Previous Article | Next Article 
Journal of Bacteriology, January 1999, p. 197-203, Vol. 181, No. 1
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Protein Mobility in the Cytoplasm of
Escherichia coli
Michael B.
Elowitz,1,2,*
Michael G.
Surette,2,
Pierre-Etienne
Wolf,1,2,
Jeffry B.
Stock,2 and
Stanislas
Leibler1,2
Departments of
Physics1 and
Molecular
Biology,2 Princeton University, Princeton, New
Jersey 08544
Received 7 August 1998/Accepted 21 October 1998
 |
ABSTRACT |
The rate of protein diffusion in bacterial cytoplasm may constrain
a variety of cellular functions and limit the rates of many biochemical
reactions in vivo. In this paper, we report noninvasive measurements of
the apparent diffusion coefficient of green fluorescent protein (GFP)
in the cytoplasm of Escherichia coli. These measurements were made in two ways: by photobleaching of GFP fluorescence and by
photoactivation of a red-emitting fluorescent state of GFP (M. B. Elowitz, M. G. Surette, P. E. Wolf, J. Stock, and S. Leibler, Curr. Biol. 7:809-812, 1997). The apparent diffusion coefficient, Da, of GFP in E. coli DH5
was
found to be 7.7 ± 2.5 µm2/s. A 72-kDa fusion
protein composed of GFP and a cytoplasmically localized maltose binding
protein domain moves more slowly, with Da of
2.5 ± 0.6 µm2/s. In addition, GFP mobility can
depend strongly on at least two factors: first,
Da is reduced to 3.6 ± 0.7 µm2/s at high levels of GFP expression; second, the
addition to GFP of a small tag consisting of six histidine residues
reduces Da to 4.0 ± 2.0 µm2/s. Thus, a single effective cytoplasmic viscosity
cannot explain all values of Da reported here.
These measurements have implications for the understanding of
intracellular biochemical networks.
 |
INTRODUCTION |
Response times and reaction rates in
Escherichia coli often depend on the movement of proteins
from one location to another in the cell. These proteins may have
regulatory or signaling functions, or they may act as enzymes or
substrates for cellular reactions. How do such molecules reach their
destinations? In eukaryotic cells, cytoskeletal networks and motor
proteins facilitate active transport of molecules (1). In
some cases, including Drosophila oocytes, mixing of
cytoplasm can also be achieved by the cytoskeleton-dependent process of
cytoplasmic streaming (27). However, such structures and
processes have not been observed in bacteria. Therefore, in bacteria,
diffusion may be the primary means of intracellular movement. The
diffusional mobility of cytoplasmic proteins may constrain the rates of
some cellular reactions. The in vivo diffusive properties of proteins
are therefore of general interest for understanding a variety of
processes in the bacterial cell.
The interior of a bacterial cell is an environment crowded with a
heterogeneous collection of macromolecules. In E. coli, the
concentrations of protein, RNA, and DNA are 200 to 320 mg/ml, 75 to 120 mg/ml, and 11 to 18 mg/ml, respectively (6, 30). These high
macromolecular concentrations imply large excluded volume effects,
which strongly affect the activities of cytoplasmic molecules (14,
30). The validity of extrapolations from the values of physical
or biochemical constants measured at lower macromolecular
concentrations in cell-free in vitro systems to their effective values
in actual cytoplasm is therefore uncertain (12). In
particular, the rate of protein diffusion inside the cell cannot
necessarily be inferred from in vitro measurements.
One of the most useful techniques for studying cytoplasmic diffusion in
eukaryotic cells and cell membranes has been the method of
"fluorescence recovery after photobleaching" (FRAP) (3, 16). By this method, fluorescent tracer molecules are introduced into the cell. Those tracers located in a small region are
photobleached by a laser. The size, L, of the bleached area,
and the characteristic time,
, over which unbleached tracer
molecules return to it, determine an apparent diffusion coefficient,
Da, which is proportional to
L2/
. In spot photobleaching experiments,
L is the diameter of the spot, whereas in the experiments
described here, it is the length of the cell. For diffusive particles,
Da is independent of L and equal to
the diffusion coefficient, D. In a nonideal medium, on the
other hand, particles may behave nondiffusively or exhibit anomalous
diffusion, in which case the apparent diffusion coefficient, Da, will depend on L (21).
Because the cytoplasm may be such an environment, mobility measurements
are reported here in terms of an apparent diffusion coefficient,
Da, valid specifically at the scale of the cell length.
Until now, it has been difficult to apply FRAP to E. coli
cells. These bacteria are smaller than the eukaryotic cells previously studied by FRAP, and it is difficult to introduce fluorescently labeled
molecules into them. Here, we have used the Aequorea
victoria green fluorescent protein (GFP) as a tracer molecule to
measure cytoplasmic protein diffusion. Like fluorochromes used in
previous FRAP experiments, GFP can be irreversibly photobleached with
sufficiently intense illumination (25). Unlike traditional
FRAP fluorophores, however, GFP can be expressed endogenously. Further,
it was recently shown that under conditions of low oxygen
concentration, a short pulse of blue light converts the normally
green-emitting GFP to a red-emitting state (10). Thus,
apparent diffusion coefficients can also be measured by photoactivating
GFP molecules at one pole and observing their subsequent propagation
through the cell. Together, photobleaching and photoactivation
techniques permit us to make direct in vivo measurements of protein
diffusion in bacterial cytoplasm.
 |
MATERIALS AND METHODS |
Bacterial strains and GFP constructs.
The GFPmut2 allele of
GFP, obtained by Cormack et al. (7), was selected because it
is efficiently excited, photobleached, and photoactivated by the 488-nm
argon laser line. GFPmut2 DNA was amplified with primers to generate 5'
BamHI and 3' HindIII sites
(CCGGATCCGGCATGAGTAAAGGAGAAGA and
GCCGAAGCTTATTTGTATAGTTCATCCA, respectively). The resulting
DNA was cloned into plasmid pQE-12 (Qiagen) and cut with the
BamHI and HindIII enzymes, removing the
six-His tag sequence. The resulting plasmid, pMGS053, expresses a GFP
with a molecular mass of 27.5 kDa. An N-terminal polyhistidine-tagged GFP was generated by amplifying GFPmut2 with primers to generate 5'
BamHI and 3' BamHI sites
(CCGGATCCGGCATGAGTAAAGGAGAAGA and CCGGATCCGGCTTTGTATAGTTCATCCA, respectively) and inserted
into the BamHI site of pQE-8 (Qiagen). This BamHI
GFP-encoding DNA was also cloned into the BamHI site of
plasmid pMAL-C2 (New England Biolabs) to generate a cytoplasmically
expressed maltose binding protein (MBP)-GFP fusion of approximately 72 kDa. For most experiments, the plasmids were transformed into E. coli DH5
. In addition, the following E. coli strains
transformed with pMGS053 were examined: AB1157 (9),
M15(pREP4) (Qiagen), MC1000 (5), MC1061 (5), MG1655 (13), and RP437 (18). For some
experiments, the GFPuv gene was expressed from plasmid pGFPuv
(Clontech) transformed into strain DH5
. GFPuv is a brighter GFP
mutant which has the spectral characteristics of the wild-type protein
(8).
