Previous Article | Next Article 
Journal of Bacteriology, January 1999, p. 141-148, Vol. 181, No. 1
Departamento de Microbiología
Molecular, Instituto de Biotecnología, Universidad Nacional
Autónoma de México, Cuernavaca, Morelos, México
Received 20 July 1998/Accepted 28 October 1998
Azotobacter vinelandii produces the exopolysaccharide
alginate, which is essential for the encystment process. In
Pseudomonas aeruginosa, as well as in A. vinelandii, the Azotobacter vinelandii is
a soil bacterium that undergoes a process of cellular differentiation
to form metabolically dormant cysts resistant to desiccation (for a
review, see reference 34). Mucoid strains of
A. vinelandii produce the extracellular polysaccharide alginate, a linear copolymer of D-mannuronic acid and its
C-5 epimer L-guluronic acid. Alginate is a major component
of the intine and exine layers of the cysts (31) and is
essential to the encystment process, since nonmucoid strains fail to
form cysts (2, 23, 29).
The alginate biosynthesis pathway in A. vinelandii has been
elucidated (32). In this pathway, fructose-6-phosphate is
converted by four enzymatic reactions to GDP-mannuronic acid, which is
the substrate for polymerization. The resultant polymannuronic acid is
secreted and modified by an O-acetylase and an extracellular C-5
epimerase to give the final product, alginate (32). A
similar pathway operates in Pseudomonas aeruginosa
(21).
The genetics of this process is well known in P. aeruginosa
(7, 21), where alginate is an important virulence
determinant and a major factor contributing to the intractability of
P. aeruginosa lung infection in cystic fibrosis patients
(11). With A. vinelandii, important advances have
been made in the study of the genetics of alginate synthesis (for a
review, see reference 10). These studies have been
motivated by the role that this polysaccharide plays in the
differentiation process and by the potential of this bacterium for use
in the production of alginate for industrial purposes.
In A. vinelandii, as in P. aeruginosa, all of the
alginate biosynthetic genes, except algC, are clustered
(2, 16, 22, 23, 33). In P. aeruginosa, this
cluster is organized in a polycistronic operon transcribed from a
promoter located upstream of algD (3). In
contrast, the A. vinelandii biosynthetic gene cluster is
organized into three operons, one of which transcribes algD
(2, 16, 22, 23).
In P. aeruginosa, transcription from the algD
promoter is affected by the products of several regulatory genes. The
algU-encoded alternative sigma factor, which is similar to
the Escherichia coli and Salmonella typhimurium
In A. vinelandii, algD is transcribed from at
least two promoters which are recognized by RNA polymerase with two
different sigma factors: p1, recognized by
Evidence for the presence of algR in bacteria of the
Azotobacteriaceae family was previously reported
(9). In this study, we report the cloning and sequence of
the A. vinelandii algR gene and show that its inactivation
diminishes alginate production by 50% but does not affect the
transcription of algD; in addition, inactivation of
algR was shown to completely impair the encystment process.
Microbiological procedures.
The bacterial strains and
plasmids used in this study are listed in Table
1. The media and growth conditions used
were as follows. A. vinelandii was grown at 30°C in
Burk's nitrogen-free salts supplemented with sucrose at 2%
(15). Escherichia coli DH5
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Azotobacter vinelandii Response
Regulator AlgR Is Essential for Cyst Formation
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
E factor encoded by
algU is required for transcription of algD, which encodes a key enzyme of the alginate biosynthetic pathway. The
P. aeruginosa response regulator AlgR activates
transcription of algD. fimS, located upstream
algR, is proposed to encode the AlgR cognate sensor kinase.
We have cloned and characterized the A. vinelandii algR
gene; the deduced amino acid sequence of the protein encoded by this
gene shows 79% identity with its P. aeruginosa homolog.
Sequence analysis around the algR gene revealed the absence of a fimS homolog. Inactivation of A. vinelandii
algR diminished alginate production by 50%, but did not affect
algD transcription, and completely impaired the capacity to
form mature cysts. Electron microscopy of the cyst structures formed by
the algR mutant revealed that the encystment process is
blocked at the step of exine formation. The transcriptional regulation
of the A. vinelandii algR gene and the role of AlgR in
alginate production differ significantly from those of its P. aeruginosa counterparts. These differences could be due to the
fact that in A. vinelandii, alginate plays a role in
encystment, a function not found in P. aeruginosa.
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
E factor (7, 13, 19), is required for
algD transcription (36, 41). The products of the
mucA and mucB genes counteract AlgU by
suppressing its function (7, 36, 37, 43). The algR (5) and algB genes
(40) encode response regulators belonging to the superfamily
of two-component signal transduction elements. AlgR has been shown to
bind to three sites (named RBS) within the algD promoter
region and to activate transcription from the AlgU-dependent promoter
(26); therefore, inactivation of algR abrogates
alginate production (5). Another gene, fimS (also called algZ), which is located upstream of algR
and encodes a protein involved in twitching motility (39),
has been proposed to be the cognate AlgR sensor kinase, which is also
involved in the control of alginate biosynthesis under certain
conditions (44). Nonphosphorylated AlgB and AlgR response
regulators were recently shown to be active as positive regulators of
alginate synthesis (18).
