Previous Article | Next Article 
Journal of Bacteriology, January 1999, p. 262-269, Vol. 181, No. 1
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Repair of Oxidized Bases in the Extremely
Radiation-Resistant Bacterium Deinococcus
radiodurans
Cécile
Bauche and
Jacques
Laval*
Groupe "Réparation des Lésions
Radio-et Chimio-Induites," UMR 1772 CNRS, Institut Gustave
Roussy, 94805 Villejuif Cedex, France
Received 2 July 1998/Accepted 9 October 1998
 |
ABSTRACT |
Deinococcus radiodurans is able to resist and survive
extreme DNA damage induced by ionizing radiation and many other
DNA-damaging agents. It is believed that it possesses highly efficient
DNA repair mechanisms. To characterize the repair pathway of oxidized purines in this bacteria, we have purified, from crude extracts, proteins that recognize these oxidized bases. We report here that D. radiodurans possesses two proteins excising the oxidized
purines (formamidopyrimidine and 8-oxoguanine) by a DNA glycosylase-a purinic/apyrimidine lyase mechanism. Moreover, one of those proteins is
endowed with a thymine glycol DNA glycosylase activity. One of these
proteins could be the homolog of the Escherichia coli Fpg
enzyme, which confirms the existence of a base excision repair system
in this bacteria.
 |
INTRODUCTION |
Deinococcus radiodurans
is a bacterium which is extremely resistant to the lethal and mutagenic
effects of ionizing radiation (1, 3) as well as other
physical and chemical DNA-damaging agents (including mitomycin C and UV
[33, 35, 38]). For example, an exponential culture of
wild-type D. radiodurans R1 can withstand from 5 to 15 kGy
of
radiation (depending on the culture conditions) with neither
loss of viability nor increased mutagenesis (10, 32), while
an Escherichia coli culture is 100 times less resistant
(40). It has been suggested that this elevated resistance of
D. radiodurans is due to unusually efficient DNA repair
mechanisms (30, 33), although these hypotheses have not yet
been investigated in detail.
To protect themselves from the oxidative DNA damage caused by ionizing
radiation cells have evolved efficient and accurate repair systems to
remove these lesions from DNA (11). In E. coli,
three DNA glycosylases are known to recognize oxidized purines and
pyrimidines present in DNA. The Fpg protein (formamidopyrimidine-DNA glycosylase) recognizes oxidized purines such as
2,6-diamino-4-hydroxy-5N-methylformamidopyrimidine (Fapy)
and 7,8-dihydro-8-oxoguanine (8-oxoG) residues and removes them from
DNA. 8-oxoG is the major oxidative lesion produced in DNA by reactive
oxygen species (17) and has been shown to be highly
mutagenic in vivo and in vitro (37, 45); if not repaired, it
may mispair with adenine during DNA replication, causing G-C to T-A
transversion mutations (9, 23, 29). Noncoding oxidized pyrimidines (such as thymine glycol, cytosine glycol, and N-substituted urea [15, 24)) are recognized and removed by the Nth
(2, 11) and/or Nei (21, 27) proteins, which share
a common range of substrates. These three glycosylases have an
apurinic/apyrimidine (AP) lyase activity which cleaves the DNA backbone
by a
-elimination mechanism for the Nth protein (leaving an
,
-unsaturated aldehyde at the 3' side of the nick [6, 22,
27]) and a
,
-elimination mechanism for the Fpg and Nei
proteins (leaving a gap bordered by 3' and 5' phosphoryl group
[21, 41]). In addition to these activities, Fpg and
Nei proteins also catalyze the excision of 5'-terminal deoxyribose
phosphate from DNA (DNA deoxyribose phosphodiesterase [dRpase]
activity [16, 21]).
Thus far, only four D. radiodurans proteins have been
associated with ionizing radiation resistance: the recA and
pol gene products, homologs of E. coli RecA
(19) and DNA polymerase I (18), respectively, and
the irrB and irrI gene products, whose biochemical functions have yet to be determined (26, 44). An
activity that cleaves DNA containing thymine glycol adducts and a
deoxyribophosphodiesterase have been identified in partially purified
extracts of D. radiodurans (33). However, the
enzymes involved in the repair of the oxidized purines, such as 8-oxoG, caused in DNA by ionizing radiation has not yet been identified.
In attempt to investigate the mechanisms involved in the resistance of
D. radiodurans to the mutagenic effects of reactive oxygen
species, we have purified from crude extracts of this bacterium enzymatic activities that recognize oxidized purines. The substrate used to identify these activities is a duplex polynucleotide containing [3H]Fapy residues. We have identified two different
enzymes excising Fapy residues, both of which have associated 8-oxoG
glycosylase and AP lyase activities, and also present the biochemical
characterization and determination of the substrate specificities of
these two enzymes.
 |
MATERIALS AND METHODS |
Growth of organisms and preparation of cells.
