Previous Article | Next Article 
J Bacteriol, May 1998, p. 2402-2408, Vol. 180, No. 9
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Regulatory Conservation and Divergence of
32 Homologs from Gram-Negative Bacteria: Serratia
marcescens, Proteus mirabilis, Pseudomonas
aeruginosa, and Agrobacterium tumefaciens
Kenji
Nakahigashi,
Hideki
Yanagi, and
Takashi
Yura*
HSP Research Institute, Kyoto Research Park,
Kyoto 600, Japan
Received 10 November 1997/Accepted 27 February 1998
 |
ABSTRACT |
The heat shock response in Escherichia coli is mediated
primarily by the rpoH gene, encoding
32,
which is specifically required for transcription of heat shock genes. A
number of
32 homologs have recently been cloned from
gram-negative bacteria that belong to the gamma or alpha subdivisions
of the proteobacteria. We report here some of the regulatory features
of several such homologs (RpoH) expressed in E. coli as
well as in respective cognate bacteria. When expressed in an E. coli
rpoH strain lacking its own
32, these homologs activated the transcription of heat
shock genes (groE and dnaK) from the start
sites normally used in E. coli. The level of RpoH in
Serratia marcescens and Pseudomonas aeruginosa cells was very low at 30°C but was elevated markedly upon a shift to
42°C, as found previously with E. coli. The increased
RpoH levels upon heat shock resulted from both increased synthesis and
stabilization of the normally unstable RpoH protein. In contrast, the
RpoH level in Proteus mirabilis was relatively high at
30°C and increased less markedly upon heat shock, mostly by increased synthesis; this
32 homolog was already stable at 30°C,
and little further stabilization occurred upon the shift to 42°C. The
increased synthesis of RpoH homologs in all these gamma proteobacteria
was observed even in the presence of rifampin, suggesting that the
induction occurred at the level of translation. Thus, the basic
regulatory strategy of the heat shock response by enhancing the RpoH
level is well conserved in the gamma proteobacteria, but some
divergence in the actual mechanisms used occurred during evolution.
 |
INTRODUCTION |
Induction of heat shock proteins
represents a ubiquitous and homeostatic cellular response to cope with
the accumulation of unfolded and misfolded proteins following exposure
to heat or other stresses. In Escherichia coli, the
induction occurs primarily by activating the transcription of heat
shock genes by a transient increase in the cellular level of
32 (10), encoded by the rpoH gene
(8, 36). The level of
32 during steady-state
growth is very low (ca. 10 to 30 molecules per cell at 30°C
[4]) due to the extreme instability (half life, 1 min)
and restricted translation of rpoH mRNA (8, 37). Upon exposure to higher temperatures (e.g., 42°C), both rapid stabilization of
32 and translational activation of
rpoH mRNA result in a marked and transient increase in the
32 level, which in turn activates the transcription of
heat shock genes such as those encoding molecular chaperones (e.g.,
DnaK and GroEL) and ATP-dependent proteases (e.g., Lon and ClpP)
(7, 8). Whereas stabilization of
32 is
thought to occur by accumulation of partially unfolded proteins that
can titrate chaperones away from
32 (2, 4),
translational activation probably occurs by resolving extensive mRNA
secondary structure formed under nonstress conditions (17, 37,
38).
Previous work on heat-induced synthesis of
32-
-galactosidase fusion protein in E. coli revealed that two proximal coding regions (A and B) of
rpoH mRNA are involved in translational control of
32 synthesis (17, 37). Region A is similar to
the "downstream box," which is complementary to part of 16S rRNA
(27), and acts as a positive element by enhancing
translation, whereas region B is a negative element which forms an
extensive secondary structure with region A. In addition, a segment of
32 (region C; around residues 122 to 144 [18]) that corresponds to an area further downstream
of rpoH was shown to be important for the DnaK/DnaJ-mediated
negative feedback control of the heat shock response (28, 30,
31). Region C affects both the synthesis and stability of the
fusion protein (18, 37), presumably by providing sites for
interaction with DnaK (14).
Recent work in this and other laboratories led to the isolation and
characterization of rpoH genes encoding
32
(RpoH) homologs from a number of gram-negative bacteria (1, 5, 6,
16, 19-23, 25, 34). Some of them were isolated by directly
selecting for clones that can complement the defects of an E. coli
rpoH mutant which grows only at or below 20°C (1, 19, 21). Comparison of nucleotide and amino acid sequences among
these homologs revealed several conserved sequences that seemed to be
of regulatory importance for the heat shock response. Specifically,
both downstream box and predicted mRNA secondary structures similar to
those seen in E. coli were found among the homologs from
most members of the gamma but not alpha proteobacteria (1, 19, 34,
36). Besides, a stretch of 9 amino acid residues, highly
conserved among all
32 homologs but absent in other
factors (designated the RpoH box [19, 36]), was
detected within region C, implicated in the chaperone-mediated feedback
control (18; see above). These interesting developments prompted us to examine the regulatory roles of
32 homologs in the heat shock response of some of the
representative bacteria.
