Lehrstuhl für Mikrobiologie,
Universität Erlangen-Nürnberg, D-91058 Erlangen, Germany
 |
TEXT |
Bacillus subtilis 168 is
unable to use sugars such as lactose, galactose, and xylose (11,
18) as its sole carbon source. This is surprising given the fact
that genes which encode the proteins necessary for the degradation of
lactose and xylose are present in B. subtilis and that these
genes are expressed under inducing conditions (2, 4). For
xylose it has been shown that this sugar is not transported inside the
cell (14).
We cloned and sequenced a B. subtilis homolog of the
Escherichia coli galE gene (16). Meanwhile, the
complete B. subtilis genome has been sequenced
(9). Besides the galE homolog, putative galK and galT genes have been identified
(5). Again, the genetic equipment of the bacterium should
allow the utilization of galactose as the sole carbon source, but
nevertheless galactose does not support growth. We were therefore
interested in whether the B. subtilis galE gene serves any
function. We were able to prove that the gene is expressed in B. subtilis 168. The transcription is not influenced by galactose but
is repressed in the presence of glucose. Galactose is not actively
transported into B. subtilis 168. Even minor amounts of
internal UDP-galactose are toxic for galE-negative B. subtilis strains. Glucose is able to alleviate the effects of
galactose but causes cell death during late log phase. One task of the
GalE protein is therefore to protect the cell from the toxic effects of
galactose and glucose or derivatives of both sugars which accumulate in
its absence.
Identification of the galE gene.
We cloned and
sequenced a B. subtilis galE homolog (16), which
encodes a protein that is 57% identical to the product of the E. coli gene. The structure of the protein from E. coli
has been solved recently (19). Fourteen of 15 amino acids
known to interact with NADH are conserved between E. coli
and B. subtilis; the only difference is at position 59 where
the E. coli protein has isoleucine and the B. subtilis protein has leucine. Of eight amino acids known to
interact with either UDP-glucose or UDP-galactose, seven are conserved,
with alanine 216 in E. coli versus serine 215 in B. subtilis. This residue is known to interact via the backbone of
the protein; therefore, the side chain of the residue is of minor
importance.
The strains and plasmids used in this study are listed in Table
1. To test whether the galE
homolog gene is functional in vivo we transformed plasmid pB8 into
galE-negative E. coli MK30-3. This plasmid was
constructed by ExoIII digestion of the galE-containing HindIII fragment described in reference
16 (EMBL gene bank accession no. X99339). The
resulting 1,677-bp fragment (nucleotide numbers 1 to 1677, as described
by Schrögel et al. [16]) was cloned into
pBluescriptII SK+ (Stratagene, La Jolla, Calif.). The transformed bacterium was able to grow on minimal media with galactose as the sole
carbon source (data not shown). This proves that the cloned gene indeed
encodes a UDP-glucose epimerase.
Regulation of galE transcription and mapping of the
galE promoter.
We wanted to test whether
galE is actively transcribed in B. subtilis 168. To do so, we constructed plasmid pEP10. This plasmid was constructed by
cloning the NciI-PvuII fragment from pB8
(nucleotide numbers 1048 to 1359 [16]) into pDH32M.
The resulting plasmid contains a transcriptional fusion of the region
upstream of galE to lacZ. pEP10 was integrated
into the amyE locus of B. subtilis 168. The
-galactosidase activity of the resulting strain in minimal media
with different carbon sources was determined as described previously
(4). Fifteen to 16 U of -galactosidase activity was
obtained, irrespective of the presence of galactose. This is
significantly higher than background activity (about 1 U under these
conditions). lacZ expression by B. subtilis EP10
was reduced to 1.3 U in the presence of glucose, whereas background
activity was reduced to 0.2 U. We were interested in whether this
effect was specific for glucose or carbon catabolite repression. We
tested a set of carbon sources known to mediate catabolite repression (7). As seen in Fig. 1, all
carbon sources known to repress xylA transcription had a
similar effect on galE transcription. In a
ccpA-negative mutant the effect was abolished. This
indicates that galE is transcribed in B. subtilis
168 under direct or indirect control of CcpA. To characterize the
promoter in detail, we mapped the 5' end of the galE
transcript by primer extension. The primer (5'
GCCAATGTAACCGGCACCGC 3') was labeled with
[
-32P]dATP and used for the primer extension reaction
as described previously (21). It hybridizes to the
translated part of the galE transcript. A signal was
obtained 27 bp upstream of the translational start codon (Fig.