D.
radiodurans ATCC 13939 (American Type Culture Collection) was
grown at 32°C in TGY broth (10 g of tryptone, 5 g of yeast extract, and 1 g of glucose per liter). The cells were harvested in the late exponential phase (optical density at 600 nm of ~0.9) by
centrifugation, washed with 80% ethanol (vol/vol) in Tris-EDTA buffer,
then washed with Tris-EDTA buffer. This treatment was optimized to
obtain quantitative lysis of the bacteria.
Enzymes assays. (i). Fapy-DNA glycosylase assay and
identification of reaction products.
Fapy-DNA glycosylase activity
was measured with [3H]Fapy-poly(dG-dC) (6) as
the substrate. The standard incubation mixture (total volume, 50 µl)
contained 70 mM HEPES-KOH (pH 8.5), 70 mM KCl, 2 mM
-mercaptoethanol, 2 mM Na2EDTA, 10% glycerol, 2,000 cpm
of [3]Fapy-poly(dG-dC) (3,106 cpm/pmol), and limiting
amounts of enzyme. After incubation at 32°C, the reaction mixture was
ethanol precipitated and the ethanol-soluble radioactivity was measured
by scintillation counting (5). To identify the reaction
products, the ethanol supernatant was supplemented with authentic Fapy
and analyzed by high-pressure liquid chromatography using a C18µ
Bondapack column as previously described (4).
(ii) 8-oxoG-DNA glycosylase assay.
A 34-mer oligonucleotide
containing a single 8-oxoG residue at position 16 (5'-GGCTTCATCGTTATT8-oxoGATGACCTGGTGGATACCG3') was used as the
substrate in 8-oxoG-DNA glycosylase assays. The 5' end of this
oligonucleotide was 32P labeled with T5 polynucleotide
kinase in the presence of [
-32P]ATP (3,000 Ci/mmol;
ICN) (8) and purified by using a Nensorb cartridge (Du
Pont). Annealing of the 34-mer with an oligonucleotide of complementary
sequence, but with a C, T, G, or A opposite the 8-oxoG, was at a 1:2
molar ratio (labeled/unlabeled) at 90°C for 10 min followed by slow
cooling to room temperature. Analysis of the resultant duplex
oligonucleotide by native polyacrylamide gel electrophoresis (PAGE) on
a 10% gel showed that more than 95% of the labeled oligonucleotide
was in a duplex. The standard assay mixture (10 µl, final volume)
contained 70 mM HEPES-KOH (pH 8.5), 70 mM NaCl, 2 mM
Na2EDTA, 2 mM
-mercaptoethanol, 100 fmol of
32P-end-labeled duplex oligonucleotide containing 8-oxoG,
and limiting amounts of enzyme. After incubation for 10 min at 32°C,
the reaction was stopped by adding 10 µl of formamide dye solution;
then the mixture was heated at 90°C for 5 min and loaded onto a
denaturing 20% polyacrylamide gel containing 7 M urea. After
electrophoresis, the gels were autoradiographed at
20°C, and the
corresponding bands were identified and quantified with a
PhosphorImager (Storm 840; Molecular Dynamics).
(iii) Thymine glycol glycosylase assay.
DNA containing
thymine glycol residues was obtained (27) by exposing 150 µg of pBR322 DNA to 0.1% OsO4 for 30 min at 70°C. The
modified DNA was phenol extracted, ethanol precipitated, and then
purified by electrophoresis on an agarose gel (1%). Covalently closed
circular DNA was phenol extracted from the agarose and ethanol
precipitated. The enzymatic reaction was carried out with 500 ng of DNA
in 10 µl of 70 mM HEPES-KOH (pH 8.5)-2 mM Na2EDTA-70 mM
NaCl-2 mM
-mercaptoethanol-10% glycerol at 32°C for 10 min. The
products of the reactions were separated by electrophoresis on a 0.9%
agarose gel, the gel was stained with ethidium bromide, and
photographed, and plasmid nicking was quantified by microdensitometric analysis of a photographic negative (Chromoscan 3; Jocye-Loebl).
(iv) Assay for AP nicking activity by using an oligonucleotide
containing a unique abasic site.