70, and p2, recognized by the
alternative E factor (AlgU). The algU-mucABCD
operon has been characterized (20). These genes seem to be
functionally equivalent to those of P. aeruginosa, since
inactivation of algU abrogated alginate production, and
introduction into strain ATCC 9046 of a plasmid containing the
functional mucABCD genes abrogated transcription from the
algDp2 promoter and diminished alginate
production (29). AlgU activity has been shown to be
essential for encystment, independently of its role in alginate
synthesis (29). Transcription of the other two operons of
the alginate biosynthetic cluster is AlgU independent (16,
22).
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
was grown on LB
medium (24) at 37°C. The antibiotic concentrations (micrograms per milliliter) used for A. vinelandii and
E. coli, respectively, were as follows: tetracycline, 20 and
20; kanamycin, 5 and 0; rifampin, 20 and 0; ampicillin, 0 and 100;
nalidixic acid, 20 and 0; spectinomycin, 100 and 100.
TABLE 1.
Bacterial strains and plasmids used in this work
-Galactosidase activity was measured as reported by Miller
(24). One unit corresponds to 1 nmol of
o-nitrophenyl--D-galactopyranoside hydrolyzed
per min per µg of protein. Protein was determined by the method of
Lowry et al. (17). All measurements were done in triplicate.
Alginate production was determined as previously described
(23); all determinations were done in triplicate.
Encystment induction, desiccation resistance assays, and electron
microscopy studies were carried out as previously described (2,
23).
Nucleic acid procedures. RNA and DNA isolation and cloning, Southern blotting, and nick translation procedures were carried out as previously described (35). Plasmids pCNR1 and pCNR2 (Fig. 1) were used to determine the nucleotide sequence reported here. DNA sequencing was done with the Taq FS DNA polymerase and fluorescent dideoxy terminators by using a cycle sequencing method. Primer extension analysis of algR was carried out with 50 µg of RNA isolated from bacterial cultures grown for 48 h in Burk's nitrogen-free salts supplemented with 2% sucrose. Primer extension of algD was carried out as previously described (2). Reactions were performed with a primer extension system (Amersham) as instructed by the manufacturer. The P. aeruginosa fimS probe was amplified by PCR using PAO1 chromosomal DNA as a template, as well as oligonucleotides fimS-5' ACTCTGTCGATGCCTATCCG and fimS-3' TAGCGTAGACAGGTGTAGTGC.
|
Construction of plasmid pSF12. The A. vinelandii algR gene was cloned by PCR using plasmid pMSR1506 as a template, as well as oligonucleotides algR-5' AAGCTTGTGCAGCTTCTTGCCGGTGATGCC and algR-3' AAGCTTCGACGGATTGGCGCGGATGATAGC. The resulting 1,458-nucleotide (nt) PCR product was cloned into pBluescript SK+. The resultant plasmid was used to introduce a spectinomycin resistance cassette into the vector polylinker to produce plasmid pSF12 (Fig. 1 and 2).
|
Construction of strains ATR8, ATR9, and WIR1.
The 1.5-kb
EcoRI fragment containing the algR 5' end was
cloned into plasmid pUC18, and the resultant plasmid, pCNR1, was used
to introduce into the unique XhoI site either a 2.0-kb
SmaI fragment containing an 
-tetracycline cassette or an
-spectinomycin cassette (8). The resultant plasmids,
pCNR101 and pCNR102 (Fig. 1B), were unable to replicate in A. vinelandii and were used to introduce the
algR::Tcr mutation into strain ATCC
9046 and the algR::Spr mutation into
strain WI12. ATR8, a tetracycline-resistant transformant, and WIR1, a
spectinomycin-resistant transformant, were selected and confirmed by
Southern blot analysis to carry the algR mutations (Fig. 2;
data not shown for WIR1).
-tetracycline
cassette into the unique SphI site located 80 nt downstream of the TGA stop codon of the algR gene. The resultant
plasmid, pCNR201 (Fig. 1), was transformed into ATCC 9046, rendering
strain ATR9.
Isolation of plasmid pMSR1507. To isolate a pMSR1506 derivative carrying an algR::Spr mutation, we transferred plasmid pMSR1506 by conjugation from strain WIR1 to E. coli. Selection of a plasmid derivative in which transfer of the algR::Spr mutation from the WIR1 chromosome to plasmid pMSR1506 had occurred by recombination was carried out by isolating E. coli transconjugants resistant to tetracycline and spectinomycin. One Spr Tcr transconjugant was shown by restriction analysis and Southern blotting to contain pMSR1506 with the algR::Spr mutation (data not shown). This plasmid was named pMSR1507.