2A). A sequence with homology to
A-dependent promoters was found upstream of the putative
transcriptional start site (Fig. 2B). Eight of 12 bp are conserved.
View larger version (39K):
[in this window]
[in a new window]
|
FIG. 1.
Catabolite repression of galE transcription.
B. subtilis EP10 and B. subtilis EP10ccpA were
grown in MOPSO minimal medium containing 0.5% succinate and 0.2%
concentrations of the indicated carbon sources. The LacZ activities of
the respective cultures were determined. One hundred percent
corresponds to 23 U for the wild-type strain (solid bars) and 39 U for
the ccpA-negative mutant (open bars).
|
|
View larger version (124K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Mapping of the putative transcriptional start site
by primer extension. Left side (from left to right): A, C, G, and T
lanes of a sequence reaction done with the primer extension primer.
Lanes 1 and 2, RNA isolated from two different NB medium-grown
cultures; lanes 3 and 4, RNA from cells grown on MOPSO medium without
and with galactose, respectively. A signal is obtained 27 bp upstream
of the translational start codon. (B) Sequence of the putative
galE promoter. The poly(dA) stretches upstream of the
promoter, the putative promoter sequence, and the start point of
transcription and translation are indicated.
|
|
Effects of a galE inactivation.
B. subtilis
168 is unable to grow on galactose as the sole carbon source
(18). Therefore, lack of growth on galactose is not a
specific trait for galE-negative B. subtilis
strains. We tested whether the presence of galactose has a negative
effect on galE strains. Such effects have been described for
gal mutants of E. coli and Salmonella
typhimurium (3, 10, 13, 22). To obtain a
galE-negative mutant, we constructed plasmid pEP2. This was
done by inserting the aphA3-containing SmaI
fragment from pBEST501 (8) into StyI-digested
pB8. The protruding ends were filled in with Klenow polymerase. The
resistance gene was inserted in the direction opposite to that of the
galE gene. pEP2 was linearized and transformed into B. subtilis 168 to give B. subtilis EP2. We grew B. subtilis 168 and the isogenic galE-negative derivative
in NB medium with and without 10 mM galactose. Growth of the wild type
and the mutant was similar in unsupplemented NB medium, indicating that
galE expression is not necessary in complex media. The
presence of galactose had no influence on the growth of B. subtilis 168 but caused a decrease of the cell density of B. subtilis EP2 (Fig. 3A). In
galactose-supplemented medium the mutant cells started to swell and
lysed at an optical density at 600 nm (OD600) of about 0.4 (Fig. 3C). Cell titers indicated that galactose is a bactericidal
compound for these cells; the decrease in viable-cell number is even
more pronounced than the decrease in OD (Table
2). Mutations in galK and
galT encoding galactokinase and galactose-1-phosphate
uridylyltransferase, respectively, abolish the lytic effects of the
galE mutation in S. typhimurium (17).
We tested whether the same is true for B. subtilis. To do
so, we created plasmid pKL9 by digesting plasmid pKL6 (15) with SalI and by subsequent religation. Plasmid pGK1 was
constructed to inactivate the B. subtilis galK gene.
Therefore, an internal region of the galK gene was amplified
by PCR with chromosomal B. subtilis 168 DNA as the template
(primer I: 5' GCAAACTCAATGTCTCAGGCC 3'; primer II: 5'
GTTCTCTTTGAACATATGGGCCG 3'). The resulting fragment was digested
with NruI and AccI (nucleotide numbers 36381 and 36578 [5]) and cloned into NruI- and
AccI-digested pKL9. Plasmid pGT1 was constructed to
inactivate galT. An internal fragment of galT was
amplified (primer I: 5' CGAGAAACCGTCTTTATGAAGC 3'; primer
II: 5' CACCGTCCAATGAACATTTTTGG 3'), digested with
AvaI and EcoRI (nucleotide numbers 37050 and
37282 [5]), and ligated to EcoRI- and
AvaI-digested pKL9. We inactivated galK and
galT by a single crossover and determined the effects of
galactose on the respective mutants and on mutants with a defect in
galE and additionally with a defect in galK or
galT. As seen in Fig. 3B galactose had no effect on either
the galT- or the galK-defective strain.