A 50-mer oligonucleotide
containing a single hypoxanthine (HX) residue at position 26 (5'GACTACAAATACATCGTCACCTGGGHXCATGTTGCAGATCCTTCCAGTGCG3') was 32P labeled at the 5' end, annealed with the
complementary sequence, and analyzed as described above. The AP site
was produced by excision of HX residues from 0.4 pmol of
32P-labeled duplex, using saturated amounts of AlkA protein
in 20 µl of 25 mM sodium phosphate (pH 7.2)-1 mM
Na2EDTA-100 mM KCl-100 µg of bovine serum albumin per
ml) for 25 min at 37°C (35). The reaction was cooled for
10 min at 4°C. To measure the nicking activity at the AP site,
limited amounts of enzyme were added and incubated for 10 min at
32°C. The reaction was stopped by adding 10 µl of formamide dye
mixture, and the products were analyzed by PAGE (20% gel) in the
presence of 7 M urea. All other steps were as described above.
Purification of the Fapy-DNA glycosylase.
All purification
procedures were performed at 4°C. Protease inhibitors were added in
all buffers at the following concentrations: antipain, leupeptin, and
aprotinin (Boehringer Mannheim), each at 3 µg/ml; and
phenylmethylsulfonyl fluoride (Boehringer Mannheim), 1 mM. Cell pellets
(490 g) were lysed in 2 volumes of buffer A (20 mM HEPES-KOH [pH
8.5], 1 mM Na2EDTA, 2 mM
-mercaptoethanol, 10%
[vol/vol] glycerol) containing 0.3 mg of lysozyme per ml and 0.25 M
NaCl. The lysate was centrifuged at 10,000 × g for 30 min at 4°C. The supernatant was the crude extract (fraction I). To remove nucleic acids, fraction I was loaded onto a QMA anion-exchange column (Waters Acell) equilibrated with buffer A containing 0.25 M
NaCl. The fractions that were not retained on the QMA column (fraction
II) contained the Fapy-DNA glycosylase activity. Fraction II was
dialyzed against buffer A containing 0.02 M NaCl and loaded onto a
Phospho-Ultrogel A6 (Pharmacia LKB Biotechnology Inc.) column. The
column was developed by using a linear gradient of buffer A without
glycerol from 0.02 to 1 M NaCl. Fractions containing Fapy-DNA
glycosylase activity were pooled (fraction III), ammonium sulfate was
added to 1.7 M, and the mixture was loaded onto a fast protein liquid
chromatography (FPLC) Phenyl Superose HR 5/5 column (Pharmacia). The
column was washed with buffer B (20 mM HEPES-KOH [pH 8.5], 1 mM
Na2EDTA, 2 mM
-mercaptoethanol, 0.25 M NaCl, 1.7 M
ammonium sulfate) and eluted with a linear gradient (1.7 to 0 M
ammonium sulfate in buffer B). The eluate from this column gave two
peaks of Fapy-DNA glycosylase activity eluting at 0.75 and 0.35 M
ammonium sulfate. These peaks were separately pooled and further
purified (fractions IVa and IVb). Those two fractions were dialyzed
against buffer A containing 0.02 M NaCl and loaded onto an FPLC MonoS
HR 5/5 column (Pharmacia). The active fractions eluted at 0.35 M
(fraction V) and 0.43 M (fraction VI) NaCl, respectively, using a 0.02 to 1 M NaCl gradient in buffer A.
Immunoblotting.
The proteins were separated by sodium
dodecyl sulfate (SDS)-PAGE (12% gel) and transferred onto a
nitrocellulose membrane treated with 5% nonfat milk in TBS-T buffer
(20 mM Tris base, 137 mM NaCl, 0.1% Tween 20 [Bio-Rad [pH 7.5]) for
1 h as described by Towbin et al. (43). The membrane
was then incubated for 1 h with serum from rabbit immunized with
the Fpg protein of E. coli (1/5,000 [vol/vol] in TBS-T
buffer). After three washes, the membrane was incubated for 1 h
with peroxidase-coupled anti-immunoglobulin G gamma chain (anti-rabbit;
Sanofi Pasteur) diluted 1/5,000. Peroxidase activity was detected with
the Boehringer Mannheim chemiluminescence blotting substrate PDO. The
membrane was then stripped of bound antibodies (using 100 mM
-mercaptoethanol-2% SDS-62.5 mM Tris-HCl [pH 7.5] at 50°C for
30 min), washed three times with TBS-T, and reprobed with the rabbit
serum containing antibodies against E. coli Nth (5% nonfat
milk in TBS-T for 1 h and rabbit serum for 1 h); then
immunoreactive bands were detected as described above.
Protein concentration determination.
Protein concentrations
were determined by the method of Bradford (7), using bovine
serum albumin as the standard. Since the enzymatic preparations
obtained in the last step of the purification were not homogeneous, we
used the following approach to evaluate protein concentrations.