Nucleotide sequence accession number. The A. vinelandii algR sequence reported here has been assigned GenBank accession no. AF077237.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Cloning and sequencing of the A. vinelandii algR gene. It has been previously reported that A. vinelandii has DNA sequences homologous to P. aeruginosa algR (9). The algR gene was cloned from strain ATCC 9046 on the basis of its homology to the corresponding P. aeruginosa gene. Southern blot analysis with an internal fragment of the P. aeruginosa algR gene used as a probe led to the identification of cosmid pMSR1506 carrying a 1.5-kb EcoRI fragment with algR-homologous sequences. The 1.5-kb EcoRI fragment and a 2.0-kb PstI fragment were subcloned into plasmids pUC18 and pBluescript, yielding plasmids pCNR1 and pCNR2, respectively (Fig. 1), which were used to determine the algR nucleotide sequence.
The A. vinelandii algR sequence codes for a 251-amino-acid polypeptide sharing 79% identity with its P. aeruginosa counterpart. As with other response regulators that are phosphorylated, A. vinelandii AlgR contains two highly conserved aspartate residues, Asp8 and Asp54 (Fig. 3).
|
The fimS gene is not present upstream of algR in A. vinelandii. In P. aeruginosa, a 1.5-kb region located between argH and algR was recently characterized and shown to contain fimS, whose product is involved in twitching motility (39) (Fig. 1). FimS has also been postulated to be the AlgR cognate sensor kinase involved in the regulation of alginate production under certain conditions (44). Analysis of 1,000 nt of the DNA sequence upstream of the first ATG of algR in A. vinelandii revealed the presence of argH but the absence of a gene homologous to fimS (Fig. 1). Southern blot hybridization of EcoRI-digested DNA from A. vinelandii AEIV and UW136 with the 1.5-kb EcoRI fragment containing the 3' end of argH and the 5' portion of algR as a probe revealed a 1.5-kb EcoRI fragment (data not shown), indicating conservation of this region among different A. vinelandii strains. A 1,054-nt fragment corresponding to P. aeruginosa fimS, encompassing codons for amino acids 1 to 348, did not hybridize with the A. vinelandii chromosome, even under low-stringency conditions (data not shown), suggesting the absence of an fimS homolog in A. vinelandii.
Characterization of an algR mutant. To determine whether the algR gene is involved in alginate regulation in A. vinelandii, strain ATR8 carrying an algR::Tcr mutation was constructed as described in Materials and Methods. In contrast to P. aeruginosa, where algR mutations totally abrogate alginate production, we found that in A. vinelandii, the algR mutation only diminished alginate production by 50% (Table 2).
|
AlgR is not required for algD transcription.
In
P. aeruginosa, AlgR activates transcription of
algD from its AlgU-dependent promoter and has been shown to
bind to three sites (RBS sites) upstream of algD (25,
26). We determined, by primer extension, algD
transcription in ATCC 9046, as well as in the algR mutant.
Transcription of algD initiates from the two previously
reported promoters, AlgU (p2) and
70 (p1), and also from a third
site located 62 nt upstream the ATG start codon (Fig.
4). No consensus sequences similar to
known promoters were found around the 
10 and 35 regions of this
transcription initiation site.
|
-galactosidase
activity of strain WI12, an ATCC 9046 derivative carrying an
algD::lacZ gene fusion, with that of
WIR1, a WI12 derivative carrying the
algR::Spr mutation. As expected, the
algR mutant and wild-type strains presented similar
-galactosidase activities (9.9 ± 0.1 and 11.4 ± 0.9 U/µg of protein, respectively) after 24 h of growth in Burk's nitrogen-free salts supplemented with 2% sucrose, thus confirming that
algD transcription is not affected by the algR mutation.
The A. vinelandii algR gene is functional in P. aeruginosa. Cosmid pMSR1506 was transferred by conjugation into two P. aeruginosa algR mutants, FRD810 and 8852. As a positive control, we used plasmid pAD1039 carrying P. aeruginosa algR in the same vector. Plasmid pMSR1506 partially restored alginate production to both strains (Table 3). These data imply that the A. vinelandii AlgR protein is functional as an activator of the algD promoter in P. aeruginosa.
|
Effect of the algR mutation on encystment. We studied encystment in algR mutant strain ATR8. We measured the desiccation resistance of cultures induced for encystment with n-butanol. An encystment frequency reduction of more than 1,000-fold was observed in algR mutant strain ATR8 (Table 2).