Furthermore, the toxic effect of galactose on galE-negative strains was abolished or at least reduced if galK or
galT was also inactivated. This experiment indicates that
none of the gal genes is cryptic because inactivation of any
of the genes had an effect on the phenotype, at least in media with
galactose. The toxic effect of galactose is most likely mainly due to
UDP-galactose or a derivative thereof, because it is observed only in
the presence of galactose and is reduced or completely abolished if the
synthesis of this compound is inhibited by the inactivation of
galT or galK. Neither the galT nor the
galK mutation alone had a toxic effect on growth in the
presence of galactose (Table 2). Therefore, it is unlikely that the
amounts of galactose-phosphate which are present in the galT
strain are toxic for B. subtilis. In a second set of
experiments we tested the influence of glucose on
galE-negative mutants. Glucose is able to suppress the
effects of galactose on galE-negative enterobacteria because
of catabolite repression (17, 22). The toxic effects of
galactose on B. subtilis are also reduced by the presence of
glucose (data not shown). But in contrast to what is found for
enterobacteria, glucose itself is toxic for B. subtilis galE
mutants. At the end of the exponential growth phase the cells do not
lyse (data not shown) but nevertheless die rapidly in the presence of
glucose (Table 3 and Fig.
4). Taken together, these results
indicate that GalE is per se not necessary for the growth of B. subtilis 168 in complex media. It is necessary only in the
presence of either glucose or galactose. In the presence of both
glucose and galactose the galE-negative strain is able to
synthesize every compound which is synthesized by the activity of
UDP-glucose epimerase in wild-type galE strains. But the
addition of both sugars at one time is nevertheless lethal. Therefore,
the effects of the mutation are not due to the fact that a compound
necessary for survival is missing. Although it is likely that GalE
serves in a biosynthetic role in the cell, our results rule out an
unanticipated biosynthetic function of GalE which is necessary for the
survival of the cells in the absence of galactose or glucose. They
strongly argue for the hypothesis that B. subtilis produces
compounds in the presence of glucose and galactose which are removed by
the activity of GalE. If these compounds are not removed the cell is
bound to die.
View larger version (85K):
[in this window]
[in a new window]
|
FIG. 3.
(A) Growth of different B. subtilis strains
in NB medium and NB medium supplemented with galactose. B. subtilis 168 and B. subtilis EP2 were diluted in NB
medium to an OD600 of 0.1. The cell suspensions were
divided into two parts, and galactose was added to one part. Solid
symbols, growth in NB medium; open symbols, growth in NB medium
supplemented with galactose; circles, B. subtilis 168;
squares, B. subtilis EP2. (B) Growth of B. subtilis with mutations in different gal genes on NB
medium with galactose. Bacteria were resuspended in media containing
galactose to an OD600 of 0.02. Circles, B. subtilis 168; inverted triangles, B. subtilis EP2;
squares, B. subtilis GK1; diamonds, B. subtilis
GT1; hexagons, B. subtilis EP2GT1; triangles, B. subtilis EP2GK1. The numbers of CFU were determined at the
indicated times (arrows; see Table 2). (C) Cell morphology of bacteria
grown on NB medium containing galactose. Left panel, B. subtilis 168; right panel, B. subtilis EP2.
|
|
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Growth of different B. subtilis strains in NB
medium and NB medium supplemented with glucose. Solid symbols, growth
in NB medium; open symbols, growth in NB medium supplemented with
glucose; circles, B. subtilis 168; inverted triangles,
B. subtilis EP2. The numbers of CFU were determined at the
indicated times (see Table 3).
|
|
Metabolic intermediates in galactose-grown B. subtilis
EP2.
For enterobacteria it is believed that the toxic effects of
galactose are due to the accumulation of galactose-1-phosphate and
UDP-galactose (10, 13). We tested whether B. subtilis 168 and B. subtilis EP2 are able to transport
galactose. While we were able to demonstrate galactose accumulation by
E. coli, only background levels were obtained for B. subtilis in an identical assay (data not shown). Nevertheless, we
grew different B. subtilis strains in media containing
radioactively labeled galactose.