Preparation of samples.
Bacterial cultures were grown
overnight in Luria broth with ampicillin at 30°C with constant
shaking, diluted 1:50 into the same medium, and grown at 30°C. After
2 h, cultures were induced by adding 100 µM (or as indicated)
IPTG (isopropyl-
-D-thiogalactopyranoside) and allowed to
continue growth for 3 h. Cells from 1 ml of culture were harvested
at 3,000 rpm in a microcentrifuge and resuspended in 0.5 ml of minimal
medium [7.6 mM (NH4)2SO4, 60 mM
K2HPO4, 2 mM MgSO4, 20 µM
FeSO4, 1 mM EDTA (pH 6.8)]. Coverslips were pretreated for
15 min with poly-L-lysine solution (Sigma Chemical Co.) to promote cell adhesion and washed with ~2 ml of minimal medium. A drop
of bacterial suspension (~100 µl) was incubated on the treated
coverslip for <30 min. Coverslips were then rinsed again with minimal
medium (~2 ml) and placed on a microscope slide. Excess fluid was
drained from the slide with Kimwipes, and the slides were sealed with
candle wax. Poly-L-lysine pretreatment of coverslips
resulted in uniform adhesion of cells at high density. Samples prepared
without poly-L-lysine, in which cells were stuck nonspecifically to the glass surface, gave similar results (data not shown).
Elongated cells were grown as described above, except that at 1.5 h after addition of IPTG, cephalexin (Sigma) at 1, 2.5, 5, 15, 25, and
100 µg/ml was added to 1-ml aliquots of cells, which were then
allowed to grow for another 1 to 2 h. Samples of each culture were
examined under the microscope; the culture that contained elongated
cells with the lowest concentration of cephalexin (typically, 15 µg/ml) was used for further study.
Optics and microscope setup.
The 488-nm component from a
multiline air-cooled He-Ar tabletop laser was separated out with a
prism and focused to a small spot (~0.7 µm in diameter) in the
image plane of a custom-modified Zeiss MPS microscope. The beam
emerging from the laser was directed through a shutter/timer (UniBlitz)
and then coupled to the microscope by means of a dichroic beamsplitter
inserted in the optical path above the objective and fluorescence
filter cube but below the trinocular eyepiece/camera stand. To permit
the laser light to reach the sample, dichroic beamsplitters in the
fluorescence filter sets were replaced with 50/50 beamsplitters
(Chroma), and fluorescence emission filters were removed from the
filter cube and placed above the laser-coupling dichroic with an extra
filter slider (Mikro Precision) inserted just below the trinocular but
above the laser-coupling dichroic. Fluorescence filters were Chroma HQ-FITC, no. 41001, for green GFP fluorescence and Zeiss rhodamine, no.
487915, for red GFP fluorescence. Prior to microscope entry, the laser
beam was directed through a steering telescope consisting of two
confocal lenses so that translation of the first lens perpendicular to
the beam allowed steering of the laser spot in the sample plane. The
total power entering the microscope was 0.25 mW. About 30% was
transmitted to the sample, corresponding to a flux of 17 kW/cm2 in the sample plane.
A 100× infinity-corrected 0.9-1.3 NA oil objective (Olympus) and a
video charge-coupled device (CCD) camera (Paultek) were mounted on the
microscope. The video CCD signal was recorded with an SVHS VCR (Sanyo)
and later digitized from tape with a Cosmo Compress M-JPEG card
(Silicon Graphics) at JPEG quality levels of
95 on an Indy
Workstation (Silicon Graphics). Custom software was written to
decompress and extract regions of interest from the M-JPEG movie file.
For some experiments, and for calibrating laser spot size, the video
CCD camera was replaced with a cooled CCD camera (Princeton
Instruments) running at frame rates of from 5 to 20 frames per second,
in which case the digitization step was omitted.
Photobleaching and photoactivation of GFP.
For
photobleaching experiments, a cell was positioned in the center of the
field of view, laser intensity was cut by a factor of 103,
and the laser spot was moved to one pole of the cell. The shutter was
programmed for periodic light pulses of 300 ms, separated by 8-s
pauses. The duration of the photobleaching pulse was chosen to be
comparable to the diffusion time across the cell, so as to develop a
large concentration gradient with minimum photobleaching of GFP.
Accordingly, for the (longer) cephelaxin-treated cells, the pulse
duration was increased, usually to 500 to 700 ms and always less than
1 s.
For photoactivation, cells were extremely dim or invisible in red
fluorescence at the beginning of the experiment (i.e., before photoactivation), so they were selected in bright field (a red long-pass filter above the condenser prevented inadvertent
photoactivation). Cells were aligned and irradiated as described above
except that much shorter (30-ms) laser pulses (at the same power) were
used to photoactivate the red state of GFP. Photoactivation of GFP is
optimal in a low-oxygen environment (10). The high density of O2-consuming cells used here was sufficient to deplete
oxygen levels for photoactivation without specific deoxygenating reagents.
For measurements of the GFPuv variant, cells containing plasmid pGFPuv
were induced with 1 mM IPTG to compensate for poorer expression and
were photoisomerized before use by illumination through a DAPI
(4',6-diamidino-2-phenylindole) filter set for a few seconds at full
power with the 100-W Hg arc lamp. This procedure reduces the amplitude
of the UV excitation peak while enhancing the amplitude of the blue
excitation peak (4).
Note that a potential artifact occurs in cells close to full septation.
GFP diffuses much more slowly across the nearly complete septum than it
does through the rest of the cell (data not shown), reducing the
apparent rate of whole-cell diffusion (mode 1) relative to the
corresponding half-cell process (mode 2). Cells undergoing septation
were avoided for this reason.
Tethered-cell photodamage assay.
To test phototoxicity by a
tethered-cell assay, RP437, a strain commonly used in chemotaxis
studies, was transformed with pMGS053 and cells were grown and tethered
as described previously (24). Expression of GFPmut2 had no
effect on chemotaxis in this strain (data not shown). Cells were
videotaped and laser treated as described above. Rotating cells were
photobleached with a laser as described above, and their angular
velocities were determined, as described previously (2).
Data analysis.
The data set we obtained was a time sequence
of fluorescence images of the cell. For analysis, a threshold was
chosen and only pixels whose intensities were greater than this value
were considered. The cell axis was determined manually. In each frame, the two-dimensional cell image was converted to a one-dimensional intensity profile by grouping pixels in stripes perpendicular to the
cell axis. Each stripe was represented by its average projected position on the bacterial axis and by its average intensity value. The
ends of the intensity profile were truncated in order to avoid problems
due to the curvature of the cell poles and the optical resolution of
the microscope. Resulting values of Da are
insensitive to the precise position of this truncation.
