Previous Article | Next Article 
J Bacteriol, April 1998, p. 2175-2185, Vol. 180, No. 8
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
A Membrane-Associated Protein, FliX, Is Required
for an Early Step in Caulobacter Flagellar
Assembly
Christian D.
Mohr,*
Joanna K.
MacKichan, and
Lucy
Shapiro
Department of Developmental Biology, Beckman
Center, Stanford University School of Medicine, Stanford,
California 94305-5427
Received 17 November 1997/Accepted 17 February 1998
 |
ABSTRACT |
The ordered assembly of the Caulobacter crescentus
flagellum is accomplished in part through the organization of the
flagellar structural genes in a regulatory hierarachy of four classes.
Class II genes are the earliest to be expressed and are activated at a
specific time in the cell cycle by the CtrA response regulator. In
order to identify gene products required for early events in flagellar
assembly, we used the known phenotypes of class II mutants to identify
new class II flagellar genes. In this report we describe the isolation
and characterization of a flagellar gene, fliX. A
fliX null mutant is nonmotile, lacks a flagellum, and
exhibits a marked cell division defect. Epistasis experiments placed
fliX within class II of the flagellar regulatory hierarchy,
suggesting that FliX functions at an early stage in flagellar assembly.
The fliX gene encodes a 15-kDa protein with a putative
N-terminal signal sequence. Expression of fliX is under
cell cycle control, with transcription beginning relatively early in
the cell cycle and peaking in Caulobacter predivisional
cells. Full expression of fliX was found to be dependent on
ctrA, and DNase I footprinting analysis demonstrated a
direct interaction between CtrA and the fliX promoter. The
fliX gene is located upstream and is divergently transcribed from the class III flagellar gene flgI, which
encodes the basal body P-ring monomer. Analysis of the
fliX-flgI intergenic region revealed an arrangement of
cis-acting elements similar to that of another set of
Caulobacter class II and class III flagellar genes,
fliL-flgF, that is also divergently transcribed. In
parallel with the FliL protein, FliX copurifies with the membrane
fraction, and although its expression is cell cycle controlled, the
protein is present throughout the cell cycle.
 |
INTRODUCTION |
Midway through the
Caulobacter cell cycle, the transcription of a cascade of
flagellar genes is initiated, culminating in the construction of a
single flagellum at one pole of a predivisional cell. The flagellum is
comprised of three subassemblies (Fig. 1). The basal body, the most complex
subassembly, spans the cell envelope and consists of (i) a compound
ring in the inner membrane that is part of the flagellar motor, (ii) a
rod that spans the cell wall, and (iii) stabilizing rings. The other
subassemblies are a cell surface-associated hook and a long
extracellular filament. Assembly of the substructures occurs in a
cell-proximal-to-cell-distal order, accomplished, in part, by the
organization of the flagellar structural genes in a regulatory
hierarachy of four classes (6, 8, 34, 36, 55). The temporal
expression of these classes of genes reflects the order in which the
gene products are assembled into the growing structure (10, 21,
45).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1.
Diagram of the C. crescentus flagellum. The
name of each structure is accompanied by its gene designation(s). The
structure of the C-ring complex is adapted from that proposed for the
Salmonella typhimurium basal body (18). The genes
encoding structural proteins are grouped into one of the three known
flagellar gene classes (II, III, and IV), which together comprise the
flagellar regulatory hierarchy (6, 8, 34, 55). Arrows
indicate positive regulation (+) in which the transcription of genes
within a class requires the expression of the gene products of the
preceding class. The regulatory cascade is initiated by the class I
gene product, CtrA, in response to as yet unidentified cell cycle cues
(39). Class II gene products include proteins comprising
early structural components of the flagellum (FliF), proteins which
function in the flagellum-specific export pathway, and the
transcription factors FlbD and RpoN ( 54). FlbE is the
cognate histidine kinase for FlbD (50).
|
|
Class II genes (Fig. 1) are the earliest flagellar genes to be
expressed (54). Mutations in these genes result in the
cessation of class III and IV flagellar gene expression and a
concomitant increase in the expression of other class II genes
(34, 55). Class II genes encode (i) early structural
components of the flagellum, including FliF, the protein monomer of the
MS-ring (22, 36); (ii) components of the flagellum-specific
export pathway required for the export of rod, hook, and filament
proteins (19, 28, 41, 47, 58); and (iii) transcription
factors such as RpoN (
54) and the response regulator
FlbD, which are required for the expression of class III and IV
flagellar genes (2, 4, 5, 40, 52, 53). Class II flagellar
genes have conserved promoter elements and are activated at a defined
time in the Caulobacter cell cycle. With at least three
class II gene promoters, PfliL, PfliQ, and PfliF, the
activation of transcription is controlled by the CtrA response
regulator (13, 39). CtrA is a global regulatory protein
which also mediates the control of the initiation of chromosome
replication and chromosomal DNA methylation at specific time points in
the cell cycle (13, 39).
Strains with mutations in class II flagellar genes, in addition to
being nonmotile, exhibit aberrant cell division, resulting in the
formation of abnormally long filamentous cells (5, 12, 19, 57,
58). This cell division defect suggests that early events in
flagellar biogenesis may function as a morphological checkpoint for
cell cycle progression. In order to understand how flagellar biogenesis
is coupled to the cell cycle, as well as to identify additional gene
products required for early events in flagellar assembly, we used the
known phenotypes of class II mutants to identify new flagellar genes.
Here we describe the isolation and characterization of a gene,
fliX, encoding a membrane protein required for flagellar
assembly and normal cell division. Epistasis experiments indicate that
fliX is a class II flagellar gene, suggesting that FliX
functions at an early stage in flagellar biogenesis. We show that
transcription of fliX is under cell cycle control, being
expressed prior to the activation of class III flagellar genes, that
full expression is dependent on ctrA (as is the case with
other class II genes), and that CtrA interacts directly with the
fliX promoter. The fliX gene is located upstream and is divergently transcribed from the class III flagellar gene flgI, which encodes the basal body P-ring monomer. This is
the second example of a divergent promoter arrangement involving class II and class III flagellar operons. The conserved architecture of
cis-acting elements within these intergenic regions may play a role in controlling the timing of flagellar gene expression during
the cell cycle.
 |
MATERIALS AND METHODS |
Materials.
Oligonucleotides were obtained from either Operon
Technologies (Alameda, Calif.) or the Beckman Center protein and
nucleic acid facility at Stanford University. DNA-modifying enzymes,
including restriction endonucleases, S1 nuclease, DNase I, and T4
polynucleotide kinase, were obtained from Boehringer Mannheim and New
England Biolabs. [35S]Trans-Label
(L-methionine, L-cysteine) was obtained from
ICN Biomedicals, and [
-32P]ATP was obtained from
Amersham. Sequencing was performed with a Thermosequenase cycle
sequencing kit from Amersham Life Science. Horseradish peroxidase
conjugated to goat anti-rabbit immunoglobulin G was purchased from
Boehringer Mannheim. Immobilon-P membranes were purchased from
Millipore, and a Renaissance chemiluminescence kit was purchased from
DuPont NEN. Formalin-fixed staphylococcus A cells (Immunoprecipitin)
were purchased from Life Technologies (BRL). Other reagents were
purchased from Sigma Chemical Co.
Bacterial strains, plasmids, and growth conditions.
Bacterial strains and plasmids used in this work are described in Table
1. The fliX null strain was
made recombination deficient as previously described (32).