Cells were grown to an OD600 of 0.2 in NB medium at 37°C.
Then 0.2% unlabeled galactose (final concentration) and 5 × 106 cpm of labeled galactose (final concentration,
105 cpm/ml) were added, and the bacteria were incubated for
another 60 min. The cells were concentrated by centrifugation and
washed thoroughly in -mercaptoethanol-free Z buffer (12).
The cells were lysed by sonication, and the protein concentration of
the supernatant was determined. Equal amounts of supernatant were analyzed by thin-layer chromatography. The samples were fractionated on
SilicaGel 60 (Merck, Darmstadt, Germany) with a mixture of n-butanol, ethanol, and H2O (5:3:2) in the
liquid phase. The plates were dried and exposed against a BAS-III
imaging plate (Fuji Photo Film Co., Tokyo, Japan). The sugars were
additionally stained with a mixture of
p-anisaldehyde, acetic acid, methanol, and
H2SO4 (1:20:340:10), which allows both
detection of sugars and their differentiation by color (6).
To differentiate between sugar acids and phosphorylated sugars, the
samples were treated with either trifluoroacetic acid (TFA) or
alkaline phosphatase to remove PO43
groups
and analyzed as described above.
The result of this experiment is depicted in Fig.
5A. Several different galactose
derivatives were obtained from the strain with mutant galE
and from the strain with mutant galE and galT. One band migrated similarly to UDP-galactose, and one band migrated similarly to galactose-1-phosphate. A third band migrated slower than
galactose-1-phosphate (Fig. 5A). To determine the chemical natures of
the respective compounds, we treated the samples with phosphatase.
After that treatment the two bands which migrated similarly to and
slower than galactose-1-phosphate both migrated like galactose,
indicating that these bands are galactose phosphates. We do not know
whether the two bands are due to different forms of galactose phosphate
or indicate different numbers of phosphates linked to one galactose.
The band that migrated like UDP-galactose was not impaired by that
treatment (Fig. 5B). TFA treatment removed the modification linked to
galactose in this band (Fig. 5C), indicating that this modification is
linked via an acid-labile ester to galactose. Treatment with
UDP-glucose epimerase and subsequent TFA hydrolysis resulted in two
spots, galactose and glucose (data not shown). Therefore, the original
spot is indeed UDP-galactose.
View larger version (96K):
[in this window]
[in a new window]
View larger version (105K):
[in this window]
[in a new window]
View larger version (66K):
[in this window]
[in a new window]
|
FIG. 5.
(A) Analysis of galactose derivatives accumulated in
B. subtilis galE-negative strains. The respective strains
were fed with 14C-labeled galactose. A cell suspension with
an OD600 of 1 was sonicated, and the supernatant was
analyzed by thin-layer chromatography. The chromatograms were developed
and compared to chromatograms of pure reagents. Lane 1, B. subtilis EP2GK1; lane 2, B. subtilis EP2; lane 3, B. subtilis EP2GT1; lane 4, B. subtilis 168. (B)
Analysis of galactose derivatives after treatment with phosphatase.
Lanes 1, 4, and 7, untreated samples; lanes 2, 5, and 8, phosphatase-treated samples; lanes 3, 6, and 9, samples in phosphatase
buffer without phosphatase. Lanes 1 to 3, B. subtilis
EP2GK1; lanes 4 to 6, B. subtilis EP2GT1; lanes 7 to 9, B. subtilis EP2. The two lower bands are converted to
galactose by the treatment. (C) Analysis of galactose derivatives after
treatment with TFA. Lane 1, B. subtilis EP2GK1; lane 2, B. subtilis EP2GT1; lane 3, B. subtilis EP2; All
bands are converted to galactose by that treatment.
|
|
We quantified the amounts of the respective compounds. To do so, we
determined the amount of radioactivity in each single spot of the
thin-layer chromatography plate. For this determination, 104 cpm corresponded to 1 µmol of galactose. The amount
of radioactivity was divided by the number of cells loaded on the
respective lane. To obtain galactose concentrations, it was assumed
that a single cell has a volume of 1 µm3 (20).