Proteins were separated by SDS-PAGE (12% gel) and stained with
Coomassie blue. A photograph of the gel was taken, and the intensities
of protein bands were quantified by microdensitometry (Chromoscan 3;
Joyce-Loebl) of the photographic negative. The total amount of protein
run on the gel was then used to estimate the relative protein
concentrations of each protein band. Identification of the protein
bands reacting with antibodies allowed evaluation of the concentrations
of the two enzymes.
Formation of enzyme-DNA complexes in the presence of
NaBH4.
The enzymes were incubated with 100 fmol of the
32P-end-labeled 8-oxoG-containing duplex (34-mer) at 32°C
for 20 min in 20 µl of a solution containing 25 mM sodium phosphate
(pH 8.5), 1 mM Na2EDTA, 70 mM NaCl, 100 µg of bovine
serum albumin per ml, and 100 mM NaBH4 (a 2 M
NaBH4 stock solution in water was prepared immediately
prior to use). The reaction was stopped by addition of SDS (0.5%,
final concentration) and heating for 10 min at 37°C. The reaction
products were separated by SDS-PAGE (15% gel), and the gel was dried
and autoradiographed. The bands corresponding to DNA-protein complex or
to free DNA were quantified with a PhosphorImager as described above.
The formation of a covalent complex between DNA containing an AP site
and proteins was achieved by using the 50-mer oligonucleotide
containing an abasic site as described above.
 |
RESULTS |
Purification of the Fapy-DNA glycosylase activities in D. radiodurans.
To identify the enzymes repairing oxidized purines in
D. radiodurans, we could assay either the 8-oxoG or the
Fapy-DNA glycosylase activity. However, preliminary experiments showed
that 8-oxoG/C glycosylase activity was not detectable in crude
extracts; consequently, we used [3H]Fapy-poly(dG-dC) as
the substrate, although the Fapy-DNA glycosylase activity is barely
detectable in the crude lysate of D. radiodurans (Table
1). Given the low level of activity, we
purified the enzyme from 200 liters (490 g) of the wild-type strain,
using a series of column chromatography steps. Two peaks of Fapy-DNA
glycosylase activity were separated by FPLC on the hydrophobic column
(fractions IVa and IVb [Table 1]). Those peaks were then separately
pooled and further purified by FPLC using an ion-exchange column
(fractions V and VI). The two preparations obtained in the final steps
were purified more than 300- and 2,000-fold, respectively. However, these values are undoubtedly underestimates due to the difficulty in
obtaining reliable enzymatic activity determinations when the crude
extract is used. The radioactive materials released from [3H]Fapy-poly(dG-dC) by the two D. radiodurans Fapy-DNA glycosylases coelute with authentic Fapy
marker molecules in two peaks, corresponding to the two rotameric forms
of the free Fapy base (data not shown). Therefore, the two purified
enzymatic activities are DNA glycosylases.
Presence of a 8-oxoG-DNA glycosylase activity.
Since the
E. coli Fpg protein excises both Fapy and 8-oxoG residues in
DNA, we tested whether an 8-oxoG-DNA glycosylase activity is also
present in fractions V and VI, using as substrate a duplex oligonucleotide containing a single 8-oxoG residue. The two most purified fractions nicked this duplex oligonucleotide in a
concentration-dependent manner (Fig. 1).
We have also found that in each case, the activities excising Fapy
residues and cleaving the 8-oxoG-containing duplex coelute during MonoS
chromatography (data not shown), strongly suggesting that both enzymes
carry these two activities, albeit with different ratios. Note that
fraction VI exhibits a much higher 8-oxoG glycosylase activity relative
to Fapy excision.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
Cleavage of the 8-oxoG/C duplex by the following: lane
1, no enzyme, lane 2, 5 ng of E. coli Fpg protein; lanes 3, 4, and 5, 0.2, 0.4, and 1 U of Fapy DNA glycosylase (fraction V); lanes
6, 7, and 8, 0.2, 0.4, and 1 U of Fapy DNA glycosylase (fraction IV).
The duplex (100 fmol/reaction) was incubated with the enzyme at 32°C
for 10 min.
|
|
Use of antibodies against E. coli Fpg or Nth to
characterize the D. radiodurans enzymes.