Caulobacter crescentus NA1000 and mutant strains were grown
at 30°C in either peptone-yeast extract (PYE) medium or M2 minimal
glucose medium (14). C. crescentus cultures
containing plasmids were supplemented with 1 µg of tetracycline per
ml. PYE agar (1.5% agar) was supplemented with nalidixic acid (20 µg/ml), tetracycline (2 µg/ml), or kanamycin (20 µg/ml) as necessary. PYE swarm plates contained 0.25% agar. Escherichia coli TG-1 and S17-1 were grown at 37°C in Luria-Bertani broth supplemented with ampicillin (50 µg/ml), tetracycline (10 µg/ml), or gentamicin (20 µg/ml). Plasmids complementing the fliX
null strain (LS2821) were obtained by subcloning fragments from cosmid pCM1 into the broad-host-range plasmid pMR4. Complementing plasmid subclones and plasmid-borne transcriptional fusions were introduced into C. crescentus cells by mating with E. coli
donor strain S17-1.
Generation of an fliX null strain.
The
fliX null strain was generated by random transposon
mutagenesis. The suicide plasmid pSUP202 carrying transposon
Tn5 was introduced into C. crescentus LS107 by
conjugation as previously described (15). Cultures of
mutagenized cells were plated directly into swarm agar plates
containing kanamycin to select for transposon-mediated antibiotic
resistance. C. crescentus strains with mutations in class II
flagellar genes, in addition to being nonmotile, exhibit defects in
cell division, often giving rise to long filamentous cells. Cultures of
cells which failed to form swarms on swarm agar were examined for cell
division defects by light microscopy. Nonmotile cells exhibiting the
filamentous phenotype were then tested for restoration of motility with
cosmids containing known C. crescentus flagellar genes. One
of the strains with nonmotile cells was complemented to motility with
cosmid pCM1, which carries the flagellar flgI locus
(26, 32). The Tn5 insertion in this strain was
transduced into strain NA1000 (selecting for Kmr) to
generate strain LS2821 (fliX::Tn5).
Electron microscopy.
Bacterial cultures were grown in PYE
medium at 30°C to an optical density at 600 nm (OD600) of
0.6, transferred to a sterile 1.5-ml microcentrifuge tube, and
concentrated by gentle centrifugation. The supernatant was removed, and
the pellets were resuspended in the residual liquid. The concentrated
cell suspension was transferred to a Formvar-coated grid and stained
with uranyl acetate. Grids were examined in a Phillips model EM300
electron microscope.
DNA sequencing.
DNA sequencing was carried out by the
dideoxynucleotide chain termination method (44), with
single- or double-stranded DNA as the template. The sequencing ladder
used to determine the transcriptional start site of fliX was
generated with plasmid pCM4 as the template and the synthetic
oligonucleotide FliX2 (5' TCGACCGATCCAACGCCGGT 3')
corresponding to nucleotides +203 to +184 relative to the fliX +1A transcriptional start site. The sequencing reaction
used to determine the transcriptional start site of flgI was
generated with plasmid pCM5 as the template and the synthetic
oligonucleotide FlgI1 (5' TCGAGGCTCTGCTTGGTCAT 3'), which
corresponds to nucleotides +241 to +222 relative to the flgI
+1A transcriptional start site. Sequence compilation was carried out
with the Genetics Computer Group package of the University of Wisconsin
(9); for database searching, we employed the BLAST
algorithm.
Promoter expression.
DNA fragments were inserted into the
multiple-cloning site of the pRKlac290 vector to generate
transcriptional fusions to lacZ.
-Galactosidase activity
was assayed as described by Miller (30), with cells being
grown in PYE medium plus tetracycline. Assays were done in triplicate
on a minimum of two independent cultures. In order to examine the
pattern of expression of the fliX and flgI
promoters during the cell cycle, strains harboring plasmid-borne
fliX and flgI transcriptional fusions to
lacZ were synchronized by gradient centrifugation as
previously described (16). At various time points during the
cell cycle, 1-ml aliquots of cells were incubated for 5 min with 15 µCi of [35S]Trans-Label, centrifuged, and frozen on dry
ice. Cells were lysed and immunoprecipitated as described previously
(32). The immunoprecipitated proteins were separated on
sodium dodecyl sulfate (SDS)-10% polyacrylamide gels and visualized
by autoradiography. Quantification was done with a Molecular Dynamics
PhosphorImager with ImageQuant software.
S1 nuclease protection analysis.
RNA was isolated from
C. crescentus NA1000 via standard protocols (43).
Double-stranded end-labeled probes for S1 nuclease assays were
generated as described previously (43). Labeled probes
(105 cpm) were mixed with RNA (40 or 80 µg), ethanol
precipitated, and resuspended in S1 hybridization solution {60%
formamide, 40 mM PIPES
[piperazine-N,N'-bis(2-ethanesulfonic acid)]
(pH 6.4), 400 mM NaCl, 1 mM EDTA (pH 8)}. The nucleic acids were
denatured at 85°C for 10 min and then allowed to hybridize overnight
at 50°C. S1 nuclease digestion and product preparation were carried out as described previously (43). The protected fragments
were run alongside sequencing ladders generated with plasmids pCM4 and
pCM5 as templates and synthetic oligonucleotide primers whose 5' ends
corresponded to the 5' ends of the labeled probes, thus permitting
direct comparison.
DNase I footprinting analysis.
The His-CtrA fusion protein
used for DNase I footprinting analysis was purified as described
previously (39). The DNA probes used for DNase I
footprinting analysis were generated by digestion with BspEI
(
92 relative to the fliX +1A transcriptional start site),
dephosphorylation with alkaline phosphatase, and phosphorylation with
[
-32P]ATP (50 µci) catalyzed by T4 polynucleotide
kinase. Following digestion with a second restriction endonuclease, the
end-labeled fragments were gel purified. Probes (approximately 5 × 104 cpm) were incubated with different amounts of
His-CtrA in a 200-µl reaction mixture containing 20 mM Tris-HCl [pH
7.4], 100 mM KCl, 5 mM MgCl2, 1 mM CaCl2, 2 mM
dithiothreitol, 5% glycerol, 50 µg of bovine serum albumin per ml,
and 4 µg of calf thymus DNA per ml. The reaction mixtures were
incubated at 23°C for 10 min to allow complex formation, followed by
a 3-min digestion of the DNA-protein complex with 60 ng of DNase I. The
digestion was stopped by the addition of 10 µl of 0.5 M EDTA, and the
labeled DNA fragments were isolated with a QIAquick PCR purification
kit (Qiagen) according to the manufacturer's instructions. The
products of DNase I digestion were separated on sequencing gels in
parallel with a sequencing ladder generated with the 22-mer
oligonucleotide FliX1 (5' CAGTCGCCGAGACACCCCCCGT 3')
extending from +82 to +61 relative to the fliX +1A
transcriptional start site.
Production of a His-tagged FliX protein and generation of
polyclonal antisera.
The fliX-coding region was
amplified by PCR with the following primers: FliX4-EcoRI
(5' TCGGATGAAGAATTCCAGCACG 3') and
FliX5-HindIII (5' CCCTGGCCTGAAGCTTGGCCA 3').