We tested whether the failure of strain ATR8 to encyst was caused by the 50% decrease in alginate production. Alginate production under encystment conditions was determined for ATR8 and WI12. Table 2 shows that strain ATR8 is unable to form desiccation-resistant cysts despite the fact that under encysting conditions it produced alginate levels similar to those of encysting strain WI12. Electron microscopy of the cultures of the algR mutant induced for encystment is shown in Fig. 5. The morphology of a mature cyst, as has been described elsewhere (42), is observed in wild-type strain ATCC 9046; i.e., the central body is surrounded by two capsule-like layers, the intine and the exine. No mature cysts were seen in the algR mutant, where the central body was surrounded by an incipient exine, and no intine layer was observed. Since the exine is the first layer to be formed, this phenotype indicates that the encystment process stopped at an early stage in the differentiation process.
|
Complementation of the algR mutation. To confirm that the algR mutation caused the cyst-defective phenotype, we constructed plasmid pSF12, a pSK derivative carrying the A. vinelandii algR gene (Fig. 2). This plasmid, which is unable to replicate in A. vinelandii, was transformed into the ATR8 mutant. Transformant ATR801, which is resistant to spectinomycin and carries plasmid pSF12 integrated into the chromosome, was selected. Integration of the plasmid was confirmed by Southern blot analysis (Fig. 2C). Strain ATR801 produced alginate in a manner similar to that of wild-type ATCC 9046 and was able to encyst. Encystment of ATR801 was reduced four times relative to that of the wild type; however, in our experience, differences in encystment below 10 times are not significant (Table 2).
Transcription analysis of algR.
The mRNA start site for
the algR gene was determined by primer extension (Fig.
6). A unique start site, 30 nt upstream
the ATG codon, was found in strain ATCC 9046 (Fig. 6B, line 3). No consensus for known bacterial promoters was found at the 10 and 35
promoter algR region (Fig. 6A). In contrast to that in
P. aeruginosa (41), algR transcription
is not abrogated in algU mutants SMU88 and UW136 (Fig. 6B,
lines 1 and 2).
|
Plasmid pMSR1506 suppresses encystment in strain ATCC 9046. Plasmid pMSR1506, harboring a copy of the wild-type algR gene, was found to reduce mucoidy and suppress encystment in wild-type strain ATCC 9046 (Table 4). The reduction in alginate production caused by plasmid pMSR1506 could be the cause for the cyst-defective phenotype. When overexpressed, P. aeruginosa algR has a negative effect on alginate synthesis (6). To investigate whether the negative effect of pMSR1506 on alginate production and encystment was due to algR, plasmid pMSR1507, a pMSR1506 derivative carrying an algR::Spr mutation, was isolated as described in Materials and Methods. This plasmid has the same effects on encystment and alginate production in ATCC 9046 (Table 4). Thus, the negative effect is not caused by algR.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
In this study, we cloned and characterized the algR gene from A. vinelandii. We found a high degree of homology with P. aeruginosa algR, encoding the response regulator AlgR, which, together with AlgU, is absolutely required for activation of the alginate biosynthetic operon controlled by the algD promoter. AlgU is the alternative sigma factor required for transcription of algD in P. aeruginosa. In A. vinelandii, algD is transcribed from three promoters, one of which, p2, is an AlgU-dependent promoter (2, 29). Our results show that in contrast to P. aeruginosa, A. vinelandii does not require AlgR for activation of algD transcription from any of its promoters, including the p2 AlgU-dependent promoter. Partial complementation of P. aeruginosa algR mutants with the A. vinelandii algR gene, however, implies that A. vinelandii AlgR can bind the RBS sequences present upstream of the P. aeruginosa algD promoter and can interact with AlgU RNA polymerase. This finding is consistent with the lack in A. vinelandii of sequences homologous to P. aeruginosa RBS (2). We propose that a transcriptional regulator other than AlgR activates transcription of algD from the AlgU-dependent promoter.
In P. aeruginosa, transcription of algR is dependent on AlgU but not on AlgR (41); similarly, transcription of A. vinelandii algD from the p2 promoter depends on AlgU but not on AlgR; thus, there are promoters that are recognized by AlgU but not activated by AlgR.
Although AlgR does not appear to be required for transcription of algD in A. vinelandii, alginate production in the algR mutant is reduced by 50%, implying that AlgR may exert some control over other alginate biosynthetic or regulatory genes. Our previous studies have shown that an unidentified biosynthetic or regulatory alginate gene other than algD is under the control of AlgU (29). Thus, the above-mentioned alg gene could be activated by AlgR.
The ATR8 mutant reported here has a cyst-defective phenotype; encystment in ATR8 seems to stop at the step of exine organization. We previously showed that encystment is also impaired when plasmid pSMU865, carrying the mucABCD genes coding for negative regulators of AlgU activity, is introduced into strain ATCC 9046 (20, 29). However, in this case, encystment proceeds a step further, since cyst structures formed by ATCC 9046/pSMU865 lack the intine layer but show a well-structured exine. Both the AlgU and AlgR proteins are essential for encystment, so it is a possibility that AlgR can activate genes involved in the encystment process whose promoters are recognized by AlgU. The putative AlgR requirement for transcription of genes involved in encystment may facilitate the identification of such genes. Transcription of algR is not abrogated in the algU mutant strains; accordingly, the algR promoter does not have AlgU consensus sequences. This indicates the potential existence of another sigma factor involved in alginate and encystment control.