Our analysis is based on the one-dimensional continuous diffusion
equation
C(x,t)/
t = D
2C(x,t)/
x2,
with boundary conditions
C/
x (0,t) =
C/
x (L, t) = 0. The general solution to this equation can be
written as a Fourier series:
|
(1)
|
where An(t)
A n
exp(
qn2Dt), and qn
, n = 1, 2, 3, ... Here,
C(x,t) is the concentration of GFP at position
x and at time t, and D is the
diffusion coefficient. We assume that fluorescence intensity is
proportional to GFP concentration:
|
(2)
|
To analyze the data, the Fourier amplitudes
An(t) for each frame are determined from the
data I(x,t) with the formula
|
(3)
|
If the data solve the diffusion equation,
An(t) will be proportional to
exp(
qn2Dt). Therefore, we perform
a three-parameter fit of An(t) to the general
exponential form Aexp(
Bt) + C. Here,
C takes into account potential permanent intensity gradients
that might arise from in homogeneities in cross-sectional area or
uneven illumination intensity. We find C/A
1, indicating
that such effects are small. Da is determined by
the decay rate, B, according to Da = B/qn2. Fits were performed by a
Levenberg-Marquardt algorithm, implemented in C (20). Figure
2A shows a typical sequence of one-dimensional profiles,
I(xi,tj), and a
plot of A1(t) with a fitted exponential. Only
lower-numbered terms in the series decay slowly enough to be followed
with video-rate cameras; in this study we used modes n = 1 and n = 2 exclusively.
GFP photoconverts to its red-emitting state with a time constant of
~0.7 s (10), comparable to the diffusion time along the
cell (see Fig. 2D, inset). Therefore, in photoactivation experiments, I(x,t) varies with time due to both photoconversion and
diffusion, so the analysis procedure must be modified. If we assume
that the rate of GFP conversion is independent of its position in the cell and local concentration, then I(x,t) is proportional to
the product of the local fraction of newly photoactivated GFP,
C*(x,t), and the total red fluorescence enhancement in the
whole cell. That is, I(x,t)
C*(x,t)[
(t)], where
(t) is the sum of the pixel intensities in the cell body
at time t. We fit An(t), as defined
in equation 3, to the three-parameter function A[
(t)
0] exp(
Bt) + C,
where
0 is
(t) evaluated just prior
to the laser pulse. Since the parameter C remains small, the
fit can alternatively be made to A[
(t)
0]
exp(
Bt), resulting in differences in
Da of <3%. This procedure is insensitive to
the shape of the photoactivation kinetics,
(t)
0, although in practice we find that
the photoactivation kinetics are reasonably approximated by a single exponential.
To check for systematic analysis errors, GFP diffusion was simulated on
a computer and simulations were analyzed like real data. We assumed
exact diffusion of GFP in a one-dimensional geometry and allowed values
for the apparent diffusion coefficient, cell length, signal intensity,
noise, camera frame rate, and background bleaching rate to be set for
each episode of photobleaching recovery. Analysis was performed
"blind," without knowledge of the correct answer. The error found
upon comparison of "measured" values with "correct" values
resulted primarily from overestimates of cell length (due to the
difficulty of resolving cell ends). When cell lengths were corrected,
errors of <5% remained. These simulations served to, first, verify
the data analysis procedure; second, provide a limit of ~5% on its
accuracy; and third, suggest that cell length determination might be a
major source of systematic error in the analysis of real data. We have
no alternative measure of cell length with which to correct real data,
but we found no significant correlation between
Da and L in a sample of 91 DH5
cells ranging in length from 3 to 5.5 µm. The relative magnitude of
errors in L should be smaller for longer cells. Measurements on cephalexin-treated cells were consistent with measurements made on
untreated, normal-length cells.
 |
RESULTS |
In vivo measurement of GFP diffusion.
We set out to measure
diffusion of GFP in the cytoplasm of E. coli by
photobleaching and photoactivation. In these experiments, we focused a
laser through microscope optics to a small spot and used it to
photobleach GFP near the pole of a single cell. Afterwards, we recorded
the distribution of unbleached GFP throughout the cell with a video CCD
camera. Use of the FRAP technique with image data in the small
quasicylindrical geometry of the bacterial cell called for a method of
analysis which considers the concentration of GFP throughout the cell
rather than only in the photobleached region (see Materials and Methods).
We first measured diffusion of the popular GFP variant GFPmut2
(7) in DH5
cells. Figure 1
(columns A and C) shows fluorescence images from two typical cells
taken before and at various intervals after photobleaching. Figure
2A shows the one-dimensional intensity profile along the length of a cell at different times after
photobleaching. The apparent diffusion coefficient was determined from
the decay rate of the amplitude of the first Fourier mode (Fig. 2B;
also see Materials and Methods). Diffusion was measured this way in 120 individual DH5
cells. The distribution of apparent diffusion coefficients is shown in Fig. 3. The
value of Da assigned to each cell is the average
obtained from several successive laser pulses. The average value of
Da for all cells is 7.7 µm2/s,
with a standard deviation (SD) of 2.5 µm2/s. Other common
laboratory strains of E. coli showed similar behaviors
(Table 1). However, strain AB1157, which
expresses very high levels of GFP, has a Da 43%
lower than DH5
(4.4 µm2/s). Therefore, we increased
the expression level of GFP in DH5
cells. When the concentration of
inducer (IPTG) was increased from 100 to 500 µM, the apparent
diffusion coefficient was indeed reduced to 4.8 µm2/s,
and at 1 mM IPTG, Da was further reduced to 3.6 µm2/s (Table 1). In addition to GFPmut2, we also
performed experiments with the GFPuv (Clontech) variant, because it was
previously found to exhibit modified diffusive behavior in eukaryotic
cells (29). However, in bacteria, we observed no differences
in its apparent diffusion coefficient.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
Snapshots from photobleaching and photoactivation
experiments. In each column the first row shows the cell before the
laser pulse. The next three images show the cellular fluorescence
distribution at subsequent times after the laser pulse. Columns A, C,
E, and F show photobleaching (GFP filter set, false color green).
Columns B and D show photoactivation (rhodamine filter set, false color
red). Columns A to D show two different DH5 cells expressing GFP (A
and B show cell 1; C and D show cell 2). Columns E and F show a
cephalexin-treated DH5 cell, expressing GFP, being bleached first at
the pole (E) and then at the center (F). Time points are as follows
(t = 0 is set arbitrarily as the end of the laser
pulse). (A) 0.42, 0.05, 0.18, 0.32, and 4.3 s. (B) 0.08, 0.08, 0.35, 0.62, and 4.7 s. (C) 0.5, 0.03, 0.10, 0.23, and 0.83 s. (D) 0.1, 0.03, 0.23, 0.63, and 1.7 s. (E) 0.57, 0.03, 0.43, 0.77, and 2.8 s. (F) 0.57, 0.03, 0.20, 0.37, and 1.8 s.