The resulting 420-bp fragment was digested with EcoRI
and HindIII and ligated into pET-21b (Novagen), creating
plasmid pCM17. The resulting plasmid generates an in-frame fusion
between an N-terminal T7 epitope tag, the cloned fliX
fragment, and a C-terminal His tag. Expression of FliX-His from the T7
promoter was induced in E. coli BL21 (DE3) by addition of 1 mM IPTG (isopropyl-
-D-thiogalactopyranoside). A 250-ml
culture was grown at 37°C in Luria-Bertani broth to an OD600 of 0.6, and cells were harvested by centrifugation
3 h after induction. The cell pellet was dissolved in ice-cold
binding buffer (20 mM Tris-HCl [pH 7.9], 5 mM imidazole, 0.5 M NaCl)
and lysed by sonication. Following centrifugation (20,000 × g for 15 min), FliX-His was purified from the supernatant
fraction by chromatography on His Bind resin (Novagen) according to the
manufacturer's instructions. Column fractions containing FliX-His were
pooled, concentrated with Centricon 10 Microconcentrator tubes
(Amicon), and used directly to immunize rabbits. Immunization and
sampling of the serum were performed by the Berkeley Antibody Company.
Western blot analysis.
Western blots on SDS-polyacrylamide
gel electrophoresis (PAGE)-separated gels were performed as previously
described (23). Blots were probed with primary antiserum at
a dilution of 1:5,000 and then with the secondary antibody (goat
anti-rabbit immunoglobulin G; Boehringer Mannheim) at a 1:10,000
dilution. Generation and use of antisera to the C. crescentus CcrM, flagellin, and FlgH proteins have been described
previously (23, 48). Western blots were developed with a
Renaissance chemiluminescence kit (DuPont NEN) according to the
manufacturer's instructions. Protein standards were prestained
SDS-PAGE low-range standards (Bio-Rad).
Analysis of cellular localization of FliX.
C.
crescentus cultures were harvested by centrifugation at an
OD600 of 0.6 to 0.8. Cell lysis and separation of membrane
fractions from soluble proteins by differential centrifugation were
performed as described previously (23). Following
centrifugation, the supernatant fraction was concentrated in Centricon
10 Microconcentrator tubes (Amicon). To prepare the extracellular
protein fraction, a 100-ml sample of culture (OD600 = 0.6)
was centrifuged at 7,000 × g for 20 min. The culture
supernatant was then passed through a 0.45-µm-pore-size filter.
Proteins were precipitated from the supernatant by addition of ammonium
sulfate to 50% saturation at 4°C. Precipitated material was
collected by centrifugation at 8,000 × g for 20 min. The
pellet was washed with 70% ethanol, dried under vacuum, and
resuspended in 1 ml of 10 mM Tris (pH 7.5)-1 mM EDTA.
Nucleotide sequence accession numbers.
The nucleotide
sequence of the fliX-flgI locus has been previously
described (26) and assigned GenBank accession no. M91448. The dksA sequence has been deposited in the GenBank database
under accession no. AFO34413.
 |
RESULTS |
Isolation and complementation of the fliX null
mutant.
In order to screen for new class II flagellar genes,
nonmotile mutants were generated by Tn5 mutagenesis and then
examined for defects in cell division (see Materials and Methods). A
total of 13 nonmotile mutants exhibiting the filamentous phenotype were generated and examined further. To determine if the mutations were in
known flagellar loci, we first attempted to complement the motility
defect using cosmids containing known flagellar genes. Three of the
mutants were not complemented, and several new class II flagellar genes
were identified (31, 47). One of the strains, LS2821, whose
cells were nonmotile, had no visible flagella, and exhibited a marked
cell division defect (Fig. 2), was
complemented by cosmid pCM1, previously shown to contain
flgI, a class III flagellar gene encoding the structural
protein of the basal body P-ring (26, 32).

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 2.
Electron micrographs of C. crescentus NA1000
and the fliX null strain LS2821. (A) Strain NA1000 showing
normal swarmer, stalked, and predivisional cells. (B) LS2821
(fliX::Tn5) lacking flagella and
forming filamentous cells. (C). LS2821 complemented with plasmid
pCM13.
|
|
Southern blot hybridization analysis (data not shown) defined the site
of Tn
5 insertion in LS2821 to within a 240-bp
PstI
fragment located upstream of
flgI (Fig.
3). Based on the previously
published
sequence of the
flgI region (
26), we identified
two
open reading frames (ORFs) upstream and oriented in the direction
opposite to that of
flgI (Fig.
3). The site of
Tn
5 insertion in
LS2821 is within the first ORF, which we
designated
fliX, based
on its requirement for flagellar
assembly and on epistasis experiments
that placed it within the
flagellar hierarchy (see below). Plasmid
pCM13, containing a 620-bp
NlaIII fragment encoding only
fliX,
complemented
both the motility defect and the cell division phenotype
of LS2821
(Fig.
2 and
3). To confirm that an intact
fliX gene
was
required for complementation, plasmid pCM14, bearing a deletion
which
lacked 260 bp of the 3' end of
fliX, was constructed. This
plasmid failed to complement either the motility or the cell division
phenotype of LS2821 (Fig.
3). To rule out possible polar effects,
as
well as the possibility that complementation by pCM13 containing
the
intact gene was due to chromosomal integration of the
fliX-complementing
DNA, complementation experiments were
carried out with both LS2821
and LS2996, a
fliX rec double
mutant background. No observable
difference in complementation results
were observed with the two
strains.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 3.
Complementation analysis of LS2821. (A) Genetic and
restriction map of the C. crescentus chromosomal region
upstream of flgI (26) and plasmids complementing
(+) or not complementing ( ) the motility and cell division phenotypes
of LS2821. The triangle represents the site of Tn5 insertion
in LS2821 as determined by Southern blot analysis (data not shown).
Abbreviations: H, HindIII; S, SacI; N,
NlaIII; P, PstI; X, XhoI.
|
|
Identification of the fliX and dksA
ORFs.
The fliX ORF begins at nucleotide 874 and ends at
nucleotide 440 of the published sequence of the flgI region
(26). A potential ribosome binding site (GGAG) is located 7 bp upstream of the putative ATG start codon. The nucleotide sequence of
fliX encodes a putative protein of 144 amino acids (Fig.
4A) with a predicted molecular mass of
14.5 kDa. The fliX gene product has no significant
similarity to proteins in current databases. The N-terminal region of
FliX has characteristics of signal-peptide sequences (38),
including a charged amino terminus and a potential signal peptidase
cleavage site (Gly-X-Ser
). The most probable cleavage site for the
putative signal peptide is between amino acids 24 and 25. Hydrophobicity analysis showed that FliX has two hydrophobic domains
(Fig. 4B). The first region, from residues 31 to 52, constitutes a
typical alpha-helical transmembrane domain, suggesting that FliX may be an integral membrane protein.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 4.
(A) Predicted amino acid sequence of FliX. The possible
signal peptide sequence is underlined, and the cleavage site is
indicated by a vertical arrow. Numbers indicate amino acids. (B)
Hydrophobicity plot of the FliX protein. The graph was generated by the
Hydrophobicity Plot program in the DNA Strider package. Negative values
indicate hydrophilic regions, and positive values indicate hydrophobic
regions. (C) Alignment of C. crescentus (Cc) DksA with the
homologs from E. coli (Ec) (25) and H. influenzae (Hi) (17). Asterisks indicate identical
amino acids.
|
|
A second ORF, located adjacent to
fliX, was designated
dksA based on the similarity of its predicted protein
product to DksA
homologs from other organisms (Fig.