In P. aeruginosa, the algR gene is flanked by the hemC gene located immediately downstream (28) and the fimS gene coding for the putative cognate sensor kinase of AlgR, which is located immediately upstream of algR and is involved in twitching motility (39). The argH gene is located upstream of fimS (Fig. 1). Our characterization of the algR flanking regions in A. vinelandii identified the hemC gene immediately downstream of algR and the argH gene 230 nt upstream of algR (Fig. 1). No open reading frames or other recognizable features are found within these 230 nt. Thus, fimS was not present upstream of algR; we also found that sequences homologous to fimS were not present elsewhere in the A. vinelandii chromosome. Type 4 fimbriae are associated with twitching motility and are found in some pathogenic bacteria (38). There is no evidence that A. vinelandii possesses type 4 fimbriae; therefore, this may be the reason for the absence of fimS in this bacterium. The cognate sensor kinase of AlgR remains unidentified in A. vinelandii.
It was recently shown that in P. aeruginosa, phosphorylation of neither AlgR nor AlgB is needed for alginate production (18). Phosphorylation is essential for the activity of most of the response regulators so far studied; an exception is the nonphosphorylated response regulator DegU that activates the late competence genes comC and comG, whereas phosphorylated DegU is required for the expression of genes encoding degradative enzymes (30). Similarly, it was postulated that in P. aeruginosa, nonphosphorylated AlgR is involved in alginate production while phosphorylated AlgR may play a role in twitching motility (39).
Another hypothesis proposed to explain the lack of AlgR phosphorylation is that mucoid strains containing nonphosphorylated response regulators are not typical wild-type strains but carry mutations in the mucA gene and synthesize high levels of AlgU. Thus, mucoid P. aeruginosa mucA strains may have elevated levels of the response regulators AlgR and AlgB that bypass the need for phosphorylation.
Whether phosphorylation of A. vinelandii AlgR is necessary for activation of its target cyst promoters remains to be investigated. Further studies will help to clarify the role of a response regulator such as AlgR in signal transduction and its interaction with AlgU-RNA polymerase.
Finally, while trying to complement the A. vinelandii algR mutants with the cosmid pMSR1506, we detected an inhibition of alginate production and encystment caused by this plasmid. Inhibition of encystment could be a consequence of the reduction in alginate. However, we have previously shown that strains that produce alginate similar to that of ATCC 9046/pMSR1506 are able to encyst (29). We provided evidence indicating that this inhibition is not caused by algR itself. Thus, other loci that participate in alginate and encystment control lie in the algR chromosomal region.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grant IN212096 from DGAPA-PAPIIT UNAM. C.N. thanks CONACYT and PADEP-UNAM for financial support during her Ph.D. studies.
We thank Rebeca Nájera and Josefina Guzmán for technical support and A. Chakrabarty, D. J. Wozniak, and J. Goldberg for providing the P. aeruginosa algR plasmid and strains.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Departamento de Microbiología Molecular, Instituto de Biotecnología UNAM, Apdo Postal 510-3 Cuernavaca, Morelos 62250, México. Phone: 52-73-291644. Fax: 52-73-172388. E-mail: espin{at}ibt.unam.mx.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. |
Bali, A.,
G. Blanco,
S. Hill, and C. Kennedy.
1992.
Excretion of ammonium by a nifL mutant of Azotobacter vinelandii fixing nitrogen.
Appl. Environ. Microbiol.
58:1711-1718 |
| 2. |
Campos, M.-E.,
J. M. Martínez-Salazar,
L. Lloret,
S. Moreno,
C. Núñez,
G. Espín, and G. Soberón-Chávez.
1996.
Characterization of the gene coding for GDP-mannose dehydrogenase (algD) from Azotobacter vinelandii.
J. Bacteriol.
178:1793-1799 |
| 3. | Chitnis, C. E., and D. E. Ohman. 1993. Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure. Mol. Microbiol. 8:583-590[Medline]. |
| 4. |
Darzins, A., and A. M. Chakrabarty.
1984.
Cloning of genes controlling alginate biosynthesis from a mucoid cystic fibrosis isolate of Pseudomonas aeruginosa.
J. Bacteriol.
159:9-19 |
| 5. |
Deretic, V.,
R. Dikshit,
W. M. Konyecsni,
A. M. Chakrabarty, and T. K. Misra.
1989.
The algR gene, which regulates mucoidy in Pseudomonas aeruginosa, belongs to a class of environmentally responsive genes.