Bar = 4 µm.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Analysis of photobleaching (A and B) and photoactivation
(C and D) data. (A) Fluorescence intensity profiles at 0.03, 0.1, 0.17, 0.3, 0.5, 0.83, and 1.5 s after the end of photobleaching are
shown for a DH5 cell expressing GFP. (B) For the same cell, temporal
decay of first Fourier amplitude with time. Circles indicate data
points; the solid line is a fit to the exponential function
Aexp( Bt) + C (see Materials and Methods). (C)
Photoactivation intensity profiles are shown at the same time points as
in panel A. (D) Temporal decay of first Fourier amplitude. The data are
shown with circles, and a fit to an exponential decay corrected by the
total cellular fluorescence enhancement is shown with a solid line (see
Materials and Methods). The inset shows the total cellular fluorescence
(t). In panel B, the total intensity after photobleaching
is constant (not shown).
|
|

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Histogram of apparent diffusion coefficients for 120 DH5 cells measured by photobleaching. (Inset) Distribution of cell
lengths for the same data. There is no significant correlation between
cell length and apparent diffusion coefficient.
|
|
Photoactivation of red GFP.
In addition to FRAP, we used
photoactivation of a red fluorescent state of GFP (10). This
method allowed us to reduce the irradiation energy by a factor of 10. Time sequences from typical photoactivation experiments are shown in
Fig. 1B and D. One-dimensional intensity profiles along the length of
one cell are given in Fig. 2C at different times after the laser pulse.
Photoactivation of GFP occurs slowly, with a half time of 0.7 s
(10). Therefore, Fourier amplitudes were normalized
according to the total fluorescence in the cell, as described in
Materials and Methods. A typical fit to the normalized exponential
decay function is shown in Figure 2D. In most cases, useful data were
obtained from three successive pulses before photoactivation was
complete. Then, we switched to the GFP-FITC filter set and performed
the photobleaching experiment on the same cell. The average ratio of
Da measured by photoactivation to
Da measured by photobleaching (on the same cell)
(± SD) was 1.1 ± 0.15 for 34 cells. This indicates that the two
methods provide equivalent information.
Experiments with GFP fusion proteins.
In addition to ordinary
GFP, we measured diffusion of a somewhat larger fusion protein,
cMBP-GFP, which consists of MBP fused to the N terminus of GFP. This
protein lacks a periplasmic signal peptide and is confined to the
cytoplasm. Its molecular mass is 72 kDa, about 2.6 times larger than
GFP alone. Its apparent diffusion coefficient is 3.1 times lower than
that of GFP alone: 2.5 ± 0.6 µm2/s. In another
experiment, we measured diffusion of a GFP construct with six histidine
residues inserted at the N terminus of the protein. We obtained a broad
distribution of values for this construct, centered at a value lower
than that of GFP: 4.6 ± 2.0 µm2/s (Table 1).
Measurements with a histidine-tagged GFP-
-galactosidase fusion
protein were also attempted. This protein is fluorescent and possesses
a specific
-galactosidase activity approximately equal to that of
-galactosidase. Active
-galactosidase is known to be tetrameric.
The predicted molecular mass of a tetramer of this fusion protein is
~500 kDa. By fluorescence microscopy, cells appeared elongated and
fluorescence was observed in approximately two-thirds of each cell (in
the polar regions, but not in the center). When specific regions of the
cell were photoactivated or photobleached, no motion of GFP was
observed whatsoever, either between labelled regions or within a single
labelled region. This indicates that this complex is essentially
immobile in the cytoplasm.
FRAP and photoactivation of GFP were not phototoxic.
At very
high laser power, photodamage occurs and no fluorescence recovery is
seen in the photobleached spot. At the laser powers used here,
diffusive recovery of the bleached region was complete and no visible
signs of cell damage were detected. Nevertheless, we have tried to
assess the unintended side effects of our laser treatment in three
different ways.
The first indication that we caused only minimal perturbation to the
cell is that the measured apparent diffusion coefficients with
photobleaching and photoactivation were in close agreement even though
the former experiments required 10-fold longer laser pulses.
Second, in each photobleaching experiment a sequence of laser pulses
was applied at the same site on a single cell. The measured values of
Da were compared with one another as a function
of pulse number (see Fig. 5). Photoinduced cross-linking or other
photodamage might be expected to progressively modify diffusive
behavior. The absence of systematic variation in
Da with respect to pulse number implies that
successive pulses did not cause accumulating mobility-altering
photodamage to the cytoplasm.
Third, as an indication of potential photodamage, we observed the
response to irradiation of cells tethered by their flagella. The
flagellar motor is powered by a proton gradient across the cell
membrane; maintenance of a steady angular velocity indicates that the
cell can sustain a steady proton motive force. We tethered GFP-expressing cells to coverslips by single flagella via antibodies to
flagellin (24). The laser spot was focused on the stationary part of the rotating cell, and a series of laser pulses of the same
power and duration as those used in the diffusion experiments were
applied. We found reductions in angular velocity only after many more
pulses or at energies greater than those used in actual experiments
(data not shown).
These three types of experiments indicate that any potential damage to
cells was minimal and did not substantially affect the diffusive
behavior of GFP.
Ratio of decay rates for different diffusion modes.
Since the
diffusion time is proportional to L2, long cells
make higher decay modes accessible to measurement. To obtain the ratio
of the decay rates of the first and second Fourier modes on the same
cell, cells were treated with cephalexin, a drug which inhibits
septation and causes cells to grow into long filaments. Eleven cells
ranging in length from 7.5 to 11 µm were selected, and laser pulses
were applied alternately at the cell pole and the cell center until GFP
was completely photobleached. The first and second Fourier modes were
analyzed from recovery data after photobleaching of the cell pole and
center, respectively. An example of this experiment is presented in
Fig. 1E and F. Values obtained for Da were
7.2 ± 1.3 µm2/s (average ± SD; n = 8) for mode 1 and 6.8 ± 1.2 µm2/s for mode 2, consistent with the experiments done without cephelaxin on cells
roughly half as long. On an individual cell the ratio of the two modes
was close to unity, i.e., Da(1)/Da(2) = 1.06 with an SD of 0.11. Although a tendency toward ratios greater than 1 was observed (Fig. 4), this result
indicates that the mobility-determining properties of the cytoplasm are
not significantly compromised by cephalexin treatment and is an
important consistency check on the analysis technique.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4.
Ratio of apparent diffusion coefficients from Fourier
modes 1 and 2 on single cephalexin-treated cells. Error bars indicate
the SD of measurements over several laser pulses on the same cell. (For
cells 1 and 5, only one pulse was made; therefore, there are no error
bars.)
|
|
Sources of variation.