In this report, we analyzed the regulatory and functional properties of
32 homologs (RpoH) both in E. coli and in
cognate bacteria. Several members of the gamma proteobacteria (E. coli, Serratia marcescens, Proteus
mirabilis, and Pseudomonas aeruginosa) and one of the alpha proteobacteria (Agrobacterium tumefaciens) were chosen
for this study. The ability of these rpoH homologs to
complement, at least partially, the growth defect of the E. coli
rpoH mutant had suggested that they can be expressed to
appreciable extents in E. coli and can functionally replace
32 to varying degrees. Such expectations were fully
supported by the present results. Most significantly, they revealed
substantial conservation and some divergence in the regulatory strategy
of
32 homologs, particularly among the gamma
proteobacteria.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and phages.
E. coli K-12
strain KY1608 (MC4100
rpoH30::Kan
zhf-50::Tn10), which was originally
used for cloning of rpoH homologs (19), was
employed to study their expression and function. Either charomid 9-36 or pTRC99A was used to express rpoH homologs from their
authentic promoter(s) or trc promoter, respectively. Other
strains used were S. marcescens ATCC 264, P. mirabilis PM-1, P. aeruginosa ATCC 10145, and A. tumefaciens GV3101, obtained from A. Oka, Kyoto University.
i21 nin5 was provided by H. Inokuchi;
other phages and plasmids were obtained from commercial sources.
Media and chemicals.
Luria-Bertani (LB) broth
(32) was generally used for growing cells. The minimal
medium used was medium E supplemented with 0.5% glucose and 2 µg of
thiamine per ml (32); it was further enriched with LB broth
(final concentration, 1%) for some experiments. L-[35S]methionine (29.6 TBq/mmol) was
obtained from American Radiochemicals, and other chemicals were
obtained from Nacalai Tesque (Kyoto, Japan) or Wako Pure Chemicals
(Osaka, Japan).
Radioactive labeling of proteins.
Exponentially growing
cells in synthetic medium were pulse-labeled with
[35S]methionine (3.7 MBq/ml), treated with 5%
trichloroacetic acid, washed with acetone, dissolved in buffer
containing sodium dodecyl sulfate (SDS) and EDTA, and analyzed by
SDS-polyacrylamide gel electrophoresis (PAGE) as described previously
(35). To determine protein stability, pulse-labeled cells
were further incubated with excess unlabeled methionine (200 µg/ml),
harvested, and disrupted for analysis by immunoprecipitation and
SDS-PAGE.
Immunoprecipitation and immunoblotting.
Immunoprecipitation
of labeled proteins was carried out essentially as described previously
(35) with specific antisera against E. coli
32. Cells that produced a truncated form of
32 were labeled with [35S]methionine and
used as an internal reference to correct for differential recovery.
Immunoblotting was also done as described previously (35)
with a Hybond-ECL nitrocellulose membrane filter (Amersham).
Quantification of protein bands following immunoprecipitation was
performed with a BAS2000 BioImaging analyzer (Fuji Film, Tokyo, Japan).
Other methods.
Nucleic acid manipulation (24) and
SDS-PAGE (35) were performed as described previously.
 |
RESULTS |
Induction of E. coli heat shock proteins mediated by
32 homologs.
A set of E. coli
(
rpoH) strains carrying each of the
32
homologs on a multicopy charomid was examined by pulse-labeling cells with [35S]methionine at 30°C or after a shift to 42°C
and by analyzing the synthesis rates of heat shock proteins by SDS-PAGE
(10% polyacrylamide gel). The strains carrying an rpoH
homolog of S. marcescens (Fig. 1b) or of P. mirabilis (Fig.
1c) exhibited heat induction of DnaK and GroEL, with maximum induction
at around 5 min, much like the control strain carrying E. coli
rpoH (Fig. 1a), although the induction was less pronounced with
the P. mirabilis homolog. A similar result was obtained with
the homolog of P. aeruginosa (data not shown). Thus,
rpoH homologs from the gamma proteobacteria can support not
only the basal-level synthesis of heat shock proteins but also enhanced
synthesis upon exposure to high temperature. It appeared that the
levels of expression and function of these homologs were appreciable
though somewhat variable. In contrast, the strain carrying the
rpoH homolog of A. tumefaciens (alpha
subdivision) (Fig. 1d) exhibited weak and delayed induction of heat
shock proteins, suggesting that the synthesis and/or function of this
homolog may be restricted in E. coli.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1.
Induction of heat shock proteins in the E. coli
rpoH mutant (KY1608) harboring a charomid 9-36 that contains
each of the rpoH homologs. The cells were grown in synthetic
medium to mid-log phase at 30°C and shifted to 42°C at time zero.
Samples were taken at intervals, pulse-labeled with
[35S]methionine for 1 min, and treated with
trichloroacetic acid, and whole-cell proteins were analyzed by SDS-PAGE
(7.5% polyacrylamide gel). Radioactivities associated with bands of
GroEL ( ) and DnaK ( ) were quantified with a BioImaging analyzer
(BAS2000) and plotted against time after normalization to the zero time
value. (a) E. coli; (b) S. marcescens; (c)
P. mirabilis; (d) A. tumefaciens.
|
|
Transcription of E. coli heat shock genes mediated by
32 homologs.