Whereas we were unable to detect any momomeric galactose derivatives in
wild-type B. subtilis, B. subtilis EP2 had
internal concentrations of 0.2 µM galactose-phosphate and 0.2 µM
UDP-galactose. B. subtilis EP2GT1, whose growth is only
slightly impaired by the presence of galactose, accumulated 0.4 µM
galactose phosphate. The concentration of these compounds within the
cell is therefore less than 1 µM. This is low compared to the
external galactose concentration of 10 mM and is in accordance with the
fact that there is no active import of galactose in the cell. This
concentration is comparable to the bacteriotoxic concentrations of
antibiotics. The antibiotic tetracycline, which is able to cross the
membrane, accumulates to a concentration of about 1 µM inside the
cell (14a). This concentration is lethal for the cell.
Therefore UDP-galactose is as toxic as the antibiotic tetracycline.
Conclusion.
The results presented in this paper prove that the
galE gene of B. subtilis is essential for growth
in media containing either glucose or galactose. This is not due to the
fact that metabolic intermediates are not produced in the absence of
GalE, because this effect is not abolished in the presence of both
sugars. Therefore, the presence and not the absence of such an
intermediate is the reason for the toxic effect. In the presence of
galactose this compound is most likely UDP-galactose. Even very small
amounts of UDP-galactose seem to be toxic for B. subtilis.
The molecular reason for this toxicity is unknown.
This work was supported by the DFG (via Schwerpunkt Molekulare Analyse
von Regulationsnetzwerken in Bakterien).
| 1.
|
Dahl, M. K., and W. Hillen.
1995.
Contributions of XylR, CcpA and Hpr to catabolite repression of the xyl operon in Bacillus subtilis.
FEMS Microbiol. Lett.
132:79-83.
|
| 2.
|
Errington, J., and C. H. Vogt.
1990.
Isolation and characterization of mutations in the gene encoding an endogenous Bacillus subtilis beta-galactosidase and its regulator.
J. Bacteriol.
172:488-490[Abstract/Free Full Text].
|
| 3.
|
Fukasawa, T., and H. Nikaido.
1961.
Galactose-sensitive mutants of Salmonella. II. Bacteriolysis induced by galactose.
Biochim. Biophys. Acta
48:470-483[Medline].
|
| 4.
|
Gärtner, D.,
M. Geissendorfer, and W. Hillen.
1988.
Expression of the Bacillus subtilis xyl operon is repressed at the level of transcription and is induced by xylose.
J. Bacteriol.
170:3102-3109[Abstract/Free Full Text].
|
| 5.
|
Glaser, P.,
F. Kunst,
M. Arnaud,
M. P. Coudart,
W. Gonzales,
M. F. Hullo,
M. Ionescu,
B. Lubochinsky,
L. Marcelino,
I. Moszer,
E. Presecan,
M. Santana,
E. Schneider,
J. Schweizer,
A. Vertes,
G. Rapoport, and A. Danchin.
1993.
Bacillus subtilis genome project: cloning and sequencing of the 97 kb region from 325 degrees to 333 degrees.
Mol. Microbiol.
10:371-384[Medline].
|
| 6.
|
Haußmann, W.
1994.
.
Ph.D. thesis.
Universität Tübingen, Tübingen, Germany.
|
| 7.
|
Hueck, C. J.,
A. Kraus,
D. Schmiedel, and W. Hillen.
1995.
Cloning, expression and functional analyses of the catabolite control protein CcpA from Bacillus megaterium.
Mol. Microbiol.
16:855-864[Medline].
|
| 8.
|
Itaya, M.,
K. Kondo, and T. Tanaka.
1989.
A neomycin resistance cassette selectable in a single copy state in the Bacillus subtilis chromosome.
Nucleic Acids Res.
17:4410[Free Full Text].
|
| 8a.
|
Kramer, W.,
V. Drutsa,
H. W. Jansen,
B. Kramer,
M. Pflugfelder, and H. J. Fritz.
1984.
The gapped duplex DNA approach to oligonucleotide-directed mutation construction.
Nucleic Acids Res.