J. Bacteriol.
171:1278-1283 |
| 6. |
Deretic, V., and W. M. Konyecsni.
1989.
Control of mucoidy in Pseudomonas aeruginosa: transcriptional regulation of algR and identification of the second regulatory gene, algQ.
J. Bacteriol.
171:3680-3688 |
| 7. |
Deretic, V.,
M. J. Schurr,
J. C. Boucher, and D. W. Martin.
1994.
Conversion of Pseudomonas aeruginosa to mucoidy in cystic fibrosis: environmental stress and regulation of bacterial virulence by alternative sigma factors.
J. Bacteriol.
176:2773-2780 |
| 8. | Fellay, R., J. Frey, and H. Krisch. 1987. Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of Gram-negative bacteria. Gene 52:147-154[Medline]. |
| 9. |
Fialho, A. M.,
N. A. Zielinski,
W. F. Fett,
A. M. Chakrabarty, and A. Berry.
1990.
Distribution of alginate gene sequences in the Pseudomonas rRNA homology group I-Azomonas-Azotobacter lineage of superfamily B procaryotes.
Appl. Environ. Microbiol.
56:436-443 |
| 10. |
Gacesa, P.
1998.
Bacterial alginate biosynthesis, recent progress and future prospects.
Microbiology
144:1133-1143 |
| 11. | Govan, J. R. W. 1988. Alginate biosynthesis and other unusual characteristics associated with the pathogenesis of Pseudomonas aeruginosa in cystic fibrosis, p. 67-96. In E. Griffiths, W. Donachie, and J. Stephen (ed.), Bacterial infections of respiratory and gastrointestinal mucosae. IRL Press, Oxford, England. |
| 12. | Hanahan, D. 1983. Studies on transformation of E. coli. J. Mol. Biol. 166:557-580[Medline]. |
| 13. |
Hershberger, C. D.,
R. W. Ye,
M. R. Parsek,
Z. D. Xie, and A. M. Chakrabarty.
1995.
The algT (algU) gene of Pseudomonas aeruginosa, a key regulator involved in alginate biosynthesis, encodes an alternative factor (E).
Proc. Natl. Acad. Sci. USA
92:7941-7945 |
| 14. |
Holloway, B. W.
1955.
Genetic recombination in Pseudomonas aeruginosa.
J. Gen. Microbiol.
13:572-581 |
| 15. | Kennedy, C., R. Gamal, R. Hummprey, J. Ramos, K. Brigle, and D. Dean. 1986. The nifH, nifM, and nifN genes of Azotobacter vinelandii: characterization by Tn5 mutagenesis and isolation from pLARF1 gene banks. Mol. Gen. Genet. 205:318-325. |
| 16. | Lloret, L., R. Barreto, R. León, S. Moreno, J. Martínez-Salazar, G. Espín, and G. Soberón-Chávez. 1996. Genetic analysis of the transcriptional arrangement of Azotobacter vinelandii alginate biosynthetic genes: identification of two independent promoters. Mol. Microbiol. 21:449-457[Medline]. |
| 17. |
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275 |
| 18. |
Ma, S.,
U. Selvaraj,
D. E. Ohman,
R. Quarless,
D. J. Hassett, and D. J. Wozniak.
1998.
Phosphorylation-independent activity of the response regulators AlgB and AlgR in promoting alginate biosynthesis in mucoid Pseudomonas aeruginosa.
J. Bacteriol.
180:956-968 |
| 19. |
Martin, D. W.,
M. J. Schurr,
H. Yu, and V. Deretic.
1994.
Analysis of promoters controlled by the putative sigma factor AlgU regulating conversion to mucoidy in Pseudomonas aeruginosa: relationship to E and stress response.
J. Bacteriol.
176:6688-6696 |
| 20. |
Martínez-Salazar, J. M.,
S. Moreno,
R. Nájera,
J. C. Boucher,
G. Espín,
G. Soberón-Chávez, and V. Deretic.
1996.
Characterization of the genes coding for the putative sigma factor AlgU and its negative regulators MucA, MucB, MucC, and MucD in Azotobacter vinelandii and evaluation of their roles in alginate biosynthesis.
J. Bacteriol.
178:1800-1808 |
| 21. | May, T., and A. M. Chakrabarty. 1994. Pseudomonas aeruginosa: genes and enzymes of alginate synthesis. Trends Microbiol. 2:151-157[Medline]. |
| 22. | Mejía-Ruíz, H., J. Guzmán, S. Moreno, G. Soberón-Chávez, and G. Espín. 1997. The Azotobacter vinelandii alg8 and alg44 genes are essential for alginate synthesis and can be transcribed from an algD-independent promoter. Gene 199:271-277[Medline]. |
| 23. | Mejía-Ruíz, H., S. Moreno, J. Guzmán, R. Nájera, R. León, G. Soberón-Chávez, and G. Espín. 1997. Isolation and characterization of an Azotobacter vinelandii algK mutant. FEMS Microbiol. Lett. 156:101-106[Medline]. |
| 24. | Miller, J. H. 1972. Experiments in molecular genetics, p. 431-435. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 25. |
Mohr, C. D.,
N. S. Hibler, and V. Deretic.
1991.