To determine the exact start sites of
transcription mediated by the
32 homologs, the same set
of E. coli
rpoH strains but carrying each rpoH
homolog under the trc promoter on a multicopy pTRC99A plasmid were grown in LB broth at 30°C. RNA was extracted from these
cells and subjected to primer extension analysis to examine the
groE and dnaK transcripts. Both groE
and dnaK transcription mediated by these homologs were
clearly initiated from sites identical to those used by E. coli
32 (3); P1 for groE
(Fig. 2a) and P1, P2, and P3 for
dnaK (Fig. 2b). The plasmid carrying E. coli rpoH
markedly enhanced the levels of these transcripts over the wild type
(compare lanes 1 and 2). All transcripts except for the groE
P2 transcript mediated by
70 were lacking in the
parental
rpoH mutant (reference 39 and data not shown). The relative amounts of these transcripts from individual promoters were similar among different homologs within the
gamma subdivision; however, the dnaK P2 transcript was
specifically reduced (five- to sixfold) in the strain carrying A. tumefaciens RpoH. The latter finding is probably due to the
reduced efficiency of transcription from this particular promoter by
E. coli RNA polymerase containing A. tumefaciens
RpoH.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
Transcription start sites of the E. coli heat
shock genes (groE and dnaK) used by RpoH
homologs. Cells of MC4100 (rpoH+) or KY1608
( rpoH) harboring pTRC99A-rpoH that expresses
each of the RpoH homologs from the trc promoter were grown
in LB broth at 30°C (without
isopropyl- -D-thiogalactopyranoside [IPTG]), and RNA
was extracted and hybridized with 32P-labeled primer for
the 5' ends of groE (ATTCATTGATAACTCTCCTTT) or
dnaK (TAGTACCCAGGTCGATACC) transcripts. The
primer extension products obtained were applied to a DNA sequencing gel
(6% polyacrylamide), and relevant portions of the gels
(autoradiograms) are presented. (a) groE transcripts; (b)
dnaK transcripts. The amounts (in micrograms) of RNA
hybridized for each lane are shown at the top, and start sites for the
known promoters in E. coli (3) are indicated to
the right. Lanes: 1, MC4100 (wild type); 2, KY1608 expressing RpoH
(E. coli); 3, KY1608 expressing RpoH (S. marcescens); 4, KY1608 expressing RpoH (P. aeruginosa);
5, KY1608 expressing RpoH (A. tumefaciens).
|
|
Marked increase in the level of the
32 homolog upon
heat shock.
We then asked whether each of the homologs can respond
to high temperature by enhancing its level as observed in E. coli. Immunoblotting of the RpoH homolog by using antiserum
against E. coli
32 was carried out with
standard strains of bacteria from which the respective homologs were
originally isolated. In S. marcescens, the RpoH level was
very low at 30°C but was markedly and transiently elevated upon heat
shock, as in E. coli (Fig.
3b). A similar response was observed in
P. aeruginosa (Fig. 3d). In contrast, the RpoH level in
P. mirabilis was relatively high at 30°C and only modestly enhanced upon the shift to 42°C (Fig. 3c). A similar heat-induced increase in the levels of the
32 homologs was observed
with a set of E. coli
rpoH strains carrying each
heterologous rpoH on a single-copy
prophage, although
the amounts of homolog (particularly of P. mirabilis)
produced were apparently smaller than those in the standard strains
(Fig. 3e to f). We failed to determine the unequivocal response of RpoH of P. aeruginosa in E. coli or the response of
A. tumefaciens RpoH, presumably because of the low
expression and/or low cross-reactivities of these homologs to the
antibodies used (data not shown). In spite of this limitation, these
results clearly indicated that the heat-induced increase in the RpoH
level is basically conserved as a primary cellular response to
temperature upshift, at least within the gamma proteobacteria.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 3.
Enhancement of the RpoH level during the heat shock
response. Cells were grown to mid-log phase in enriched medium E at
30°C and were shifted to 42°C. Samples were taken at the times
indicated, and whole-cell proteins (5 µg/lane) were separated by
SDS-PAGE (12.5% polyacrylamide gel) and immunoblotted with antiserum
against E. coli 32. Arrowheads indicate the
positions of RpoH homologs. (a) E. coli MC4100; (b) S. marcescens; (c) P. mirabilis; (d) P. aeruginosa; (e) KY1608 ( i21 nin5 rpoH
[S. marcescens]); (f) KY1608 ( i21
nin5 rpoH [P. mirabilis]).
|
|
Heat-induced synthesis of
32 homologs of the gamma
proteobacteria.