4C). Homology to
the N termini
of known
dksA gene products was detected in
database searches
with the published sequence of the
flgI
region (
26). This homology
extended to the
SacI
site located at position 1 of the published
sequence, suggesting that
the remainder of the
dksA gene extended
downstream of the
SacI site. A 1.1-kb
PstI fragment with the
SacI
site located approximately midway in the fragment was
subcloned
from cosmid pCM1, and the complete nucleotide sequence of
dksA was determined on both strands. The putative
dksA initiation codon
is located 208 bp downstream of the
fliX termination codon. The
dksA gene appears to
be transcribed from its own promoter based
on the activity of reporter
fusions with the
dksA-fliX intervening
region
(
31). The
C. crescentus DksA protein is 45%
identical
to the
Haemophilus influenzae and
E. coli DksA proteins (Fig.
4C). The
dksA gene was
originally identified in
E. coli as a multicopy
suppressor
of the temperature-sensitive growth of a
dnaK null
strain
(
25). More recently,
dksA has been identified as
a multicopy
suppressor of mutations in the chromosome-partitioning gene
mukB (
56), in the periplasmic protease
tsp (
3), and in the origin
of replication of
plasmid pCS101 (
35). In
E. coli the
dksA gene
has been shown to be nonessential (
25).
Insertional inactivation
of the
C. crescentus dksA gene has
no observable affect on motility,
growth, or cell division under normal
growth conditions (
31).
Placement of the fliX gene in class II of the flagellar
regulatory hierarchy.
Epistasis experiments were performed in
order to determine the position of fliX within the flagellar
regulatory hierarchy. The nonmotile and aberrant cell division
phenotypes of the fliX null strain are consistent with a
mutation in a class II flagellar gene. Mutations in class II flagellar
genes typically result in an increased expression of other class II
flagellar genes and a dramatic reduction in the expression of class III
and IV flagellar genes (34, 55). In order to analyze the
effect of the fliX mutant on flagellar gene expression,
transcriptional fusions of representative class II, III, and IV
flagellar gene promoters to lacZ were introduced into LS2821
(fliX::Tn5) on low-copy-number plasmids
and
-galactosidase activity was measured and compared to that of
NA1000. The expression of class II promoters was elevated in LS2821,
while that of class III and IV promoters was dramatically reduced
(Table 2), consistent with the phenotype
expected of a class II flagellar mutant.
Conversely, we examined the effect of known flagellar mutants on
fliX expression. An 800-bp
PstI fragment
extending 200 bp
into the
fliX coding region and 400 bp into
the
flgI coding region
was cloned into pRKlac290, yielding
recombinant plasmids pCM9
and pCM10, with the two possible orientations
of the
PstI insertion.
The pCM9 construct places
lacZ under the control of the
fliX promoter,
while the pCM10 construct places
lacZ under the control of
the
promoter for the class III flagellar gene
flgI. The pCM9
and pCM10
constructs introduced into strain NA1000 produced
approximately
1,700 and 700 U of

-galactosidase, respectively. As
shown in
Table
3, the
fliX::
lacZ fusion (pCM9) showed
elevated expression
in class II flagellar mutants and was relatively
unaffected by
mutations in class III flagellar genes, as expected for
the expression
of a class II flagellar gene. In contrast, expression of
the
flgI::
lacZ fusion (pCM10) was
dramatically reduced in class II flagellar
mutants and increased
roughly twofold in class III flagellar mutants,
the expected expression
pattern for a class III flagellar gene.
A number of class II flagellar genes have been shown to be under
transcriptional regulation by the CtrA response regulator
(
39). We therefore tested the activity of the
fliX::
lacZ fusion
in strain LS2195,
which contains a temperature-sensitive mutation
in
ctrA
(
39). Two hours after a shift to the nonpermissive
temperature,

-galactosidase activity was reduced by over 50% (Table
3). A
similar reduction in activity of the class III
flgI-lacZ fusion
was most likely indirect, due to the block
in flagellar class
II gene expression.
The transcription of class II flagellar genes is activated midway
through the cell cycle, prior to the activation of class
III and then
class IV flagellar genes. To test the relative time
of
fliX
transcriptional activation, swarmer cells were isolated
from cultures
of NA1000 containing either pCM9
(
fliX::
lacZ) or
pCM10
(
flgI::
lacZ) and allowed to progress
synchronously through
the cell cycle. At 15-min intervals, samples were
pulse-labeled
with [
35S]Trans-Label for 5 min and cell
extracts were immunoprecipitated
with anti-

-galactosidase antibody.
As an internal control, samples
of the same cell extracts were also
immunoprecipitated with antibodies
to the class IV flagellar filament
proteins. Both
fliX::
lacZ and
flgI::
lacZ exhibited temporal
regulation, with
fliX transcription
initiating somewhat
before
flgI relative to the flagellin internal
control (Fig.
5).
fliX promoter expression
began between 0.3 and
0.4 division units and peaked in the
predivisional cell, similar
to that reported for other class II
flagellar genes (
36,
41,
49,
58). The expression of
flgI began between 0.4 and 0.5
division units, slightly
later than that of
fliX, consistent with
the time of
activation of other class III flagellar promoters
(
10,
22,
32).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 5.
Patterns of fliX and flgI
transcription during the cell cycle. Swarmer cells from cultures of
NA1000 containing either pCM9
(fliX::lacZ) or pCM10
(flgI::lacZ) were isolated and allowed
to progress synchronously through the cell cycle. At 15-min intervals,
a portion of the culture was removed and proteins were pulse-labeled
with [35S]Trans-Label. (A) Results of immunoprecipitation
of 35S-labeled -galactosidase from strains carrying
either pCM9 (fliX::lacZ) or pCM10
(flgI::lacZ) and of
35S-labeled flagellar filament proteins, followed by
electrophoresis on an SDS-10% polyacrylamide gel and autoradiography.
The flagellin proteins were monitored as an internal control and
indicator for the quality of cell synchrony. Shown are flagellins
recovered from cells carrying the
flgI::lacZ fusion. Flagellin proteins
recovered from the cells carrying the
fliX::lacZ fusion gave nearly identical
immunoprecipitation and quantification profiles. The cell types present
at each time point, monitored microscopically, are represented
schematically above the graphs and the autoradiograms. (B)
Quantification of the data in panel A with a Molecular Dynamics
PhosphorImager, reported as the percentage of maximal expression for
each protein. The duration of the cell cycle was approximately 150 min.
Filled boxes represent expression of the
fliX::lacZ fusion, open boxes represent
expression of the flgI::lacZ fusion,
and filled circles represent expression of flagellin. The Roman
numerals in parentheses indicate the flagellar class for each gene
(fliX, flgI) or protein (flagellins) examined.
|
|
Thus, the phenotype of the
fliX mutant, the results of the
epistasis experiments, and the time of
fliX transcriptional
activation
relative to those of other flagellar genes leads to the
conclusion
that
fliX is a class II flagellar gene and that
the
fliX gene
product is likely to be required at an early
stage in flagellar
assembly.
Mapping the transcriptional start sites for fliX and
flgI.
S1 nuclease protection assays were used to determine
the fliX and flgI transcriptional start sites
(Fig. 6). The 568-bp probe used for
mapping the fliX transcriptional start site was end labeled at the SalI site located 158 bp into the fliX
coding sequence. The 600-bp probe used for mapping the transcriptional
start site of flgI was end labeled at the XhoI
site located 212 bp into the flgI coding region. To define
precisely the ends of the protected transcripts, DNA sequencing
reactions were performed with primers whose 5' ends matched the 5' ends
of the labeled probes. Two products of equal intensities, corresponding
to two transcriptional start points, were consistently seen in S1
nuclease experiments with either the fliX or the
flgI promoter probe (Fig. 6). The length of the protected
fragments corresponding to the fliX transcript indicated
that the transcriptional start sites (+1A and +1B) (Fig. 6) are located
45 and 43 bp, respectively, upstream of the fliX initiation
codon. The lengths of the protected fragments corresponding to the
flgI transcript indicated that the transcriptional start sites +1A and +1B (Fig. 6) are located 29 and 27 bp, respectively, upstream of the flgI initiation codon. The distance between
the fliX and flgI transcriptional start sites
(+1A) is 158 bp (Fig. 7B).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 6.