The results
presented above show that D. radiodurans has two enzymes
with common activities (Fapy- and 8-oxoG-DNA glycosylases). We have
further investigated whether these enzymes could be structural homologs
of the E. coli Fpg protein by immunoblotting the two proteins with anti-E. coli Fpg protein antibodies. The
results (Fig. 2A) show that both
fractions possess a protein reacting with these antibodies. Since we
have used the same amounts of enzyme (measured with Fapy-DNA
glycosylase units), Fig. 2A shows that the fraction V protein reacts
weakly and fractions VI protein exhibits a stronger reaction. Moreover,
these proteins have different apparent molecular masses (~38 and
~34 kDa for the fraction V and VI proteins, respectively).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2.
Immunoblotting of fractions V and VI protein with
anti-Fpg (A) and anti-Nth (B) antibodies. Lane 1, E. coli
Fpg protein (100 ng); lane 2, E. coli Nth protein (100 ng);
lane 3, fraction V (0.5 U of Fapy-DNA glycosylase); lane 4, fraction VI
(0.5 U of Fapy-DNA glycosylase).
|
|
Recently, a Fapy-DNA glycosylase activity in yeast has been found in a
non-Fpg protein-like enzyme, Ntg1 (
14). Ntg1 shows
a
sequence similarity with
E. coli Nth (
2,
14), and
excises
oxidized pyrimidines (thymine glycols) from yeast DNA. It also
removes Fapy residues but not 8-oxoG, whereas in
E. coli,
Nth
removes oxidized pyrimidines but not Fapy residues. Therefore,
we
investigated whether the
D. radiodurans enzymes could be
recognized
by antibodies against the
E. coli Nth protein by
reprobing the
immunoblot described above with anti-
E. coli
Nth protein antibodies.
The results show that there is no detectable
reaction with either
fraction V or fraction VI (Fig.
2B).
We further investigated the inhibitory effects of the antibodies toward
the enzymatic activities of the two proteins. The
results (Fig.
3) show that the various antibodies
inhibit the
two enzymatic activities but with different patterns. The
anti-Fpg
antibody inhibited the enzymatic activities of the fraction VI
protein more efficiently than those of the fraction V protein.
The
Western blot analysis (Fig.
2) also showed that anti-Fpg antibodies
react better with the enzyme presents in fraction VI than with
the
fraction V enzyme. Taken together with the fact that the two
enzymatic
activities have different apparent molecular weights,
these results
suggest that two different enzymes having structural
homologies with
the
E. coli Fpg protein are responsible for the
excision of
the Fapy residues and incision of 8-oxoG-containing
DNA in
D. radiodurans.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
D. radiodurans Fapy and 8-oxoG DNA
glycosylase activities in the presence of various concentrations of
anti-Fpg antibodies. Fraction V (0.04 U of Fapy DNA glycosylase; )
and fraction VI (0.04 U of Fapy DNA glycosylase; ) were incubated
for 10 min at 32°C with 700 fmol of
[3H]Fapy-poly(dG-dC) or 100 fmol of 8-oxoG/C-containing
oligonucleotide (34-mer) (B).
|
|
Repair of Fapy lesions by the D. radiodurans
enzymes.
The optimum pH for both D. radiodurans enzymes
in Fapy excision was pH 8.4, using a HEPES-KOH buffer containing 70 mM
NaCl (data not shown). The abilities of the two enzymes to excise Fapy residues was analyzed. As noted above, both enzymes release Fapy residues, with the fraction VI enzyme being the most efficient (Fig.
4). Analysis of the kinetic parameters
for the release of [3H]Fapy residues gave an apparent
Km value for the fraction VI enzyme which is
comparable to that of the E. coli Fpg protein, while the
fraction V enzyme had a higher Km value (Table
2). Comparison of the two enzymes
Kcat/Km values for
excision of Fapy residues (Table 2) shows that these values are similar
to those of the E. coli Fpg protein.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 4.
Fapy-DNA glycosylase activities of fraction V ( ) and
fraction VI ( ). Increasing amounts of each enzyme were incubated in
the presence of [3H]Fapy-poly(dG-dC) at 32°C for 10 min, and the [3H]Fapy residues released were measured
(for details, see Materials and Methods).
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Kinetic parameters for excision of Fapy and 8-oxoG (from
oligonucleotides) residues for D. radiodurans fraction V
and fraction VI enzymes
|
|
Repair of 8-oxoG residues by the D. radiodurans
enzymes.
The efficiency of the two enzymes to excise 8-oxoG
residues as a function of the base opposite to the lesion was analyzed by using a 34-mer duplex DNA containing an 8-oxoG residue opposite one
of the four bases. To compare the two enzymatic activities on 8-oxoG
residues, the reactions were standardized by Fapy units as a measure of
the two enzymes concentrations. The results show that both enzymes
incise the various substrates with different efficiencies (Fig.