The mechanism underlying the increased RpoH level
in the above strains was further investigated by examining the
synthesis rate of each homolog upon heat shock. Cells were
pulse-labeled with [35S]methionine before and after the
temperature upshift, and RpoH proteins were analyzed by
immunoprecipitation and SDS-PAGE. All three members of the gamma
proteobacteria exhibited essentially identical responses, showing a
marked and transient increase in synthesis rates, as in E. coli
32, with maximum induction occurring at about
4 min. The extents of induction varied significantly and reproducibly:
seven- to eightfold for S. marcescens, three- to fourfold
for P. mirabilis, and five- to sixfold for P. aeruginosa (Fig. 4b to d).
Quantitatively similar results were obtained with the set of E. coli
rpoH strains carrying the
prophage that can express
each homolog from the cognate promoter(s) (Fig. 4e to g). Thus,
heat-induced synthesis of RpoH appears to be a well-conserved mechanism
that contributes to the transcriptional activation of heat shock genes
in the gamma proteobacteria.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 4.
Induction of RpoH synthesis upon heat shock. Cells were
grown at 30°C and shifted to 42°C as in the experiment in Fig. 3.
Samples were taken at the times indicated and pulse-labeled with
[35S]methionine for 30 s. Whole-cell proteins were
immunoprecipitated with antiserum against 32, subjected
to SDS-PAGE, and visualized with a BioImaging analyzer (BAS2000).
Portions of the gels are presented below each graph; each lane
corresponds to the time at which the sample was taken. Solid and open
arrowheads indicate 32 homologs and truncated E. coli 32 (reference), respectively. Synthesis rates
were calculated after correction for the recovery and normalized to the
zero time value. (a) E. coli MC4100; (b) S. marcescens; (c) P. mirabilis; (d) P. aeruginosa; (e) KY1608 ( i21 nin5 rpoH
[S. marcescens]); (f) KY1608 ( i21
nin5 rpoH [P. mirabilis]); (g) KY1608
( i21 nin5 rpoH [P.
aeruginosa]).
|
|
Heat-induced synthesis of
32 homologs occurs at the
level of translation.
To address the question whether the
increased synthesis of
32 homologs occurs at the
translational rather than the transcriptional level, we asked if the
synthesis of homologs increases upon temperature upshift even in the
presence of rifampin, which specifically inhibits RNA synthesis. The
previous results of similar experiments with E. coli gave
strong support to the translational control model (17). When
cells of S. marcescens, P. mirabilis, and
P. aeruginosa were grown at 30°C and shifted to 42°C in
the presence and absence of rifampin, increased synthesis of RpoH was
observed even in the presence of rifampin (Fig.
5). Rifampin is known to inhibit RNA
synthesis (by 95%) within 3 min in E. coli under similar
conditions (17), and no increase in the rpoH mRNA
levels occurred in any of the strains examined (data not shown). These
results therefore suggested strongly that the synthesis of RpoH is
repressed under nonstress conditions and is markedly derepressed at the
level of translation upon heat shock, as had previously been
demonstrated in E. coli (8, 12, 17, 29, 37). The
data are also consistent with the conserved secondary structure of
rpoH mRNA of the gamma proteobacteria predicted from
sequence analyses (19).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 5.
Induction of RpoH synthesis in the presence and absence
of rifampin. Log phase cells grown in enriched medium E at 30°C were
divided into three aliquots. After 1 min, rifampin was added to one
aliquot (final concentration, 200 µg/ml) and shaken for 1 min; two
aliquots (with and without rifampin) were shifted to 42°C, while the
third (without rifampin) was kept at 30°C. After incubation for 3 min, all aliquots were pulse-labeled with [35S]methionine
for 1 min and whole-cell proteins were isolated and analyzed by
immunoprecipitation and SDS-PAGE as in the experiment in Fig. 4.
Radioactivities were quantified, corrected for the recovery, and
normalized to the 30°C control. HS, heat shock at 42°C; rif,
rifampin. Lanes: 1 to 3, E. coli MC4100; 4 to 6, S. marcescens; 7 to 9, P. mirabilis; 10 to 12, P. aeruginosa.
|
|
Heat-induced stabilization of
32 homologs.
Finally, we examined the stability of
32 homologs before
and after temperature upshift by pulse-chase experiments. The homologs in S. marcescens and P. aeruginosa were found to
be unstable at 30°C, with half lives of 0.7 and 2.5 min, respectively
(Fig. 6b and d), much like E. coli
32 (half life, 1.3 min) (Fig. 6a), and were
markedly stabilized upon shift to 42°C. In contrast, RpoH of P. mirabilis was found to be quite stable (half life, 40 min) at
30°C and slightly more stabilized upon shift to 42°C (Fig. 6c).
This agreed well with the constitutively high RpoH level at 30°C,
with a modest increase upon heat shock (Fig. 3c). When these RpoH
homologs were expressed in E. coli, quite different results
were obtained: whereas RpoH of S. marcescens showed
significantly slower degradation at 30°C (Fig. 6e), that of P. mirabilis showed much faster degradation, particularly at 30°C
(half-life, 3 min) (Fig. 6f). These results indicate that although the
instability of RpoH under nonstress conditions and rapid stabilization
upon temperature upshift appear to be conserved, the actual half-lives
and extents of stabilization can vary considerably, an extreme example
being P. mirabilis RpoH, which virtually lost the mechanism
of controlling its stability during the heat shock response, at least
under the set of conditions used.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 6.