S1 nuclease mapping of the flgI and
fliX transcriptional start sites. The lanes labeled G, A, T,
and C show the products of the sequencing reactions that used
oligonucleotide primers with 5' sequences matching the labeled ends of
the S1 nuclease probes. Lanes labeled 1 and 2 contained labeled probe
hybridized to 40 and 80 µg of C. crescentus total RNA,
respectively. The identified transcriptional start sites (+1A and +1B)
are indicated next to the sequence.
|
|

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 7.
(A) Footprinting analysis of His-CtrA at the
fliX promoter. An end-labeled
BspEI-PstI fragment containing sequences from
92 to +220 (relative to the +1A transcriptional start site) of the
fliX promoter was incubated in the presence or absence of
CtrA and then digested with DNase I as described in Materials and
Methods. The triangle indicates increasing concentrations of His-CtrA
(10, 20, and 40 µg). The minus signs indicate that no protein was
added, and the asterisk indicates a hypersensitive site. (B) Nucleotide
sequence of the fliX-flgI intergenic region showing 10 and
35 regions for fliX and flgI as well as the
CtrA binding site and potential cis-acting regulatory
elements. Numbers are given relative to the +1A transcriptional start
sites. The nucleotide sequence is shown from 5' to 3' in the direction
of transcription of flgI. Boldface nucleotides denote the
consensus CtrA binding site, and ftr denotes the potential
binding sites for the transcriptional activator FlbD. Double-underlined
sequences at 24 and 12 of the flgI promoter conform to
the consensus sequence for 54-dependent promoters.
Overlined is the conserved binding site for integration host factor
(IHF). Arrows indicate the transcriptional start sites determined by S1
nuclease analysis. (C) Comparison of the organization of
cis-acting elements in the fliX-flgI
(26) and fliL-flgF (29, 53) intergenic
regions. Arrows denote transcriptional start sites.
|
|
DNase I footprinting analysis of the CtrA binding site in the
fliX promoter.
Class II flagellar genes are driven by
a unique class of promoters which contain a conserved DNA motif
recognized by the CtrA response regulator (39). Examination
of the fliX promoter region revealed a sequence, centered
around
35, which matched seven of nine bases of the consensus CtrA
binding site (TTAA-N7-TTAAC) (Fig. 7B). The CtrA binding motif is
typically located in the
35 regions of other class II flagellar
promoters (39). To determine if CtrA recognizes this site
and binds directly to the fliX promoter, DNase I
footprinting studies were performed with a purified His-CtrA fusion
protein. The His-CtrA fusion protein has previously been shown to bind
the class II fliQ promoter, at a region overlapping the CtrA
binding motif (39). In the presence of CtrA, a single protected region of 17 bp, partially overlapping the binding motif, was
observed. This region extended from positions
31 to
47 relative to
the fliX +1A transcriptional start site (Fig. 7A and B).
These results, and the finding that transcription of fliX is
decreased in a strain bearing a ctrA401 allele, suggest that
CtrA plays a direct role in the regulation of fliX
transcription.
Analysis of the
fliX-flgI intergenic region revealed a
number of other potential
cis-acting regulatory elements
(Fig.
7B and
C). Overlapping the CtrA binding site within the
fliX promoter
is the first of two
ftr (flagellar
transcriptional regulation)
elements. The
ftr elements are
binding sites for the transcriptional
activator FlbD and are typically
present in pairs approximately
100 bp upstream of the transcriptional
start sites for class III
flagellar genes (
4,
33,
51,
53).
Sequences at

24 and

12 of the
flgI promoter conform to
the consensus sequence for
54-dependent promoters
typically found in other class III flagellar
genes (
53).
Between this sequence and the
ftr elements is a
consensus
binding site for integration host factor. The presence
and arrangement
of regulatory elements within the
fliX-flgI intergenic
region is similar to those of the
fliL-flgF intergenic
region
(
29), which controls the class II
fliLM
operon and the class
III
flgFGDH flagellar operon (Fig.
7C).
FliX is a membrane protein that is present throughout the cell
cycle.
A polyhistidine-tagged FliX protein was overexpressed,
purified, and used to generate antibodies. The FliX antibody recognized a protein of 15 kDa (Fig. 8A) which is
similar in size to the 14.5-kDa protein predicted from the
fliX nucleotide sequence. The fliX null strain
LS2821 completely lacks the 15-kDa protein, which was restored when the
fliX gene was provided in trans on the
complementing plasmid pCM13 (Fig. 8A, lanes 2 and 3). Elevated levels
of the 15-kDa protein were observed in protein extracts from the class
II fliF and fliQR flagellar mutants (Fig. 8A,
lanes 4 and 5), as was expected from the expression analysis of the fliX promoter (Table 3).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 8.
Western blot characterization of FliX. (A) Western blot
analysis of the FliX protein in NA1000 and flagellar mutants. Equal
amounts of protein from whole-cell extracts were separated by SDS-12%
PAGE and immunoblotted with anti-FliX antibody. Lanes: 1, NA1000; 2, LS2821 (fliX::Tn5); 3, LS2821
complemented with plasmid pCM13; 4, LS1218 (fliF mutant); 5, SC508 (fliQR mutant). (B) FliX protein levels throughout the
cell cycle. Swarmer cells isolated from a culture of NA1000 were
suspended in fresh medium and allowed to progress through the cell
cycle. At 15-min intervals, 1-ml aliquots were removed. Equal amounts
of total protein from each time point were separated by SDS-PAGE and
immunoblotted with antisera to FliX, FliF, and McpA proteins. Shown
schematically above the autoradiograms are the cell types present at
each time point as determined by light microscopy. (C) Subcellular
localization of the FliX protein. Cell extracts from strain NA1000 were
fractionated into membrane, cytoplasmic, and extracellular fractions as
described in Materials and Methods. Equal amounts of protein from each
fraction and a whole-cell control were separated by SDS-PAGE and
blotted onto polyvinylidene difluoride membranes. Membranes were probed
separately with polyclonal antisera to FliX, the CcrM DNA
methyltransferase, the FlgH flagellar ring protein, and C. crescentus flagellins.
|
|
Cell-type-specific proteolysis has been shown to play an important role
in maintaining asymmetry in the predivisional cell.
The McpA
chemoreceptor (
1) and FliF flagellar motor protein
(
22), for example, are specifically degraded during the
transition
from swarmer to stalked cell. In contrast, the flagellar
FlgH
ring protein and the FliL protein are present throughout the cell
cycle (
23,
32). In order to examine FliX protein levels
during
the cell cycle, cell extracts were prepared from samples of
synchronous
cultures at several times during the cell cycle and assayed
by
Western blot analysis with anti-FliX antibodies. As controls,
the
extracts were also assayed with anti-FliF or anti-McpA antibodies.
As
previously shown, the FliF and McpA proteins are turned over
during the
transition from swarmer to stalked cells (Fig.
8B).
In contrast, the
steady-state level of the FliX protein remains
constant (Fig.
8B),
suggesting that FliX is not turned over during
the cell cycle, even
though its synthesis is under temporal control
(Fig.
5).