5). Fraction V enzyme incises the four
duplexes with a low efficiency and has a slight preference for 8-oxoG/C and 8-oxoG/T mismatches. Fraction VI enzyme incises 8-oxoG residues from all the mismatches with a higher efficiency, and the 8-oxo-G residue is better eliminated when opposite a pyrimidine; however, the
8-oxoG/A mismatch is recognized at a detectable rate. Fraction VI
enzyme exhibits Km and
Kcat/Km values for the
8-oxoG-DNA glycosylase activity comparable to those of the E. coli Fpg protein, while fraction V enzyme has a much (10-fold)
lower apparent Km and a 20-fold-reduced
Kcat/Km (Table 2).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 5.
Cleavage of DNA duplexes containing a single 8-oxoG
mismatched with one of the four bases C ( ), T ( ), G ( ), and A
( ). The various duplexes (100 fmol) were incubated with increasing
amounts of proteins standardized as Fapy-DNA glycosylase activity of
fraction V (A) and fraction VI (B) for 10 min at 32°C.
|
|
Mechanisms of action of the enzymes in repair of 8-oxoG
residues.
Following the enzymatic treatment of the
8-oxo-G-containing duplex, further incubation with 10% piperidine
(which nicks DNA at AP sites) leads to no increase in the amount of
incised substrate (data not shown), thus showing that our assay did not
underestimate the excision of 8-oxoG. This result implies either that
an AP nicking activity contaminates both enzyme preparations or that for both enzymes, an associated nicking activity, presumably AP lyase
activity, is involved in repair of the 8-oxoG lesions. If the latter is
the case, it should be possible to isolate the covalent Schiff base
intermediate as an enzyme-substrate complex as shown for the E. coli Fpg protein (42), as this complex can be reduced in the presence of sodium borohydride to yield a stable covalent complex (37, 42). We therefore tested the ability of the two D. radiodurans enzymes to trap 8-oxoG/C DNA in the presence
of NaBH4. As shown in Fig. 6,
both enzymes generate covalent complexes with DNA, suggesting that they
have an intrinsic
-AP lyase activity associated with their DNA
glycosylase activity (see below).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 6.
NaBH4 trapping of 8-oxoG-containing DNA (200 fmol) treated with different amounts of proteins standardized as
Fapy-DNA glycosylase activity from fraction V ( ) and fraction VI
( ). The reactions were performed at 32°C for 30 min (for details,
see Materials and Methods).
|
|
Nicking activities at a abasic sites of the D. radiodurans enzymes.
The nicking activities at AP sites by
the two enzymes was further characterized by using as substrate a
duplex oligonucleotide containing a unique abasic site at a defined
position. The results (Fig. 7A) show that
for both enzymes, the AP lyase activities can operate independently of
the glycosylase activity. The mechanism of the AP lyase activity was
determined by comparing the products of the reaction obtained with
fraction V and VI enzymes with the products of the reaction of the
E. coli Fpg (
,
-elimination) and Nth (
-elimination)
proteins. Figure 7B shows that the products of the reaction obtained
with fractions V and VI migrate at the same position as those obtained
with the E. coli Fpg protein. These results suggest that the
two D. radiodurans enzymes use the same mechanism for
nicking DNA at abasic sites: a
,
elimination.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7.
Cleavage of an oligonucleotide containing a unique
abasic site. Oligonucleotide (100 fmol) was incubated for 10 min at
32°C with enzyme. The products of the reaction were separated by
SDS-PAGE, and the results were quantified with PhosphorImager. (A)
Increasing amounts of fraction V ( ) and fraction VI ( ). (B) Lane
1, duplex oligonucleotide containing an AP site. lane 2, like lane 1 but incubated with 0.2 M NaOH before analysis; lane 3, like lane 1 but
incubated with 10 ng of E. coli Fpg protein; lane 4, like
lane 1 but incubated with 10 ng of E. coli Nth protein; lane
5, like lane I but incubated with 10 ng of fraction V enzyme; lane 6, like lane 1 but incubated with 10 ng of fraction VI enzyme.
|
|
We also tested whether these two enzymes could trap DNA containing an
AP site in the presence of NaBH
4. The results (Fig.
8) show that both enzymes generate
covalent complexes with DNA
containing ATP sites. The migration
positions of the two covalent
complexes are also in good agreement with
the enzymes' apparent
molecular masses as measured above, compared to
the migration
of the complex formed between the
E. coli Fpg
protein (30.2 kDa)
and the AP site-containing DNA duplex.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 8.