Stability of RpoH homologs at 30°C and after the shift
to 42°C. Log-phase cultures grown in enriched medium E at 30°C were
divided into two portions, and each was pulse-labeled with
[35S]methionine for 30 s and chased for 1 min with
excess unlabeled methionine; one was kept at 30°C, and the other was
shifted to 42°C. Samples were taken at the times indicated and
subjected to analysis by immunoprecipitation and SDS-PAGE, and the
radioactivities associated with RpoH bands were visualized and
quantified as in the experiment in Fig. 4. Panels a to f are the same
as in Fig. 4. Portions of the gels are presented below each graph; the
left and right halves represent data obtained at 30 and 42°C,
respectively. Each lane corresponds to the time at which the sample was
taken. Symbols: , 30°C; , 42°C.
|
|
 |
DISCUSSION |
The
32 homologs of the gamma subdivision analyzed
here exhibit 65 to 80% identity in amino acid sequence to E. coli
32 and ca. 45% identity between E. coli and the alpha proteobacteria (19). As expected,
the sequence similarity was particularly high for the conserved regions
2.4 and 4.2, which are involved in promoter recognition, and the
regions 2.1 and 2.2, which are involved in binding to core RNA
polymerase (9). Such high conservation is consistent with
the fact that these homologs can at least partly replace
32, presumably by catalyzing specific transcription from
heat shock promoters when expressed in E. coli (1, 16,
19-23, 34). In line with the structural and functional
similarities, all RpoH homologs tested, including that of A. tumefaciens, were able to induce the DnaK and GroE heat shock
proteins to appreciable although variable extents (Fig. 1).
Furthermore, they were shown to initiate transcription from start sites
identical to those used by E. coli
32,
although the efficiency was low in certain cases (Fig. 2). These results suggest that each RpoH homolog can recognize the cognate heat
shock promoters with sequences similar, if not identical, to those of
E. coli. Indeed, the dnaK promoter of A. tumefaciens, previously thought to have a novel consensus sequence
characteristic of heat shock genes of the alpha proteobacteria
(26), was found to be recognized by its own RpoH
(20). Similarly, the dnaK heat shock promoter of
Caulobacter crescentus or Bradyrhizobium
japonicum (alpha subdivision) was recently shown to be recognized
by the cognate
32 homolog in vitro (34) or in
vivo (in E. coli) (15). Thus, the apparent
difference in consensus heat shock promoters between E. coli
and the alpha proteobacteria appears to be explained by subtle
difference in promoter specificity among
32 homologs.
The previous sequence analysis of rpoH homologs detected
both putative downstream box and mRNA secondary structure among members of the gamma (but not the alpha) subdivision (19).
Consistent with such predictions, the synthesis of all RpoH homologs of
the gamma subdivision examined was similarly induced upon temperature upshift, and the induction apparently occurred at the level of translation (Fig. 5). Thus, the translational control involving rpoH mRNA secondary structure appears to be a conserved
mechanism for heat shock regulation of
32 homologs in
the gamma proteobacteria. The extents of heat-induced synthesis varied
among these homologs, between seven- to eightfold (S. marcescens) and three- to fourfold (P. mirabilis) (Fig.
4b to d). Since quantitatively similar differences were found when these homologs were expressed in E. coli (Fig. 4e to g), the
differential extents of induction observed might reflect the
differential stability of the rpoH mRNA secondary structure
itself. As for the alpha subdivision, a heat-induced increase in the
RpoH level was observed in C. crescentus (22,
34), B. japonicum (21), and A. tumefaciens (20), but the increase appears to occur
primarily at the level of transcription.
All the RpoH homologs of the gamma subdivision tested except P. mirabilis were found to be unstable at low temperature (nonstress conditions), with some variation in half-life (0.7 to 2.5 min), the
most unstable one being RpoH of S. marcescens (Fig. 6). In contrast, RpoH of P. mirabilis was quite stable at 30°C
(half-life, 40 min) and showed little further stabilization upon the
shift to 42°C. Interestingly, when either S. marcescens or
P. mirabilis RpoH was expressed in E. coli, the
apparent half-life became much like that of E. coli
32 (1.3 min). This suggests that, in contrast to the
above cases of translational induction (Fig. 4), interplay with certain
cellular factors responsible for degradation of RpoH such as
ATP-dependent proteases (11, 13, 33) or DnaK-DnaJ-GrpE
chaperones (28, 30, 31) rather than the characteristics of
RpoH itself explains the observed difference in stability between the
respective bacteria. However, the actual involvement of such factors in
the degradation of RpoH in S. marcescens and P. aeruginosa as well as of P. mirabilis RpoH expressed in
E. coli remained to be investigated.
In summary, the results presented here and those reported by others
indicate a strong conservation, at least among the alpha and gamma
proteobacteria, of heat-induced elevation of cellular RpoH levels as a
means of activating the transcription of the heat shock genes, much
like in E. coli. However, there are differences in the
actual strategies used to modulate the RpoH levels, perhaps reflecting
the different ecological niche of each bacterial species. Among the
gamma proteobacteria tested, P. mirabilis seemed to require
higher levels of RpoH and heat shock proteins even under nonstress
conditions, and this presumably brought about stable RpoH during
evolution. Besides, a highly parasitic Haemophilus influenzae and endosymbiont Buchnera aphidicola, which
may not require strong heat shock responses in their living
environments, appear to lack rpoH mRNA secondary structures
(5, 25) and perhaps translational control of RpoH synthesis.