The N-terminal region of FliX contains a putative cleavable signal
sequence, followed by a hydrophobic transmembrane domain,
suggesting
that FliX might function extracytoplasmically. To determine
the
cellular location of the FliX protein, cell extracts from
strain NA1000
were separated into cytoplasmic, membrane, and extracellular
fractions
and Western blot analysis with anti-FliX antibody was
used to detect
the proteins in these fractions. As a control for
the purity of the
fractions, each sample was also probed with
antisera to the cytoplasmic
CcrM DNA methyltransferase (
48),
the outer membrane L-ring
protein, FlgH (
23), and the predominantly
extracellular
flagellins. FliX was found almost exclusively in
the membrane fraction,
although a small but detectable amount
was also seen in the cytoplasmic
fraction (Fig.
8C).
 |
DISCUSSION |
We have isolated and characterized fliX, a gene
required for flagellar assembly and normal cell division in C. crescentus. Epistasis experiments place fliX in class
II of the flagellar regulatory hierarchy, indicating that the
fliX gene product functions at an early stage in flagellar
biogenesis. The observations that FliX copurifies with the membrane
fraction and that the FliX predicted amino acid sequence has a
potential N-terminal signal sequence and at least one transmembrane
domain indicate that FliX functions either in or in association with
the membrane. In Caulobacter, the only flagellar proteins
other than FliX that possess N-terminal signal sequences are the
protein monomers for the P- and L-rings (11, 26). The P- and
L-ring proteins are presumed to be exported across the cytoplasmic
membrane to their respective destinations in the cell envelope via the
general secA-dependent pathway. This export is in contrast
to that of the axial rod, hook, and filament subunit proteins, which do
not have cleaveable signal sequences and are exported by a
flagellum-specific export apparatus (28). The presence of an
N-terminal signal sequence suggests that FliX may use the same pathway
as the P- and L-ring proteins for translocation to the membrane. The
function of FliX in the cell envelope has not been determined. Although
the genes encoding the known substructures of the flagellum have been
identified (Fig. 1), it is possible that FliX functions as a transient
component of the flagellum that is required for the assembly process.
FliX may contribute to the targeting or assembly of the P- and L-ring
protein monomers at the cell pole. Immunolocalization and
coimmunoprecipitation studies with the anti-FliX antibodies are under
way to further elucidate the role of FliX.
A hallmark of the flagellar regulatory hierarchy in
Caulobacter is the sequential activation of the genes
required to assemble the flagellum. It has recently been shown that the
cues which initiate flagellar biogenesis at a specific time in the cell
cycle are mediated through the signal transduction response regulator CtrA, by regulating the transcriptional activity of class II flagellar genes (39). We have shown that fliX expression is
activated at the same time in the cell cycle as other class II genes
and that its full expression is dependent on CtrA, which interacts directly with the fliX promoter. We propose that in vivo,
the temporal control of fliX expression during the
Caulobacter cell cycle is mediated directly through binding
and transcriptional activation by CtrA.
While the CtrA protein regulates the transcription of class II
flagellar genes, the FlbD response regulator mediates the transition from early to late flagellar gene expression by activating class III
and IV flagellar genes (4, 40, 52, 53). We have shown that
the class II fliX gene and the class III flgI
gene are divergently transcribed and that their transcriptional start
sites are separated by a 158-bp intergenic region. We have demonstrated
that the intergenic region mediates the cell cycle control of
fliX and flgI expression. Analysis of this region
revealed not only the presence of a CtrA binding motif but also two
FlbD binding sites, termed ftr (Fig. 7B). This arrangement
of cis-acting elements is similar to that of another set of
class II and class III flagellar genes, fliL-flgF, that is
also divergently transcribed (see Fig. 7C). We have recently demonstrated that CtrA binds to the class II fliL promoter
in vitro (42). A direct interaction between FlbD and the
flgI and flgF promoters has not yet been
demonstrated. However, Wu et al. (53) have shown that
flgI and flgF promoter fragments, with the
ftr elements intact, can be transcriptionally activated by FlbD, indicating that FlbD binds to the ftr elements to
control flgI and flgF expression. The
fliX-flgI and fliL-flgF intergenic regions,
therefore, appear to be important control sites for both the initiation
of flagellar biogenesis by CtrA and the transition from early to late
flagellar gene expression mediated by FlbD.
Does the regulatory control exerted on the fliX-flgI and
fliL-flgF intergenic regions reflect a functional
relationship between the products of these divergent transcription
units? The class II fliLM operon encodes FliL, a membrane
protein of unknown function, and FliM, a flagellar switch protein. The
class III flgF operon encodes the basal body rod proteins
and FlgH, the L-ring monomer. We have previously shown that the FlgH
protein is expressed, but unstable, in a flgI null strain
(32), suggesting that the assembly of FlgI into the P-ring
and FlgH into the L-ring is coordinately controlled. In an attempt to
establish a similar relationship between fliX and the
products of the fliLM operon, we examined FliL and FliM
protein levels in LS2821, the fliX null strain. We found
that FliL and FliM were present in the fliX null strain, indicating that the absence of FliX does not affect the stability of
these proteins (31). Alternatively, the regulatory control exerted on the fliX-flgI intergenic region may reflect a
functional relationship between FliX and FlgI. For example, if FliX has
a role in the assembly of the periplasmic FlgI P-ring monomers, then
the regulatory control of the fliX-flgI intergenic region would ensure that FliX synthesis occurs prior to that of FlgI, its
target substrate.
 |
ACKNOWLEDGMENTS |
We thank members of the Shapiro lab for critical readings of the
manuscript.
This work was supported by National Institutes of Health grant GM
32506/5120MZ.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Developmental Biology B300, Beckman Center, Stanford, CA 94305-5427. Phone: (650) 723-5685. Fax: (650) 725-7739. E-mail:
Mohr{at}cmgm.stanford.edu.
 |
REFERENCES |
| 1.
|
Alley, M. R.,
J. R. Maddock, and L. Shapiro.
1993.
Requirement of the carboxyl terminus of a bacterial chemoreceptor for its targeted proteolysis.
Science
259:1754-1757[Abstract/Free Full Text].
|
| 2.
|
Anderson, D. K.,
N. Ohta,
J. Wu, and A. Newton.
1995.
Regulation of the Caulobacter crescentus rpoN gene and function of the purified sigma 54 in flagellar gene transcription.
Mol. Gen. Genet.
246:697-706[Medline].
|
| 3.
|
Bass, S.,
Q. Gu, and A. Christen.
1996.
Multicopy suppressors of Prc mutant Escherichia coli include two HtrA (DegP) protease homologs (HhoAB), DksA, and truncated RlpA.
J. Bacteriol.
178:1154-1161[Abstract/Free Full Text].
|
| 4.
|
Benson, A. K.,
G. Ramakrishnan,
N. Ohta,
J. Feng,
A. J. Ninfa, and A. Newton.
1994.
The Caulobacter crescentus FlbD protein acts at ftr sequence elements both to activate and to repress transcription of cell cycle-regulated flagellar genes.
Proc. Natl. Acad. Sci. USA
91:4989-4993[Abstract/Free Full Text].
|
| 5.
|
Brun, Y. V., and L. Shapiro.
1992.
A temporally controlled sigma-factor is required for polar morphogenesis and normal cell division in Caulobacter.
Genes Dev.
6:2395-2408[Abstract/Free Full Text].
|
| 6.
|
Bryan, R.,
D. Glaser, and L. Shapiro.
1990.
A genetic regulatory hierarchy in Caulobacter development.