NaBH4 trapping of AP site-containing DNA
(100 fmol) with 50 ng of E. coli Fpg protein (lane 1), 10, 20 50 ng of fraction V enzyme (lanes 2, 3, and 4), and 10, 20, and 50 ng of fraction VI enzyme (lanes 5, 6, and 7) for 10 min at 32°C.
|
|
Incision of osmium tetroxide-damaged DNA by the two enzymes.
To further characterize the substrate specificities of the two
deionococcal Fapy- and 8-oxoG-DNA glycosylases, we tested their ability
to recognize oxidized pyrimidines, using as substrate plasmid DNA
treated with OsO4, which predominantly generates thymine glycols in DNA (14, 24). The fraction V enzyme efficiently cleaves the OsO4-treated DNA, whereas fraction VI enzyme
does not (Fig. 9A). The results are
compatible with a two-step mechanism: the N-glycosylase
activity excised the oxidized base then the AP lyase activity leads to
the strand cleavage at the ATP site. The unoxidized DNA was resistant
to enzymatic cleavage when treated with the fraction V enzyme, thus
ruling out possible contamination of the preparation by a nonspecific
endonuclease.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 9.
Incision of OsO4-treated DNA by the D. radiodurans enzymes. (A) 500 ng of OsO4-treated DNA was incubated
at 32°C for 10 min with increasing amounts of fraction V ( ) and
fraction VI ( ) enzymes. The products of the reaction were separated
on an agarose gel and quantified by microdensitometric analysis (for
details, see Materials and Methods). (B) Thymine glycol DNA glycosylase
activities of fraction V ( ) and fraction VI ( ) enzymes in the
presence of different dilutions of anti E. coli Fpg
antibodies.
|
|
To confirm that this thymine glycol DNA glycosylase activity is carried
by the Fapy- or 8-oxoG-DNA glycosylase-AP lyase protein
present in
fraction V, OsO
4-treated-DNA cleavage reactions were
performed in the presence of various amounts of anti-Fpg protein
antibodies. The results (Fig.
9B) show that only anti-Fpg antibodies
are able to inhibit the enzymatic reactions, suggesting that the
thymine glycol glycosylase activity is carried by the same enzyme
that
cleaves at Fapy, 8-oxoG, and AP
lesions.
 |
DISCUSSION |
D. radiodurans has an extraordinary ability to
withstand both the lethal and the mutagenic effects of ionizing
radiation. This bacterium is multigenomic (20), with
stationary-phase cells carrying an estimated four genome equivalents.
It has been proposed (10) that preexisting alignment between
homologous sequences of the chromosomes facilitates the association of
these regions after X irradiation, leading to rapid recombinational
repair of the complete genome. However, this model cannot explain the
resistance of the bacterium to the mutagenic effects of ionizing
radiation, believed to be due to the generation of oxidized bases in
DNA (17). The effects of these modified bases are eliminated
in E. coli by a set of DNA repair enzymes including the Fpg,
MutY, and MutT proteins, coordinated in the GO repair system (12, 13, 29).
Due to the potential importance of the mechanisms that counteract the
mutagenic effects of oxidized purines, our goal was to identify the
enzymes involved in the repair of these oxidized bases in D. radiodurans, in particular to purify from bacterial extracts the
proteins that excise Fapy residues since it was not possible to detect
8-oxoG repair activity in crude extracts of D. radiodurans
(data not shown). Our results show that two protein fractions from
D. radiodurans exhibit Fapy-DNA glycosylase activity. The
two proteins differ in both hydrophobicity and charge, since they are
eluted on the FPLC MonoS or hydrophobic columns at different ionic
strengths. The proteins also have different catalytic parameters. Fraction VI enzyme exhibits robust 8-oxoG-DNA glycosylase and AP lyase
activities and has very efficient kinetic parameters (Km and Kcat) for action
on Fapy and 8-oxoG residues similar to those of the E. coli
Fpg protein (6). The mechanisms of action of this fraction
VI enzyme appears to involve a transient Schiff base intermediate with
8-oxoG or AP site containing DNA that can be trapped upon reduction
with NaBH4, with the AP lyase activity proceeding by a
,
elimination. Anti-E. coli Fpg antibodies recognize the fraction VI enzyme, and these antibodies strongly inhibit its
glycosylase and AP lyase activities, suggesting significant structural
similarity between the E. coli and D. radiodurans
proteins. The E. coli Fpg protein is unable to incise
8-oxoG/A complex, which is a substrate for the MutY protein in the GO
repair system (8, 28). In contrast, the fraction VI enzyme
is able to recognize and repair the 8-oxoG/A mismatch, although only at
a slow rate. This activity is also inhibited by anti-Fpg antibodies
(data not shown), suggesting that it is carried by the same protein.