Further work on the regulatory mechanisms of RpoH homologs may provide
new insights into the nature and significance of the heat shock
response in eubacteria.
 |
ACKNOWLEDGMENTS |
We are grateful to Eliora Ron for helpful discussion, to A. Oka
for bacterial strains, and to Masako Nakayama and Mayumi Ueda for
technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: HSP Research
Institute, Kyoto Research Park, Kyoto 600, Japan. Phone:
(81)-75-315-8619. Fax: (81)-75-315-8659. E-mail:
tyura{at}hsp.co.jp.
 |
REFERENCES |
| 1.
|
Benvenisti, L.,
S. Koby,
A. Rutman,
H. Giladi,
T. Yura, and A. B. Oppenheim.
1995.
Cloning and primary sequence of the rpoH gene from Pseudomonas aeruginosa.
Gene
155:73-76[Medline].
|
| 2.
|
Bukau, B.
1993.
Regulation of the Escherichia coli heat shock response.
Mol. Microbiol.
9:671-680[Medline].
|
| 3.
|
Cowing, D. W.,
J. C. A. Bardwell,
E. A. Craig,
C. Woolford,
R. W. Hendrix, and C. A. Gross.
1985.
Consensus sequence for Escherichia coli heat shock gene promoters.
Proc. Natl. Acad. Sci. USA
82:2679-2683[Abstract/Free Full Text].
|
| 4.
|
Craig, E. A., and C. A. Gross.
1991.
Is hsp70 the cellular thermometer?
Trends Biochem. Sci.
16:135-140[Medline].
|
| 5.
|
Fleischmann, R. D.,
M. D. Adams,
O. White,
R. A. Clayton,
E. F. Kirkness,
A. R. Kerlavage,
C. J. Bult,
J.-F. Tomb,
B. A. Dougherty,
J. M. Merrick,
K. McKenney,
G. Sutton,
W. FitzHugh,
C. Fields,
J. D. Gocayne,
J. Scott,
R. Shirley,
L.-I. Liu,
A. Glodek,
J. M. Kelley,
J. F. Weidman,
C. A. Phillips,
T. Spriggs,
E. Hedblom,
M. D. Cotton,
T. R. Utterback,
M. C. Hanna,
D. T. Nguyen,
D. M. Saudek,
R. C. Brandon,
L. D. Fine,
J. L. Fritchman,
J. L. Fuhrmann,
N. S. M. Georghagen,
C. L. Gnehm,
L. A. McDonald,
K. V. Small,
C. M. Fraser,
H. O. Smith, and J. C. Venter.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
Science
269:496-512[Abstract/Free Full Text].
|
| 6.
|
Garvin, D. L., and S. C. Hardies.
1989.
Nucleotide sequence for the htpR gene from Citrobacter freundii.
Nucleic Acids Res.
17:4889[Free Full Text].
|
| 7.
|
Georgopoulos, C.,
K. Liberek,
M. Zylicz, and D. Ang.
1994.
Properties of the heat shock proteins of Escherichia coli and the autoregulation of the heat shock response, p. 209-249.
In
R. I. Morimoto, A. Tissieres, and C. Georgopoulos (ed.), The biology of heat shock proteins and molecular chaperones. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 8.
|
Gross, C. A.
1996.
Function and regulation of the heat shock proteins, p. 1382-1399.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. AMS Press, Washington, D.C.
|
| 9.
|
Gross, C. A.,
M. Lonetto, and R. Losick.
1992.
Bacterial sigma factors, p. 129-176.
In
S. L. McKnight, and K. R. Yamamoto (ed.), Transcriptional regulation. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 10.
|
Grossman, A. D.,
J. W. Erickson, and C. Gross.
1984.
The htpR gene product of E. coli is a sigma factor for heat-shock promoters.
Cell
38:383-390[Medline].
|
| 11.
|
Herman, C.,
D. Thevenet,
R. D'Ari, and P. Bouloc.
1995.
Degradation of 32, the heat shock regulator in Escherichia coli, is governed by HflB.
Proc. Natl. Acad. Sci. USA
92:3516-3520[Abstract/Free Full Text].
|
| 12.
|
Kamath-Loeb, A. S., and C. A. Gross.
1991.
Translational regulation of 32 synthesis: requirement for an internal control element.
J. Bacteriol.
173:3904-3906[Abstract/Free Full Text].
|
| 13.
|
Kanemori, M.,
K. Nishihara,
H. Yanagi, and T. Yura.
1997.