Adv. Genet.
27:1-31[Medline].
|
| 7.
|
Carter, P.,
H. Bedouelle, and G. Winter.
1985.
Improved oligonucleotide site-directed mutagenesis using M13 vectors.
Nucleic Acids Res.
13:4431-4443[Abstract/Free Full Text].
|
| 8.
|
Champer, R.,
A. Dingwall, and L. Shapiro.
1987.
Cascade regulation of Caulobacter flagellar and chemotaxis genes.
J. Mol. Biol.
194:71-80[Medline].
|
| 9.
|
Devereux, D.,
P. Hableri, and O. Smithies.
1984.
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res.
12:387-395.
|
| 10.
|
Dingwall, A.,
J. D. Garman, and L. Shapiro.
1992.
Organization and ordered expression of Caulobacter genes encoding flagellar basal body rod and ring proteins.
J. Mol. Biol.
228:1147-1162[Medline].
|
| 11.
|
Dingwall, A.,
J. W. Gober, and L. Shapiro.
1990.
Identification of a Caulobacter basal body structural gene and a cis-acting site required for activation of transcription.
J. Bacteriol.
172:6066-6076[Abstract/Free Full Text].
|
| 12.
|
Dingwall, A.,
W. Y. Zhuang,
K. Quon, and L. Shapiro.
1992.
Expression of an early gene in the flagellar regulatory hierarchy is sensitive to an interruption in DNA replication.
J. Bacteriol.
174:1760-1768[Abstract/Free Full Text].
|
| 13.
|
Domian, I. J.,
K. C. Quon, and L. Shapiro.
1997.
Cell type-specific phosphorylation and proteolysis of a transcriptional regulator controls the G1-to-S transition in a bacterial cell cycle.
Cell
90:415-424[Medline].
|
| 14.
|
Ely, B.
1991.
Genetics of Caulobacter crescentus.
Methods Enzymol.
204:372-384[Medline].
|
| 15.
|
Ely, B., and R. H. Croft.
1982.
Transposon mutagenesis in Caulobacter crescentus.
J. Bacteriol.
149:620-625[Abstract/Free Full Text].
|
| 16.
|
Evinger, M., and N. Agabian.
1977.
Envelope-associated nucleoid from Caulobacter crescentus stalked and swarmer cells.
J. Bacteriol.
132:294-301[Abstract/Free Full Text].
|
| 17.
|
Fleischmann, R. D.,
M. D. Adams,
O. White,
R. A. Clayton,
E. F. Kirkness,
A. R. Kerlavage,
C. J. Bult,
J. Tomb,
B. A. Dougherty,
J. M. Merrick,
K. McKenney,
G. Sutton,
W. Fitzhugh,
C. Fields,
J. D. Gocayne,
J. Scott,
R. Shirley,
L. Liu,
A. Glodek,
J. M. Kelley, et al.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
Science
269:496-512[Abstract/Free Full Text].
|
| 18.
|
Francis, N. R.,
G. E. Sosinsky,
D. Thomas, and D. J. DeRosier.
1994.
Isolation, characterization, and structure of bacterial flagellar motors containing the switch complex.
J. Mol. Biol.
235:1261-1270[Medline].
|
| 19.
|
Gober, J. W.,
C. H. Boyd,
M. Jarvis,
E. K. Mangan,
M. F. Rizzo, and J. A. Wingrove.
1995.
Temporal and spatial regulation of fliP, an early flagellar gene of Caulobacter crescentus that is required for motility and normal cell division.
J. Bacteriol.
177:3656-3667[Abstract/Free Full Text].
|
| 20.
|
Gober, J. W., and L. Shapiro.
1992.
A developmentally regulated Caulobacter flagellar promoter is activated by 3' enhancer and IHF binding elements.
Mol. Biol. Cell
3:913-926[Abstract].
|
| 21.
|
Hahnenberger, K. M., and L. Shapiro.
1987.
Identification of a gene cluster involved in flagellar basal body biogenesis in Caulobacter crescentus.
J. Mol. Biol.
194:91-103[Medline].
|
| 22.
|
Jenal, U., and L. Shapiro.
1996.
Cell cycle-controlled proteolysis of a flagellar motor protein that is asymmetrically distributed in the Caulobacter predivisional cell.
EMBO J.
15:2393-2406[Medline].
|
| 23.
|
Jenal, U.,
J. White, and L. Shapiro.
1994.
Caulobacter flagellar function, but not assembly, requires FliL, a non-polarly localized membrane protein present in all cell types.
J. Mol. Biol.
243:227-244[Medline].
|
| 24.
|
Johnson, R. C., and B. Ely.
1979.
Analysis of nonmotile mutants of the dimorphic bacterium Caulobacter crescentus.
J. Bacteriol.
137:627-634[Abstract/Free Full Text].
|
| 25.
|
Kang, P. J., and E. A. Craig.
1990.
Identification and characterization of a new Escherichia coli gene that is a dosage-dependent suppressor of a dnaK deletion mutation.
J. Bacteriol.
172:2055-2064[Abstract/Free Full Text].
|
| 26.
|
Khambaty, F. M., and B. Ely.
1992.
Molecular genetics of the flgI region and its role in flagellum biosynthesis in Caulobacter crescentus.
J. Bacteriol.
174:4101-4109[Abstract/Free Full Text].
|
| 27.
|
Kokjohn, T. A., and R. Miller.
1987.
Characterization of the Pseudomonas aeruginosa recA analog and its protein product: rec-102 is a mutant allele of the P. aeruginosa PAO recA gene.
J. Bacteriol.
169:1499-1508[Abstract/Free Full Text].
|
| 28.
|
Macnab, R.
1996.
Flagella and motility, p. 123-145. In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed.
ASM Press, Washington, D.C.
|
| 29.
|
Marques, M. V., and J. Gober.
1995.
Activation of a temporally regulated Caulobacter promoter by upstream and downstream sequence elements.
Mol. Microbiol.
16:279-289[Medline].
|
| 30.
|
Miller, J. H.
1972.
, p. 352-355.
Experiments in molecular genetics
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 31.
| Mohr, C. Unpublished data.
|
| 32.
|
Mohr, C. D.,
U. Jenal, and L. Shapiro.
1996.
Flagellar assembly in Caulobacter crescentus: a basal body P-ring null mutation affects stability of the L-ring protein.
J. Bacteriol.
178:675-682[Abstract/Free Full Text].
|
| 33.
|
Mullin, D.,
S. Minnich,
L. S. Chen, and A. Newton.
1987.
A set of positively regulated flagellar gene promoters in Caulobacter crescentus with sequence homology to the nif gene promoters of Klebsiella pneumoniae.
J. Mol. Biol.
195:939-943[Medline].
|
| 34.
|
Newton, A.,
N. Ohta,
G. Ramakrishnan,
D. Mullin, and G. Raymon.
1989.
Genetic switching in the flagellar gene hierarchy of Caulobacter requires negative as well as positive regulation of transcription.
Proc. Natl. Acad. Sci. USA
86:6651-6655[Abstract/Free Full Text].
|
| 35.
|
Ohkubo, S., and K. Yamaguchi.
1997.
A suppressor of mutations in the region adjacent to iterons of pSC101 ori.
J. Bacteriol.
179:2089-2091[Abstract/Free Full Text].
|
| 36.
|
Ohta, N.,
L. S. Chen,
D. A. Mullin, and A. Newton.
1991.
Timing of flagellar gene expression in the Caulobacter cell cycle is determined by a transcriptional cascade of positive regulatory genes.