Errors and uncertainties in this
measurement can be divided into at least three categories. First, there
are "simple measurement errors" that affect measurements
independently, whether they are made on the same cell or on different
cells. Second, there are "cell errors," random errors that affect
different cells differently but have consistent effects when multiple
measurements are made on the same individual. Third, there is "true
variation," which occurs if individuals possess different values of
Da from one another. Multiple measurements were
made on each cell. A distribution of Da values
was thereby obtained for each individual. These distributions are, on
average, symmetric about their average value and display no systematic
trend with successive laser pulses (Fig.
5). For DH5
cells expressing GFP, the
average SD of these distributions was 0.77 µm2/s (10% of
the mean). This value is an estimate of the magnitude of the simple
measurement error. A second estimate of the same statistic is obtained
by assuming that GFP movement is diffusive and comparing the values of
Da obtained from the first and second Fourier
modes on the same cell. In that case we obtain a similar value, 0.55 µm2/s (6% of the mean). The mean values of the
single-cell Da distributions form another
distribution (Fig. 3). The width of this distribution is the
cell-to-cell variation. It equals 2.5 µm2/s, which is
more than three times larger than the measurement error. Its sources
include cell errors, such as cell length estimation, and true
variation, if it exists. Therefore, if natural variation of
Da exists in the population, the cell-to-cell
variation places an upper limit of 2.5 µm2/s, or 32% of
the mean, on its magnitude for GFP in DH5
cells.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 5.
Deviations of individual measurements of a single cell
from their average values. For each cell, measurements of
Da were made several times. (A) Value of
Da obtained with a given measurement ("Pulse
Number") minus the average of all such measurements on the same cell
as a function of the pulse number. There are fewer points at higher
pulse numbers because fewer cells were subjected to a large (>3) total
number of pulses. (B) Histograms of the data shown in panel A, showing
the number of points as a function of deviation, for the first four
pulses.
|
|
 |
DISCUSSION |
We have performed FRAP and photoactivation experiments to measure
the apparent diffusion coefficients of GFP and GFP fusion proteins in
living E. coli cells. Differences with previous FRAP experiments used in other systems included the use of red GFP photoactivation, requiring 10 times less energy than photobleaching, and the analysis of recovery data throughout the cell rather than only
in the irradiated spot. The apparent diffusion coefficient for GFP in
bacterial cytoplasm is 7.7 ± 2.5 µm2/s, about 11 times lower than in water (87 µm2/s) (25, 26)
and significantly lower than in eukaryotic cells (~27
µm2/s) (25) and mitochondria (20 to 30 µm2/s) (19). Previously reported in vitro
measurements suggest that background protein concentrations as high as
200 mg/ml (comparable to the total cellular protein concentration)
reduce the mobility of tracer proteins (17 to 150 kDa) by factors of
~3 (17). Therefore, direct effects of high total protein
concentrations in the cell may not be sufficient to account for the low
apparent diffusion coefficients observed here.
Low protein mobility might limit reaction times in some bacterial
signal transduction systems. For example, in E. coli
chemotaxis, cells change their swimming behavior in response to
attractants or repellents. This response is mediated by diffusion of a
14 kDa protein, CheY, from its site of phosphorylation to the flagellar motor. The chemotactic response time has been measured to be 50 to 200 ms (15, 23). Based on our measurements for GFP, the expected
time scale for diffusion of a small protein such as CheY through the
cytoplasm would be on the order of 100 ms over a distance of 1 µm and
thus comparable to the response time. These results are compatible with
those of Segall et al., who previously estimated the rate of CheY
diffusion to be about 10 µm2/s (22).
We observed no significant variations in the apparent GFP diffusion
coefficients between common laboratory strains, suggesting that
mobility is a property of the diffusing molecule (GFP) and generic
structural properties of the cytoplasm, rather than the specific
genetic background of the cell. In contrast, GFP concentration significantly influences GFP mobility, reducing the apparent diffusion coefficient of GFP twofold at high induction levels or in an
overexpressing strain (Table 1). GFP reportedly dimerizes in solution
at ionic strengths below 100 mM (28), and dimerization may
contribute to the concentration-dependent effect. Modifications to GFP
also caused quite significant changes in its diffusional mobility. Fusion to the much larger, tetramer-forming
-galactosidase protein essentially eliminates protein mobility and causes exclusion of GFP
from the center of the cell. Addition of a cytoplasmically localized
MBP domain (whose signal peptide has been deleted) reduced Da by a factor of 3. This large reduction could
in principle be due to viscous hydrodynamic effects related to the
larger size and different shape of the fusion protein.
Surprisingly, however, a much smaller change to the protein, addition
of a small six-histidine tag, commonly added to recombinant proteins
for purification, reduced the apparent diffusion coefficient by as much
as 40%. This effect is too drastic to be explained by viscosity and
size alone. Slowing of the His-tagged protein could be due to
nonspecific electrostatic interactions of the positively charged His
tag with negatively charged nucleic acids. Regardless of the precise
cause, however, this effect indicates that nongeometrical effects can
exercise strong constraints on protein movement in vivo and
demonstrates that even relatively small sequence changes may have large
influences on protein mobility.
We have measured only an apparent diffusion coefficient here; the range
of length scales to which it applies is not known. Substantial
subdiffusive behavior, in which the average mean-squared displacement
of a particle grows as a fractional power of time less than 1, i.e.,
<r2(t) >
tp, p < 1 (p
of 1 corresponds to normal diffusion), has been observed in membranes
by two-dimensional single-particle tracking experiments (11). It may occur as well in cytoplasm. FRAP experiments
have difficulty distinguishing between normal diffusion with a fixed "immobile fraction" and subdiffusion (11). Direct
signatures of subdiffusion are deviations from exponential temporal
decay of the Fourier coefficients, which is difficult to detect, and disagreement of diffusion determinations made with different Fourier modes. We have been able to measure apparent diffusion in the lowest
two modes in cephalexin-treated filamentous cells. This was found to be
consistent with normal diffusion, with differences between the two
modes averaging 6%, close to the limit of experimental precision (Fig.
4). This indicates that GFP transport is diffusive at least on the
longest two length scales in the bacterium (the length and half-length
of the cell). Because the cell length scale is long compared to the
molecular scale, information on short-length diffusion inside cells,
obtainable by other techniques, would complement these measurements and
indicate whether GFP movement is truly diffusive.
In summary, the data presented here provide apparent diffusion rates
for proteins expressed in E. coli. They also show that FRAP
and photoactivation measurements must be interpreted with caution; in
particular, one cannot assign an effective viscosity to the cytoplasm
which would be applicable to all proteins inside it. Mobility depends
sensitively on the protein under consideration, on its concentration,
and on any genetic modification it may have undergone, such as His
tagging. Thus, protein mobility must be seen not only as a property of
the geometrical structure of cytoplasm and the background
macromolecular concentrations alone but also as a characteristic of the
diffusing species. Future work may elucidate the causes of the protein
mobility variations observed here and show how they are tolerated, or
compensated for, by cellular networks.
 |
ACKNOWLEDGMENTS |
We thank B. Aguera y Arcas, U. Alon, T. Holy, and A. C. Maggs for help with data analysis and software. We also thank U. Alon, P. Cluzel, L. Frisen, P. Lopez, and T. Surrey for critical reading of
the manuscript. We are grateful to B. P. Cormack for providing GFP mutants.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Lewis Thomas
Lab, Washington Rd., Princeton, NJ 08544. Phone: (609) 258-1574. Fax: (609) 258-6175. E-mail: melowitz{at}princeton.edu.