Synergistic roles of Hs1VU and other ATP-dependent proteases in controlling in vivo turnover of 32 and abnormal proteins in Escherichia coli.
J. Bacteriol.
179:7219-7225[Abstract/Free Full Text].
|
| 14.
|
McCarty, J. S.,
S. Rudiger,
H.-J. Schonfeld,
J. Schneider-Mergener,
K. Nakahigashi,
T. Yura, and B. Bukau.
1996.
Regulatory region C of the E. coli heat shock transcription factor, 32, constitutes a DnaK binding site and is conserved among eubacteria.
J. Mol. Biol.
256:829-837[Medline].
|
| 15.
|
Minder, A. C.,
F. Narberhaus,
M. Babst,
H. Hennecke, and H.-M. Fischer.
1997.
The dnaKJ operon belongs to the 32-dependent class of heat shock genes in Bradyrhizobium japonicum.
Mol. Gen. Genet.
254:195-206[Medline].
|
| 16.
|
Naczynski, Z. M.,
C. Mueller, and A. M. Kropinski.
1995.
Cloning the gene for the heat shock response positive regulator (sigma 32 homolog) from Pseudomonas aeruginosa.
Can. J. Microbiol.
41:75-87[Medline].
|
| 17.
|
Nagai, H.,
H. Yuzawa, and T. Yura.
1991.
Interplay of two cis-acting mRNA regions in translational control of 32 synthesis during the heat shock response of Escherichia coli.
Proc. Natl. Acad. Sci. USA
88:10515-10519[Abstract/Free Full Text].
|
| 18.
|
Nagai, H.,
H. Yuzawa,
M. Kanemori, and T. Yura.
1994.
A distinct segment of the 32 polypeptide is involved in DnaK-mediated negative control of the heat shock response in Escherichia coli.
Proc. Natl. Acad. Sci. USA
91:10280-10284[Abstract/Free Full Text].
|
| 19.
|
Nakahigashi, K.,
H. Yanagi, and T. Yura.
1995.
Isolation and sequence analysis of rpoH genes encoding 32 homologs from gram negative bacteria: conserved mRNA and protein segments for heat shock regulation.
Nucleic Acids Res.
23:4383-4390.
|
| 20.
| Nakahigashi, K. Unpublished data.
|
| 21.
|
Narberhaus, F.,
W. Weiglhofer,
H.-M. Fischer, and H. Hennecke.
1996.
The Bradyrhizobium japonicum rpoH1 gene encoding a 32-like protein is part of a unique heat shock gene cluster together with groESL1 and three small heat shock genes.
J. Bacteriol.
178:5337-5346[Abstract/Free Full Text].
|
| 22.
|
Reisenauer, A.,
C. D. Mohr, and L. Shapiro.
1996.
Regulation of a heat shock 32 homolog in Caulobacter crescentus.
J. Bacteriol.
178:1919-1927[Abstract/Free Full Text].
|
| 23.
|
Sahu, G. K.,
R. Chowdhury, and J. Das.
1997.
The rpoH gene encoding 32 homolog of Vibrio cholerae.
Gene
189:203-207[Medline].
|
| 24.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
In
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 25.
|
Sato, S., and H. Ishikawa.
1997.
Expression and control of an operon from an intracellular symbiont which is homologous to the groE operon.
J. Bacteriol.
179:2300-2304[Abstract/Free Full Text].
|
| 26.
|
Segal, G., and E. Z. Ron.
1995.
The dnaKJ operon of Agrobacterium tumefaciens: transcriptional analysis and evidence for a new heat shock promoter.
J. Bacteriol.
177:5952-5958[Abstract/Free Full Text].
|
| 27.
|
Sprengart, M. L.,
H. P. Fatscher, and E. Fuchs.
1990.
The initiation of translation in E. coli: apparent base pairing between the 16S rRNA and downstream sequences of the mRNA.
Nucleic Acids Res.
18:1719-1723[Abstract/Free Full Text].
|
| 28.
|
Straus, D.,
W. Walter, and C. A. Gross.
1990.
DnaK, DnaJ, and GrpE heat shock proteins negatively regulate heat shock gene expression by controlling the synthesis and stability of 32.
Genes Dev.
4:2202-2209[Abstract/Free Full Text].
|
| 29.
|
Straus, D. B.,
W. A. Walter, and C. A. Gross.
1987.
The heat shock response of E. coli is regulated by changes in the concentration of 32.
Nature
329:348-351[Medline].
|
| 30.
|
Tilly, K.,
N. McKittrick,
M. Zylicz, and C. Georgopoulos.
1983.
The dnaK protein modulates the heat-shock response of Escherichia coli.
Cell
34:641-646[Medline].
|
| 31.
|
Tilly, K.,
J. Spence, and C. Georgopoulos.
1989.
Modulation of stability of the Escherichia coli heat shock regulatory factor 32.
J. Bacteriol.
171:1585-1589[Abstract/Free Full Text].
|
| 32.
|
Tobe, T.,
K. Ito, and T. Yura.
1984.
Isolation and physical mapping of temperature-sensitive mutants defective in heat-shock induction of proteins in Escherichia coli.