J. Bacteriol.
173:1514-1522[Abstract/Free Full Text].
|
| 37.
|
O'Neill, E. A.,
R. H. Hynes, and R. A. Bender.
1985.
Recombination deficient mutant of Caulobacter crescentus.
Mol. Gen. Genet.
198:275-278[Medline].
|
| 38.
|
Pugsley, A. P.
1993.
The complete general secretory pathway in gram-negative bacteria.
Microbiol. Rev.
57:50-108[Abstract/Free Full Text].
|
| 39.
|
Quon, K. C.,
G. T. Marczynski, and L. Shapiro.
1996.
Cell cycle control by an essential bacterial two-component signal transduction protein.
Cell
84:83-93[Medline].
|
| 40.
|
Ramakrishnan, G., and A. Newton.
1990.
FlbD of Caulobacter crescentus is a homologue of the NtrC (NRI) protein and activates sigma 54-dependent flagellar gene promoters.
Proc. Natl. Acad. Sci. USA
87:2369-2373[Abstract/Free Full Text].
|
| 41.
|
Ramakrishnan, G.,
J. L. Zhao, and A. Newton.
1991.
The cell cycle-regulated flagellar gene flbF of Caulobacter crescentus is homologous to a virulence locus (lcrD) of Yersinia pestis.
J. Bacteriol.
173:7283-7292[Abstract/Free Full Text].
|
| 42.
| Reisenauer, A. Unpublished data.
|
| 43.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 44.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 45.
|
Shapiro, L.
1995.
The bacterial flagellum: from genetic network to complex architecture.
Cell
80:525-527[Medline].
|
| 46.
|
Simon, R.,
U. Piefer, and A. Puhler.
1993.
A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria.
Bio/Technology
1:784-790.
|
| 47.
|
Stephens, C.,
C. Mohr,
C. Boyd,
J. Maddock,
J. Gober, and L. Shapiro.
1997.
Identification of the fliI and fliJ components of the Caulobacter flagellar type III protein secretion system.
J. Bacteriol.
179:5355-5365[Abstract/Free Full Text].
|
| 48.
|
Stephens, C.,
A. Reisenauer,
R. Wright, and L. Shapiro.
1996.
A cell cycle-regulated bacterial DNA methyltransferase is essential for viability.
Proc. Natl. Acad. Sci. USA
93:1210-1214[Abstract/Free Full Text].
|
| 49.
|
Stephens, C. M., and L. Shapiro.
1993.
An unusual promoter controls cell-cycle regulation and dependence on DNA replication of the Caulobacter fliLM early flagellar operon.
Mol. Microbiol.
9:1169-1179[Medline].
|
| 50.
|
Wingrove, J. A., and J. Gober.
1996.
Identification of an asymmetrically localized sensor histidine kinase responsible for temporally and spatially regulated transcription.
Science
274:597-601[Abstract/Free Full Text].
|
| 51.
|
Wingrove, J. A., and J. W. Gober.
1994.
A sigma 54 transcriptional activator also functions as a pole-specific repressor in Caulobacter.
Genes Dev.
8:1839-1852[Abstract/Free Full Text].
|
| 52.
|
Wingrove, J. A.,
E. K. Mangan, and J. W. Gober.
1993.
Spatial and temporal phosphorylation of a transcriptional activator regulates pole-specific gene expression in Caulobacter.
Genes Dev.
7:1979-1992[Abstract/Free Full Text].
|
| 53.
|
Wu, J.,
A. K. Benson, and A. Newton.
1995.
Global regulation of a sigma 54-dependent flagellar gene family in Caulobacter crescentus by the transcriptional activator FlbD.
J. Bacteriol.
177:3241-3250[Abstract/Free Full Text].
|
| 54.
|
Wu, J., and A. Newton.
1997.
Regulation of the Caulobacter flagellar gene hierarchy; not just for motility.
Mol. Microbiol.
24:233-239[Medline].
|
| 55.
|
Xu, H.,
A. Dingwall, and L. Shapiro.
1989.
Negative transcriptional regulation in the Caulobacter flagellar hierarchy.
Proc. Natl. Acad. Sci. USA
86:6656-6660[Abstract/Free Full Text].
|
| 56.
|
Yamanaka, K.,
T. Mitani,
T. Ogura,
H. Niki, and S. Hiraga.
1994.
Cloning, sequencing, and characterization of multicopy suppressors of a mukB mutation in Escherichia coli.
Mol. Microbiol.
13:301-312[Medline].
|
| 57.
|
Yu, J., and L. Shapiro.
1992.
Early Caulobacter crescentus genes fliL and fliM are required for flagellar gene expression and normal cell division.
J. Bacteriol.
174:3327-3338[Abstract/Free Full Text].
|
| 58.
|
Zhuang, W. Y., and L. Shapiro.
1995.
Caulobacter FliQ and FliR membrane proteins, required for flagellar biogenesis and cell division, belong to a family of virulence factor export proteins.
J. Bacteriol.
177:343-356[Abstract/Free Full Text].
|
J Bacteriol, April 1998, p. 2175-2185, Vol. 180, No. 8
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Charbon, G., Cabeen, M. T., Jacobs-Wagner, C.
(2009). Bacterial intermediate filaments: in vivo assembly, organization, and dynamics of crescentin. Genes Dev.
23: 1131-1144
[Abstract]
[Full Text]
-
Kamal, N., Dorrell, N., Jagannathan, A., Turner, S. M., Constantinidou, C., Studholme, D. J., Marsden, G., Hinds, J., Laing, K. G., Wren, B. W., Penn, C. W.
(2007). Deletion of a previously uncharacterized flagellar-hook-length control gene fliK modulates the {sigma}54-dependent regulon in Campylobacter jejuni. Microbiology
153: 3099-3111
[Abstract]
[Full Text]
-
Muir, R. E., Easter, J., Gober, J. W.
(2005). The trans-acting flagellar regulatory proteins, FliX and FlbD, play a central role in linking flagellar biogenesis and cytokinesis in Caulobacter crescentus. Microbiology
151: 3699-3711
[Abstract]
[Full Text]
-
Mallik, P., Pratt, T. S., Beach, M. B., Bradley, M. D., Undamatla, J., Osuna, R.
(2004). Growth Phase-Dependent Regulation and Stringent Control of fis Are Conserved Processes in Enteric Bacteria and Involve a Single Promoter (fis P) in Escherichia coli. J. Bacteriol.
186: 122-135
[Abstract]
[Full Text]
-
Laub, M. T., Chen, S. L., Shapiro, L., McAdams, H. H.
(2002). Genes directly controlled by CtrA, a master regulator of the Caulobacter cell cycle. Proc. Natl. Acad. Sci. USA
99: 4632-4637
[Abstract]
[Full Text]
-
Jones, S. E., Ferguson, N. L., Alley, M. R. K.
(2001). New members of the ctrA regulon: the major chemotaxis operon in Caulobacter is CtrA dependent. Microbiology
147: 949-958
[Abstract]
[Full Text]
-
Boyd, C. H., Gober, J. W.
(2001). Temporal Regulation of Genes Encoding the Flagellar Proximal Rod in Caulobacter crescentus. J. Bacteriol.
183: 725-735
[Abstract]
[Full Text]
-
Mangan, E. K., Malakooti, J., Caballero, A., Anderson, P., Ely, B., Gober, J. W.
(1999). FlbT Couples Flagellum Assembly to Gene Expression in Caulobacter crescentus. J. Bacteriol.
181: 6160-6170
[Abstract]
[Full Text]