AlgR, a response regulator controlling mucoidy in Pseudomonas aeruginosa, binds to the FUS sites of the algD promoter located unusually far upstream from the mRNA start site.
J. Bacteriol.
173:5136-5143 |
| 26. |
Mohr, C. D.,
J. H. J. Leveau,
D. P. Krieg,
N. S. Hibler, and V. Deretic.
1992.
AlgR binding sites within the algD promoter make up a set of inverted repeats separated by a large intervening segment of DNA.
J. Bacteriol.
174:6624-6633 |
| 27. | Mohr, C. D., D. W. Martin, W. N. Konyecsni, J. R. W. Govan, S. Lory, and V. Deretic. 1990. Role of the far-upstream sites of the algD promoter and the algR and rpoN genes in environmental modulation of mucoidy in Pseudomonas aeruginosa. J. Mol. Biol. 172:6576-6580. |
| 28. | Mohr, C. D., S. K. Sonsteby, and V. Deretic. 1994. The Pseudomonas aeruginosa homologs of hemC and hemD are linked to the gene encoding the regulator of mucoidy algR. Mol. Gen. Genet. 242:177-184[Medline]. |
| 29. |
Moreno, S.,
J. Guzmán,
R. Nájera,
G. Soberón-Chávez, and G. Espín.
1998.
Role of the alternative E factor AlgU in encystment of Azotobacter vinelandii.
J. Bacteriol.
180:2766-2769 |
| 30. | Msadek, T., F. Kunst, and G. Rapoport. 1995. A signal transduction network in Bacillus subtilis includes the DegS/DegU and ComP/ComA two-component systems, p. 447-471. In J. A. Hoch, and T. J. Silhavy (ed.), Two-component signal transduction. ASM Press, Washington, D.C. |
| 31. |
Page, W. J., and H. L. Sadoff.
1975.
Relationship between calcium and uronic acids in the encystment of Azotobacter vinelandii.
J. Bacteriol.
122:145-151 |
| 32. | Pindar, D. F., and C. Bucke. 1975. The biosynthesis of alginic acid by Azotobacter vinelandii. Biochem. J. 152:617-622[Medline]. |
| 33. |
Rehm, H. A.,
H. Ertesvag, and S. Valla.
1996.
A new Azotobacter vinelandii mannuronan C-5 epimerase gene (algG) is part of an alg gene cluster physically organized in a manner similar to that in Pseudomonas aeruginosa.
J. Bacteriol.
178:5884-5889 |
| 34. |
Sadoff, H. L.
1975.
Encystment and germination in Azotobacter vinelandii.
Bacteriol. Rev.
39:516-539 |
| 35. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 36. |
Schurr, M. J.,
D. W. Martin,
M. H. Mudd, and V. Deretic.
1994.
Gene cluster controlling conversion to alginate-overproducing phenotype in Pseudomonas aeruginosa: functional analysis in a heterologous host and role in the instability of mucoidy.
J. Bacteriol.
176:3375-3382 |
| 37. |
Schurr, M. J.,
H. Yu,
J. M. Martínez-Salazar,
J. C. Boucher, and V. Deretic.
1996.
Control of AlgU, a member of the E-like family of stress sigma factors, by the negative regulators MucA and MucB and Pseudomonas aeruginosa conversion to mucoidy in cystic fibrosis.
J. Bacteriol.
178:4997-5004 |
| 38. | Strom, M. S., and S. Lory. 1993. Structure-function and biogenesis of the type IV pili. Annu. Rev. Microbiol. 47:565-596[Medline]. |
| 39. |
Whitchurch, C. B.,
R. A. Alm, and J. S. Mattick.
1996.
The alginate regulator AlgR and an associated sensor FimS are required for twitching motility in Pseudomonas aeruginosa.
Proc. Natl. Acad. Sci. USA
93:9839-9843 |
| 40. |
Wozniak, D. J., and D. E. Ohman.
1991.
Pseudomonas aeruginosa AlgB, a two-component response regulator of the NtrC family, is required for algD transcription.
J. Bacteriol.
173:1406-1413 |
| 41. |
Wozniak, D. J., and D. E. Ohman.
1994.
Transcriptional analysis of the Pseudomonas aeruginosa genes algR, algB, and algD reveals a hierarchy of alginate gene expression which is modulated by algT.
J. Bacteriol.
176:6007-6014 |
| 42. |
Wyss, O.,
M. G. Newmann, and M. D. Socolofsky.
1961.