Present address: Department of Microbiology and Infectious
Diseases, University of Calgary, Calgary, Alberta, Canada T2N 4N1.
Present address: Centre de Recherches sur les Très Basses
Températures, CNRS, Laboratoire associé à
l'Université Joseph Fourier, F-38042 Grenoble Cedex 9, France.
 |
REFERENCES |
| 1.
|
Allan, V.
1995.
Membrane traffic motors.
FEBS Lett.
369:101-106[Medline].
|
| 2.
|
Alon, U.,
L. Camarena,
M. G. Surette,
B. Aguera y Arcas,
Y. Liu,
S. Leibler, and J. B. Stock.
1998.
Response regulator output in bacterial chemotaxis.
EMBO J.
17:4238-4248[Medline].
|
| 3.
|
Axelrod, D.,
D. E. Koppel,
J. Schlessinger,
E. Elson, and W. W. Webb.
1976.
Mobility measurement by analysis of fluorescence photobleaching recovery kinetics.
Biophys. J.
16:1055-1069[Abstract/Free Full Text].
|
| 4.
|
Brejc, K.,
T. K. Sixma,
P. A. Kitts,
S. R. Kain,
R. Y. Tsien,
M. Ormo, and S. J. Remington.
1997.
Structural basis for dual excitation and photoisomerization of the Aequorea victoria green fluorescent protein.
Proc. Natl. Acad. Sci. USA
94:2306-2311[Abstract/Free Full Text].
|
| 5.
|
Casadaban, M. J., and S. N. Cohen.
1980.
Analysis of gene control signals by DNA fusion and cloning in Escherichia coli.
J. Mol. Biol.
138:179-207[Medline].
|
| 6.
|
Cayley, S.,
B. A. Lewis,
H. J. Guttman, and M. T. Record, Jr.
1991.
Characterization of the cytoplasm of Escherichia coli K-12 as a function of external osmolarity. Implications for protein-DNA interactions in vivo.
J. Mol. Biol.
222:281-300[Medline].
|
| 7.
|
Cormack, B. P.,
R. H. Valdivia, and S. Falkow.
1996.
FACS-optimized mutants of the green fluorescent protein (GFP).
Gene
173(1 spec. no.):33-38[Medline].
|
| 8.
|
Crameri, A.,
E. A. Whitehorn,
E. Tate, and W. P. C. Stemmer.
1996.
Improved green fluorescent protein by molecular evolution using DNA shuffling.
Nat. Biotechnol.
14:315-319[Medline].
|
| 9.
|
DeWitt, S., and E. A. Adelberg.
1962.
The occurrence of a genetic transposition in a strain of Escherichia coli.
Genetics
47:577-585[Free Full Text].
|
| 10.
|
Elowitz, M. B.,
M. G. Surette,
P. E. Wolf,
J. Stock, and S. Leibler.
1997.
Photoactivation turns green fluorescent protein red.
Curr. Biol.
7:809-812[Medline].
|
| 11.
|
Feder, T. J.,
I. Brust-Mascher,
J. P. Slattery,
B. Baird, and W. W. Webb.
1996.
Constrained diffusion or immobile fraction on cell surfaces: a new interpretation.
Biophys. J.
70:2767-2773[Abstract/Free Full Text].
|
| 12.
|
Garner, M. M., and M. B. Burg.
1994.
Macromolecular crowding and confinement in cells exposed to hypertonicity.
Am. J. Physiol.
266:C877-C892[Abstract/Free Full Text].
|
| 13.
|
Guyer, M. S.,
R. R. Reed,
J. A. Steitz, and K. B. Low.
1981.
Identification of a sex-factor-affinity site in E. coli as gamma delta.
Cold Spring Harbor Symp. Quant. Biol.
45(Pt. 1):135-140.
|
| 14.
|
Kao, H. P.,
J. R. Abney, and A. S. Verkman.
1993.
Determinants of the translational mobility of a small solute in cell cytoplasm.
J. Cell Biol.
120:175-184[Abstract/Free Full Text].
|
| 15.
|
Khan, S.,
J. L. Spudich,
J. A. McCray, and D. R. Trentham.
1995.
Chemotactic signal integration in bacteria.
Proc. Natl. Acad. Sci. USA
92:9757-9761[Abstract/Free Full Text].
|
| 16.
|
Luby-Phelps, K.
1994.
Physical properties of cytoplasm.
Curr. Opin. Cell Biol.
6:3-9[Medline].
|
| 17.
|
Muramatsu, N., and A. P. Minton.
1988.
Tracer diffusion of globular proteins in concentrated protein solutions.
Proc. Natl. Acad. Sci. USA
85:2984-2988[Abstract/Free Full Text].
|
| 18.
|
Parkinson, J. S.
1976.
cheA, cheB, and cheC genes of Escherichia coli and their role in chemotaxis.
J. Bacteriol.
126:758-770[Abstract/Free Full Text].
|
| 19.
|
Partikian, A.,
B. Olveczky,
R. Swaminathan,
Y. Li, and A. S. Verkman.
1998.
Rapid diffusion of green fluorescent protein in the mitochondrial matrix.
J. Cell Biol.
140:821-829[Abstract/Free Full Text].
|
| 20.
|
Press, W. H.,
S. A. Teukolsky, and W. T. Vetterling.
1993.
Numerical recipes in C: the art of scientific computing, 2nd ed.
Cambridge University Press, Cambridge, England.
|
| 21.
|
Saxton, M. J.
1989.
Lateral diffusion in an archipelago. Distance dependence of the diffusion coefficient.
Biophys. J.
56:615-622[Abstract/Free Full Text].
|
| 22.
|
Segall, J. E.,
A. Ishihara, and H. C. Berg.
1985.
Chemotactic signaling in filamentous cells of Escherichia coli.
J. Bacteriol.
161:51-59[Abstract/Free Full Text].
|
| 23.
|
Segall, J. E.,
M. D. Manson, and H. C. Berg.
1982.
Signal processing times in bacterial chemotaxis.
Nature
296:855-857[Medline].
|
| 24.
|
Silverman, M., and M. Simon.
1974.
Flagellar rotation and the mechanism of bacterial motility.
Nature
249:73-74[Medline].
|
| 25.
|
Swaminathan, R.,
C. P. Hoang, and A. S. Verkman.
1997.
