. G. Priest, A. Ramos-Cormenzana, and B. J. Tindall (ed.).
Bacterial diversity and systematics.
Plenum Press, New York, N.Y.
|
| 33.
|
Sharp, P. M.
1991.
Determinants of DNA sequence divergence between Escherichia coli and Salmonella typhimurium: codon usage, map position, and concerted evolution.
J. Mol. Evol.
33:23-33[Medline].
|
| 34.
|
Stolzfus, A.,
J. F. Leslie, and R. Milkman.
1988.
Molecular evolution of the Escherichia coli chromosome. I. Analysis of structure and natural variation in a previously uncharacterized region between trp and tonB.
Genetics
120:345-358[Abstract/Free Full Text].
|
| 35.
|
Thampapillai, G.,
R. Lan, and P. R. Reeves.
1994.
Molecular evolution in the gnd locus of Salmonella enterica.
Mol. Biol. Evol.
11:813-828[Abstract].
|
| 36.
|
Whiley, R. A.,
B. Duke,
J. M. Hardie, and L. M. C. Hall.
1995.
Heterogeneity among 16S-23S rRNA intergenic spacers of species within the `Streptococcus miller group.'
Microbiology
141:1461-1467[Abstract/Free Full Text].
|
J Bacteriol, April 1998, p. 2144-2151, Vol. 180, No. 8
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Walk, S. T., Alm, E. W., Gordon, D. M., Ram, J. L., Toranzos, G. A., Tiedje, J. M., Whittam, T. S.
(2009). Cryptic Lineages of the Genus Escherichia. Appl. Environ. Microbiol.
75: 6534-6544
[Abstract]
[Full Text]
-
Wang, M., Cao, B., Gao, Q., Sun, Y., Liu, P., Feng, L., Wang, L.
(2009). Detection of Enterobacter sakazakii and Other Pathogens Associated with Infant Formula Powder by Use of a DNA Microarray. J. Clin. Microbiol.
47: 3178-3184
[Abstract]
[Full Text]
-
Wang, M., Cao, B., Yu, Q., Liu, L., Gao, Q., Wang, L., Feng, L.
(2008). Analysis of the 16S-23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species. J. Clin. Microbiol.
46: 3555-3563
[Abstract]
[Full Text]
-
Sadeghifard, N., Gurtler, V., Beer, M., Seviour, R. J.
(2006). The Mosaic Nature of Intergenic 16S-23S rRNA Spacer Regions Suggests rRNA Operon Copy Number Variation in Clostridium difficile Strains. Appl. Environ. Microbiol.
72: 7311-7323
[Abstract]
[Full Text]
-
Danovaro, R., Luna, G. M., Dell'Anno, A., Pietrangeli, B.
(2006). Comparison of Two Fingerprinting Techniques, Terminal Restriction Fragment Length Polymorphism and Automated Ribosomal Intergenic Spacer Analysis, for Determination of Bacterial Diversity in Aquatic Environments. Appl. Environ. Microbiol.
72: 5982-5989
[Abstract]
[Full Text]
-
Osorio, C. R., Collins, M. D., Romalde, J. L., Toranzo, A. E.
(2005). Variation in 16S-23S rRNA Intergenic Spacer Regions in Photobacterium damselae: a Mosaic-Like Structure. Appl. Environ. Microbiol.
71: 636-645
[Abstract]
[Full Text]
-
Boucher, Y., Douady, C. J., Sharma, A. K., Kamekura, M., Doolittle, W. F.
(2004). Intragenomic Heterogeneity and Intergenomic Recombination among Haloarchaeal rRNA Genes. J. Bacteriol.
186: 3980-3990
[Abstract]
[Full Text]
-
Ventura, M., Zink, R.
(2002). Rapid Identification, Differentiation, and Proposed New Taxonomic Classification of Bifidobacterium lactis. Appl. Environ. Microbiol.
68: 6429-6434
[Abstract]
[Full Text]
-
Kabadjova, P., Dousset, X., Le Cam, V., Prevost, H.
(2002). Differentiation of Closely Related Carnobacterium Food Isolates Based on 16S-23S Ribosomal DNA Intergenic Spacer Region Polymorphism. Appl. Environ. Microbiol.
68: 5358-5366
[Abstract]
[Full Text]
-
Moreno, C., Romero, J., Espejo, R. T.
(2002). Polymorphism in repeated 16S rRNA genes is a common property of type strains and environmental isolates of the genus Vibrio. Microbiology
148: 1233-1239
[Abstract]
[Full Text]
-
Wenner, T., Roth, V., Decaris, B., Leblond, P.
(2002). Intragenomic and intraspecific polymorphism of the 16S-23S rDNA internally transcribed sequences of Streptomyces ambofaciens. Microbiology
148: 633-642
[Abstract]
[Full Text]
-
Garcia-Martinez, J., Bescos, I., Rodriguez-Sala, J. J., Rodriguez-Valera, F.
(2001). RISSC: a novel database for ribosomal 16S-23S RNA genes spacer regions. Nucleic Acids Res
29: 178-180
[Abstract]
[Full Text]
-
Baudart, J., Lemarchand, K., Brisabois, A., Lebaron, P.
(2000). Diversity of Salmonella Strains Isolated from the Aquatic Environment as Determined by Serotyping and Amplification of the Ribosomal DNA Spacer Regions. Appl. Environ. Microbiol.
66: 1544-1552
[Abstract]
[Full Text]
-
Pabbaraju, K., Miller, W. L., Sanderson, K. E.
(2000). Distribution of Intervening Sequences in the Genes for 23S rRNA and rRNA Fragmentation among Strains of the Salmonella Reference Collection B (SARB) and SARC Sets. J. Bacteriol.
182: 1923-1929
[Abstract]
[Full Text]
-
Chun, J., Huq, A., Colwell, R. R.
(1999). Analysis of 16S-23S rRNA Intergenic Spacer Regions of Vibrio cholerae and Vibrio mimicus. Appl. Environ. Microbiol.
65: 2202-2208
[Abstract]
[Full Text]
-
Antón, A. I., Martínez-Murcia, A. J., Rodríguez-Valera, F.
(1999). Intraspecific Diversity of the 23S rRNA Gene and the Spacer Region Downstream in Escherichia coli. J. Bacteriol.
181: 2703-2709
[Abstract]
[Full Text]
-
Hinrikson, H. P., Dutly, F., Altwegg, M.
(1999). Homogeneity of 16S-23S Ribosomal Intergenic Spacer Regions of Tropheryma whippelii in Swiss Patients with Whipple's Disease. J. Clin. Microbiol.
37: 152-156
[Abstract]
[Full Text]