Mol. Gen. Genet.
195:10-16[Medline].
|
| 33.
|
Tomoyasu, T.,
J. Gamer,
B. Bukau,
M. Kanemori,
H. Mori,
A. J. Rutman,
A. B. Oppenheim,
T. Yura,
K. Yamanaka,
H. Niki,
S. Hiraga, and T. Ogura.
1995.
Escherichia coli FtsH is a membrane-bound, ATP-dependent protease which degrades the heat-shock transcription factor 32.
EMBO J.
14:2551-2560[Medline].
|
| 34.
|
Wu, J., and A. Newton.
1996.
Isolation, identification, and transcriptional specificity of the heat shock sigma factor 32 from Caulobacter crescentus.
J. Bacteriol.
178:2094-2101[Abstract/Free Full Text].
|
| 35.
|
Yano, R.,
H. Nagai,
K. Shiba, and T. Yura.
1990.
A mutation that enhances synthesis of 32 and suppresses temperature-sensitive growth of the rpoH15 mutant of Escherichia coli.
J. Bacteriol.
172:2124-2130[Abstract/Free Full Text].
|
| 36.
|
Yura, T.
1996.
Regulation and conservation of the heat-shock transcription factor 32.
Genes Cells
1:277-284.
[Abstract] |
| 37.
|
Yura, T.,
H. Nagai, and H. Mori.
1993.
Regulation of heat shock response in bacteria.
Annu. Rev. Microbiol.
47:321-350[Medline].
|
| 38.
|
Yuzawa, H.,
H. Nagai,
H. Mori, and T. Yura.
1993.
Heat induction of 32 synthesis mediated by mRNA secondary structure: a primary step of the heat shock response in Escherichia coli.
Nucleic Acids Res.
21:5449-5455[Abstract/Free Full Text].
|
| 39.
|
Zhou, Y.-N.,
N. Kusukawa,
J. W. Erickson,
C. A. Gross, and T. Yura.
1988.
Isolation and characterization of Escherichia coli mutants that lack the heat shock sigma factor 32.
J. Bacteriol.
170:3640-3649[Abstract/Free Full Text].
|
J Bacteriol, May 1998, p. 2402-2408, Vol. 180, No. 9
0021-9193/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Du, Y., Arvidson, C. G.
(2006). RpoH Mediates the Expression of Some, but Not All, Genes Induced in Neisseria gonorrhoeae Adherent to Epithelial Cells.. Infect. Immun.
74: 2767-2776
[Abstract]
[Full Text]
-
Laskos, L., Ryan, C. S., Fyfe, J. A. M., Davies, J. K.
(2004). The RpoH-Mediated Stress Response in Neisseria gonorrhoeae Is Regulated at the Level of Activity. J. Bacteriol.
186: 8443-8452
[Abstract]
[Full Text]
-
Tchufistova, L. S., Komarova, A. V., Boni, I. V.
(2003). A key role for the mRNA leader structure in translational control of ribosomal protein S1 synthesis in {gamma}-proteobacteria. Nucleic Acids Res
31: 6996-7002
[Abstract]
[Full Text]
-
Rosen, R., Buttner, K., Becher, D., Nakahigashi, K., Yura, T., Hecker, M., Ron, E. Z.
(2002). Heat Shock Proteome of Agrobacterium tumefaciens: Evidence for New Control Systems. J. Bacteriol.
184: 1772-1778
[Abstract]
[Full Text]
-
Nakahigashi, K., Yanagi, H., Yura, T.
(2001). DnaK Chaperone-Mediated Control of Activity of a {sigma}32 Homolog (RpoH) Plays a Major Role in the Heat Shock Response of Agrobacterium tumefaciens. J. Bacteriol.
183: 5302-5310
[Abstract]
[Full Text]
-
Ramirez-Santos, J., Collado-Vides, J., Garcia-Varela, M., Gomez-Eichelmann, M. C.
(2001). Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria. Nucleic Acids Res
29: 380-386
[Abstract]
[Full Text]
-
Nakahigashi, K., Ron, E. Z., Yanagi, H., Yura, T.
(1999). Differential and Independent Roles of a sigma 32 Homolog (RpoH) and an HrcA Repressor in the Heat Shock Response of Agrobacterium tumefaciens. J. Bacteriol.
181: 7509-7515
[Abstract]
[Full Text]
-
Storz, G.
(1999). An RNA thermometer. Genes Dev.
13: 633-636
[Full Text]
-
Morita, M. T., Tanaka, Y., Kodama, T. S., Kyogoku, Y., Yanagi, H., Yura, T.
(1999). Translational induction of heat shock transcription factor sigma 32: evidence for a built-in RNA thermosensor. Genes Dev.
13: 655-665
[Abstract]
[Full Text]
-
Morita, M., Kanemori, M., Yanagi, H., Yura, T.
(1999). Heat-Induced Synthesis of sigma 32 in Escherichia coli: Structural and Functional Dissection of rpoH mRNA Secondary Structure. J. Bacteriol.
181: 401-410
[Abstract]
[Full Text]