Photobleaching recovery and anisotropy decay of green fluorescent protein GFP-S65T in solution and cells: cytoplasmic viscosity probed by green fluorescent protein translational and rotational diffusion.
Biophys. J.
72:1900-1907[Abstract/Free Full Text].
|
| 26.
|
Terry, B. R.,
E. K. Matthews, and J. Haseloff.
1995.
Molecular characterisation of recombinant green fluorescent protein by fluorescence correlation microscopy.
Biochem. Biophys. Res. Commun.
217:21-27[Medline].
|
| 27.
|
Theurkauf, W. E.
1994.
Premature microtubule-dependent cytoplasmic streaming in cappuccino and spire mutant oocytes.
Science
265:2093-2096[Abstract/Free Full Text].
|
| 28.
|
Yang, F.,
L. G. Moss, and G. N. Phillips, Jr.
1996.
The molecular structure of green fluorescent protein.
Nat. Biotechnol.
14:1246-1251[Medline].
|
| 29.
|
Yokoe, H., and T. Meyer.
1996.
Spatial dynamics of GFP-tagged proteins investigated by local fluorescence enhancement.
Nat. Biotechnol.
14:1252-1256[Medline].
|
| 30.
|
Zimmerman, S. B., and S. O. Trach.
1991.
Estimation of macromolecule concentrations and excluded volume effects for the cytoplasm of Escherichia coli.
J. Mol. Biol.
222:599-620[Medline].
|
Journal of Bacteriology, January 1999, p. 197-203, Vol. 181, No. 1
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jasnin, M., Moulin, M., Haertlein, M., Zaccai, G., Tehei, M.
(2008). In Vivo Measurement of Internal and Global Macromolecular Motions in Escherichia coli. Biophys. J
95: 857-864
[Abstract]
[Full Text]
-
Wunderlich, Z., Mirny, L. A.
(2008). Spatial effects on the speed and reliability of protein-DNA search. Nucleic Acids Res
36: 3570-3578
[Abstract]
[Full Text]
-
Ridgway, D., Broderick, G., Lopez-Campistrous, A., Ru'aini, M., Winter, P., Hamilton, M., Boulanger, P., Kovalenko, A., Ellison, M. J.
(2008). Coarse-Grained Molecular Simulation of Diffusion and Reaction Kinetics in a Crowded Virtual Cytoplasm. Biophys. J
94: 3748-3759
[Abstract]
[Full Text]
-
Schulmeister, S., Ruttorf, M., Thiem, S., Kentner, D., Lebiedz, D., Sourjik, V.
(2008). Protein exchange dynamics at chemoreceptor clusters in Escherichia coli. Proc. Natl. Acad. Sci. USA
105: 6403-6408
[Abstract]
[Full Text]
-
White, A. P., Gibson, D. L., Grassl, G. A., Kay, W. W., Finlay, B. B., Vallance, B. A., Surette, M. G.
(2008). Aggregation via the Red, Dry, and Rough Morphotype Is Not a Virulence Adaptation in Salmonella enterica Serovar Typhimurium. Infect. Immun.
76: 1048-1058
[Abstract]
[Full Text]
-
Lindner, A. B., Madden, R., Demarez, A., Stewart, E. J., Taddei, F.
(2008). Asymmetric segregation of protein aggregates is associated with cellular aging and rejuvenation. Proc. Natl. Acad. Sci. USA
105: 3076-3081
[Abstract]
[Full Text]
-
Rickgauer, J. P., Fuller, D. N., Grimes, S., Jardine, P. J., Anderson, D. L., Smith, D. E.
(2008). Portal Motor Velocity and Internal Force Resisting Viral DNA Packaging in Bacteriophage {phi}29. Biophys. J
94: 159-167
[Abstract]
[Full Text]
-
Campbell, C. S., Mullins, R. D.
(2007). In vivo visualization of type II plasmid segregation: bacterial actin filaments pushing plasmids. J. Cell Biol.
179: 1059-1066
[Abstract]
[Full Text]
-
Cytrynbaum, E. N., Marshall, B. D. L.
(2007). A Multistranded Polymer Model Explains MinDE Dynamics in E. coli Cell Division. Biophys. J
93: 1134-1150
[Abstract]
[Full Text]
-
Beg, Q. K., Vazquez, A., Ernst, J., de Menezes, M. A., Bar-Joseph, Z., Barabasi, A.-L., Oltvai, Z. N.
(2007). Intracellular crowding defines the mode and sequence of substrate uptake by Escherichia coli and constrains its metabolic activity. Proc. Natl. Acad. Sci. USA
104: 12663-12668
[Abstract]
[Full Text]
-
Levine, J., Kueh, H. Y., Mirny, L.
(2007). Intrinsic Fluctuations, Robustness, and Tunability in Signaling Cycles. Biophys. J
92: 4473-4481
[Abstract]
[Full Text]
-
Suel, G. M., Kulkarni, R. P., Dworkin, J., Garcia-Ojalvo, J., Elowitz, M. B.
(2007). Tunability and Noise Dependence in Differentiation Dynamics. Science
315: 1716-1719
[Abstract]
[Full Text]
-
van Zon, J. S., Morelli, M. J., Tanase-Nicola, S., ten Wolde, P. R.
(2006). Diffusion of Transcription Factors Can Drastically Enhance the Noise in Gene Expression. Biophys. J
91: 4350-4367
[Abstract]
[Full Text]
-
Sanford, C., Yip, M. L.K., White, C., Parkinson, J.
(2006). Cell++--simulating biochemical pathways. Bioinformatics
22: 2918-2925
[Abstract]
[Full Text]
-
Shih, Y.-L., Rothfield, L.
(2006). The Bacterial Cytoskeleton. Microbiol. Mol. Biol. Rev.
70: 729-754
[Abstract]
[Full Text]
-
Konopka, M. C., Shkel, I. A., Cayley, S., Record, M. T., Weisshaar, J. C.
(2006). Crowding and confinement effects on protein diffusion in vivo.. J. Bacteriol.
188: 6115-6123
[Abstract]
[Full Text]
-
Rodriguez, J. V., Kaandorp, J. A., Dobrzynski, M., Blom, J. G.
(2006). Spatial stochastic modelling of the phosphoenolpyruvate-dependent phosphotransferase (PTS) pathway in Escherichia coli. Bioinformatics
22: 1895-1901
[Abstract]
[Full Text]
-
Kim, S. Y., Gitai, Z., Kinkhabwala, A., Shapiro, L., Moerner, W. E.
(2006). Single molecules of the bacterial actin MreB undergo directed treadmilling motion in Caulobacter crescentus. Proc. Natl. Acad. Sci. USA
103: 10929-10934
[Abstract]
[Full Text]
-
Mullineaux, C. W., Nenninger, A., Ray, N., Robinson, C.
(2006). Diffusion of green fluorescent protein in three cell environments in Escherichia coli.. J. Bacteriol.