Development and germination of the Azotobacter cyst.
J. Biophys. Biochem. Cytol.
10:555-565.
|
| 43. |
Xie, Z.-D.,
C. D. Hershberger,
S. Shankar,
R. W. Ye, and A. M. Chakrabarty.
1996.
Sigma factor-anti-sigma factor interaction in alginate synthesis: inhibition of AlgT by MucA.
J. Bacteriol.
178:4990-4996 |
| 44. |
Yu, H.,
M. Mudd,
J. C. Boucher,
M. J. Schurr, and V. Deretic.
1997.
Identification of the algZ gene upstream of the response regulator algR and its participation in control of alginate production in Pseudomonas aeruginosa.
J. Bacteriol.
179:187-193 |
Journal of Bacteriology, January 1999, p. 141-148, Vol. 181, No. 1
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Setubal, J. C., dos Santos, P., Goldman, B. S., Ertesvag, H., Espin, G., Rubio, L. M., Valla, S., Almeida, N. F., Balasubramanian, D., Cromes, L., Curatti, L., Du, Z., Godsy, E., Goodner, B., Hellner-Burris, K., Hernandez, J. A., Houmiel, K., Imperial, J., Kennedy, C., Larson, T. J., Latreille, P., Ligon, L. S., Lu, J., Maerk, M., Miller, N. M., Norton, S., O'Carroll, I. P., Paulsen, I., Raulfs, E. C., Roemer, R., Rosser, J., Segura, D., Slater, S., Stricklin, S. L., Studholme, D. J., Sun, J., Viana, C. J., Wallin, E., Wang, B., Wheeler, C., Zhu, H., Dean, D. R., Dixon, R., Wood, D.
(2009). Genome Sequence of Azotobacter vinelandii, an Obligate Aerobe Specialized To Support Diverse Anaerobic Metabolic Processes. J. Bacteriol.
191: 4534-4545
[Abstract] [Full Text] -
Nunez, C., Bogachev, A. V., Guzman, G., Tello, I., Guzman, J., Espin, G.
(2009). The Na+-translocating NADH : ubiquinone oxidoreductase of Azotobacter vinelandii negatively regulates alginate synthesis. Microbiology
155: 249-256
[Abstract] [Full Text] -
Berleman, J. E., Hasselbring, B. M., Bauer, C. E.
(2004). Hypercyst Mutants in Rhodospirillum centenum Identify Regulatory Loci Involved in Cyst Cell Differentiation. J. Bacteriol.
186: 5834-5841
[Abstract] [Full Text] -
Nunez, C., Adams, L., Childers, S., Lovley, D. R.
(2004). The RpoS Sigma Factor in the Dissimilatory Fe(III)-Reducing Bacterium Geobacter sulfurreducens. J. Bacteriol.
186: 5543-5546
[Abstract] [Full Text] -
Grangeasse, C., Obadia, B., Mijakovic, I., Deutscher, J., Cozzone, A. J., Doublet, P.
(2003). Autophosphorylation of the Escherichia coli Protein Kinase Wzc Regulates Tyrosine Phosphorylation of Ugd, a UDP-glucose Dehydrogenase. J. Biol. Chem.
278: 39323-39329
[Abstract] [Full Text] -
Heulin, T., Barakat, M., Christen, R., Lesourd, M., Sutra, L., De Luca, G., Achouak, W.
(2003). Ramlibacter tataouinensis gen. nov., sp. nov., and Ramlibacter henchirensis sp. nov., cyst-producing bacteria isolated from subdesert soil in Tunisia. Int. J. Syst. Evol. Microbiol.
53: 589-594
[Abstract] [Full Text] -
Castaneda, M., Sanchez, J., Moreno, S., Nunez, C., Espin, G.
(2001). The Global Regulators GacA and sigma S Form Part of a Cascade That Controls Alginate Production in Azotobacter vinelandii. J. Bacteriol.
183: 6787-6793
[Abstract] [Full Text] -
Núñez, C., León, R., Guzmán, J., Espín, G., Soberón-Chávez, G.
(2000). Role of Azotobacter vinelandii mucA and mucC Gene Products in Alginate Production. J. Bacteriol.
182: 6550-6556
[Abstract] [Full Text] -
Sabra, W., Zeng, A.-P., Lünsdorf, H., Deckwer, W.-D.
(2000). Effect of Oxygen on Formation and Structure of Azotobacter vinelandii Alginate and Its Role in Protecting Nitrogenase. Appl. Environ. Microbiol.
66: 4037-4044
[Abstract] [Full Text] -
Núñez, C., Moreno, S., Cárdenas, L., Soberón-Chávez, G., Espín, G.
(2000). Inactivation of the ampDE Operon Increases Transcription of algD and Affects Morphology and Encystment of Azotobacter vinelandii. J. Bacteriol.
182: 4829-4835
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»