12:9441-9456[Abstract/Free Full Text].
|
| 8b.
|
Kraus, A.,
C. Hueck,
D. Gartner, and W. Hillen.
1994.
Catabolite repression of the Bacillus subtilis xyl operon involves a cis element functional in the context of an unrelated sequence, and glucose exerts additional xylR-dependent repression.
J Bacteriol.
176:1738-1745[Abstract/Free Full Text].
|
| 9.
|
Kunst, F.,
N. Ogasawara,
I. Moszer,
A. M. Albertini,
G. Alloni,
V. Azevedo,
M. G. Bertero,
P. Bessieres,
A. Bolotin,
S. Borchert,
R. Borriss,
L. Boursier,
A. Brans,
M. Braun,
S. C. Brignell,
S. Bron,
S. Brouillet,
C. V. Bruschi,
B. Caldwell,
V. Capuano,
N. M. Carter,
S. K. Choi,
J. J. Codani,
I. F. Connerton,
A. Danchin, et al.
1997.
The complete genome sequence of the gram-positive bacterium Bacillus subtilis.
Nature
390:249-256[Medline].
|
| 10.
|
Kurahashi, K., and A. J. Wahba.
1958.
Interference of growth with certain Escherichia coli mutants by galactose.
Biochim. Biophys. Acta
30:298-302[Medline].
|
| 11.
|
Lindner, C.,
J. Stülke, and M. Hecker.
1994.
Regulation of xylanolytic enzymes in Bacillus subtilis.
Microbiology
140:753-757[Abstract].
|
| 12.
|
Miller, J. H.
1972.
.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 13.
|
Nikaido, H.
1961.
Galactose-sensitive mutants of Salmonella. I. Metabolism of galactose.
Biochim. Biophys. Acta
48:460-469[Medline].
|
| 14.
|
Schmiedel, D., and W. Hillen.
1996.
A Bacillus subtilis 168 mutant with increased xylose uptake can utilize xylose as sole carbon source.
FEMS Microbiol. Lett.
135:175-178.
|
| 14a.
| Scholz, O. Personal communication.
|
| 15.
|
Schrögel, O., and R. Allmansberger.
1997.
Optimisation of the BgaB reporter system: determination of transcriptional regulation of stress responsive genes in Bacillus subtilis.
FEMS Microbiol. Lett.
153:237-243[Medline].
|
| 16.
|
Schrögel, O.,
O. Krispin, and R. Allmansberger.
1996.
Expression of a pepT homologue from Bacillus subtilis.
FEMS Microbiol. Lett.
145:341-348[Medline].
|
| 17.
|
Shuster, C. W., and K. Rundell.
1969.
Resistance of Salmonella typhimurium mutants to galactose death.
J. Bacteriol.
100:103-109[Abstract/Free Full Text].
|
| 18.
|
Steinmetz, M.
1993.
Carbohydrate metabolism: pathways, enzymes, genetic regulation, and evolution, p. 157-170. In
A. Sonenshein, J. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria.
American Society for Microbiology, Washington, D.C.
|
| 19.
|
Thoden, J. B.,
P. A. Frey, and H. M. Holden.
1996.
Crystal structures of the oxidized and reduced forms of UDP-galactose 4-epimerase isolated from Escherichia coli.
Biochemistry
35:2557-2566[Medline].
|
| 20.
|
Whatmore, A. M., and R. H. Reed.
1990.
Determination of turgor pressure in Bacillus subtilis: a possible role for K+ in turgor regulation.
J. Gen. Microbiol.
136:2521-2526[Medline].
|
| 21.
|
Williams, J. G., and P. J. Mason.
1985.
Hybridisation in the analysis of RNA, p. 139-160. In
B. D. Hames, and S. J. Higgins (ed.), Nucleic acid hybridisation, a practical approach.
IRL Press, Oxford, United Kingdom.
|
| 22.
|
Yarmolinsky, M. B.,
H. Wiesmeyer,
H. M. Kalckar, and E. Jordan.
1959.
Hereditary defects in galactose metabolism in Escherichia coli mutants. II. Galactose-induced sensitivity.
Proc. Natl. Acad. Sci. USA
45:1786-1791[Free Full Text].
|
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Text