188: 3442-3448
[Abstract]
[Full Text]
-
Nolan, S., Cowan, A. E., Koppel, D. E., Jin, H., Grote, E.
(2006). FUS1 Regulates the Opening and Expansion of Fusion Pores between Mating Yeast. Mol. Biol. Cell
17: 2439-2450
[Abstract]
[Full Text]
-
Banks, D. S., Fradin, C.
(2005). Anomalous Diffusion of Proteins Due to Molecular Crowding. Biophys. J
89: 2960-2971
[Abstract]
[Full Text]
-
Judd, E. M., Comolli, L. R., Chen, J. C., Downing, K. H., Moerner, W. E., McAdams, H. H.
(2005). Distinct Constrictive Processes, Separated in Time and Space, Divide Caulobacter Inner and Outer Membranes. J. Bacteriol.
187: 6874-6882
[Abstract]
[Full Text]
-
Bialek, W., Setayeshgar, S.
(2005). Physical limits to biochemical signaling. Proc. Natl. Acad. Sci. USA
102: 10040-10045
[Abstract]
[Full Text]
-
Doubrovinski, K., Howard, M.
(2005). Stochastic model for Soj relocation dynamics in Bacillus subtilis. Proc. Natl. Acad. Sci. USA
102: 9808-9813
[Abstract]
[Full Text]
-
Ray, N., Nenninger, A., Mullineaux, C. W., Robinson, C.
(2005). Location and Mobility of Twin Arginine Translocase Subunits in the Escherichia coli Plasma Membrane. J. Biol. Chem.
280: 17961-17968
[Abstract]
[Full Text]
-
Drew, D. A., Osborn, M. J., Rothfield, L. I.
(2005). A polymerization-depolymerization model that accurately generates the self-sustained oscillatory system involved in bacterial division site placement. Proc. Natl. Acad. Sci. USA
102: 6114-6118
[Abstract]
[Full Text]
-
Lipkow, K., Andrews, S. S., Bray, D.
(2005). Simulated Diffusion of Phosphorylated CheY through the Cytoplasm of Escherichia coli. J. Bacteriol.
187: 45-53
[Abstract]
[Full Text]
-
Zhou, B.-R., Liang, Y., Du, F., Zhou, Z., Chen, J.
(2004). Mixed Macromolecular Crowding Accelerates the Oxidative Refolding of Reduced, Denatured Lysozyme: IMPLICATIONS FOR PROTEIN FOLDING IN INTRACELLULAR ENVIRONMENTS. J. Biol. Chem.
279: 55109-55116
[Abstract]
[Full Text]
-
Blum, C., Meixner, A. J., Subramaniam, V.
(2004). Room Temperature Spectrally Resolved Single-Molecule Spectroscopy Reveals New Spectral Forms and Photophysical Versatility of Aequorea Green Fluorescent Protein Variants. Biophys. J
87: 4172-4179
[Abstract]
[Full Text]
-
Slutsky, M., Mirny, L. A.
(2004). Kinetics of Protein-DNA Interaction: Facilitated Target Location in Sequence-Dependent Potential. Biophys. J
87: 4021-4035
[Abstract]
[Full Text]
-
Deich, J., Judd, E. M., McAdams, H. H., Moerner, W. E.
(2004). Visualization of the movement of single histidine kinase molecules in live Caulobacter cells. Proc. Natl. Acad. Sci. USA
101: 15921-15926
[Abstract]
[Full Text]
-
Brehm-Stecher, B. F., Johnson, E. A.
(2004). Single-Cell Microbiology: Tools, Technologies, and Applications. Microbiol. Mol. Biol. Rev.
68: 538-559
[Abstract]
[Full Text]
-
Anderson, D. E., Gueiros-Filho, F. J., Erickson, H. P.
(2004). Assembly Dynamics of FtsZ Rings in Bacillus subtilis and Escherichia coli and Effects of FtsZ-Regulating Proteins. J. Bacteriol.
186: 5775-5781
[Abstract]
[Full Text]
-
Golding, I., Cox, E. C.
(2004). RNA dynamics in live Escherichia coli cells. Proc. Natl. Acad. Sci. USA
101: 11310-11315
[Abstract]
[Full Text]
-
Mullineaux, C. W.
(2004). FRAP analysis of photosynthetic membranes. J Exp Bot
55: 1207-1211
[Abstract]
[Full Text]
-
Judd, E. M., Ryan, K. R., Moerner, W. E., Shapiro, L., McAdams, H. H.
(2003). Fluorescence bleaching reveals asymmetric compartment formation prior to cell division in Caulobacter. Proc. Natl. Acad. Sci. USA
100: 8235-8240
[Abstract]
[Full Text]
-
Francke, C., Postma, P. W., Westerhoff, H. V., Blom, J. G., Peletier, M. A.
(2003). Why the Phosphotransferase System of Escherichia coli Escapes Diffusion Limitation. Biophys. J
85: 612-622
[Abstract]
[Full Text]
-
Cowan, A. E., Koppel, D. E., Setlow, B., Setlow, P.
(2003). A soluble protein is immobile in dormant spores of Bacillus subtilis but is mobile in germinated spores: Implications for spore dormancy. Proc. Natl. Acad. Sci. USA
100: 4209-4214
[Abstract]
[Full Text]
-
Chakraborty, A., Das, I., Datta, R., Sen, B., Bhattacharyya, D., Mandal, C., Datta, A. K.
(2002). A Single-domain Cyclophilin from Leishmania donovani Reactivates Soluble Aggregates of Adenosine Kinase by Isomerase-independent Chaperone Function. J. Biol. Chem.
277: 47451-47460
[Abstract]
[Full Text]
-
Franks, K. M., Bartol, T. M. Jr., Sejnowski, T. J.
(2002). A Monte Carlo Model Reveals Independent Signaling at Central Glutamatergic Synapses. Biophys. J
83: 2333-2348
[Abstract]
[Full Text]
-
Dworkin, J., Losick, R.
(2002). Does RNA polymerase help drive chromosome segregation in bacteria?. Proc. Natl. Acad. Sci. USA
99: 14089-14094
[Abstract]
[Full Text]
-
Gerland, U., Moroz, J. D., Hwa, T.
(2002). Physical constraints and functional characteristics of transcription factor-DNA interaction. Proc. Natl. Acad. Sci. USA
99: 12015-12020
[Abstract]
[Full Text]
-
Meinhardt, H., de Boer, P. A. J.
(2001). Pattern formation in Escherichia coli: A model for the pole-to-pole oscillations of Min proteins and the localization of the division site. Proc. Natl. Acad. Sci. USA
98: 14202-14207
[Abstract]
[Full Text]
-
Maki, N., Gestwicki, J. E., Lake, E. M., Kiessling, L. L., Adler, J.
(2000). Motility and Chemotaxis of Filamentous Cells of Escherichia coli. J. Bacteriol.
182: 4337-4342
[Abstract]
[Full Text]