This result suggest that D. radiodurans may have a GO repair
system different from that in E. coli. Indeed, we have been
unable to detect a MutY like activity in the crude extract or in the
Phosphor-Ultrogel fractions from D. radiodurans (data not shown).
The second protein (fraction V enzyme) shows a weaker affinity for Fapy
residues and a low 8-oxoG/C-DNA glycosylase activity. As described for
the fraction VI enzyme, fraction V enzyme also has an AP lyase
activity, which proceeds by a
,
-elimination mechanism; it also
forms a transient Schiff base intermediate with 8-oxoG or AP site
containing DNA. A thymine glycol DNA glycosylase associated with
fraction V enzyme has also been identified. Anti-E. coli Fpg
antibodies inhibit all of those activities, but less efficiently than
for the fraction VI enzyme. This suggests that the fraction V protein
has some structural similarities with the Fpg protein, although less
marked than for the fraction VI enzyme. A thymidine glycol DNA
glycosylase has previously been partially purified from D. radiodurans extracts (34), but the relationship between
this ~30-kDa protein and the ~38-kDa fraction V protein is not clear.
The fact that D. radiodurans possesses two glycosylases,
active both on Fapy and 8-oxoG residues, raises the possibility that the smaller one (fraction V) is derived from the larger one by limited
proteolysis. Indeed, they have the same optimum pH, similar sizes, and
intrinsic AP lyase activities, both functioning by
,
elimination,
and both cross-react with anti-E. coli Fpg antibodies but
not with anti-E. coli Nth antibodies. However, only fraction V protein has a thymine glycol DNA glycosylase activity. It is formally
possible that the smaller protein (fraction VI) is a proteolytic
fragment of the larger (fragment V) one and that their different
thymine glycol glycosylase activities are due to the fact that one
activity is a fragment of the other. However, the fact that only the
smaller protein excised oxidized pyrimidines favors the presence of two
distinct unrelated proteins. Furthermore, in testing for activity on
8-oxoG containing-DNA, we found that the smaller protein (fraction VI)
was more active than the larger one (fraction V), and immunoblotting
results show that the E. coli anti-FPG antibodies binds much
more weakly to fraction V than to fraction VI (consistent with the fact
that fraction VI is more inhibited by these antibodies than fraction V
in both Fapy and 8-oxoG activities). Furthermore, regardless of which base is opposite the 8-oxoG lesion in a DNA duplex, the smaller protein
(fraction VI) is in all cases more active than the larger one (fraction
V). These results together are most consistent with the two proteins
being independent gene products.
Part of the sequence of the genome of D. radiodurans is
currently available (TIGR database). A computer search for homologies to the E. coli Fpg protein reveals one sequence (fragment
gdr 31) coding for a putative protein having a molecular mass of 34.8 kDa (39% identity and 52.6% similarity with the E. coli
Fpg protein amino acids sequence) and containing a four-cysteine zinc
finger motif. These finding suggest that this sequence could code for the fraction VI enzyme. However, we have been unable to detect any
other D. radiodurans sequence encoding a Fpg homolog that could code for the fraction V enzyme, although the genomic sequence is
not yet complete. Concerning potential homologs of the E. coli Nth protein, genomic fragment gdr 4 encodes a putative
protein of 226 amino acids (molecular weight of 28,288, with 40%
identity and 54% similarity with the E. coli Nth protein
amino acids sequence), significantly smaller than the fraction V enzyme
that we have purified and characterized. This putative protein could be
the ~30-kDa thymine glycol DNA glycosylase that has been partially purified from D. radiodurans extracts (34).
In conclusion, D. radiodurans is the first bacterium that
appears to contain two different proteins excising 8-oxoG residues. One
of them shares significant homology with the E. coli Fpg
protein and a common range of enzymatic activities. This protein could be a homolog of the E. coli Fpg protein, which confirms the
existence of a base excision repair system in D. radiodurans
(25). Further characterization of these two proteins and of
their corresponding genes will be necessary to determine their exact
roles in the unusual resistance of D. radiodurans to
ionizing radiation and other DNA-damaging agents.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from Electricité de
France (Radioprotection), the Association pour la Recherche contre le
Cancer, and fellowships (to C.B.) from la Ligue contre le Cancer and
the Association pour la Recherche contre le Cancer.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Groupe
"Réparation des Lésions Radio-et Chimio-Induites," UMR
1772 CNRS, Institut Gustave Roussy, 94805 Villejuif Cedex, France.
Phone: 33 1 42114824. Fax: 33 1 42114454. E-mail:
jlaval{at}igr.fr.
 |
REFERENCES |
| 1.
|
Anderson, A. W.,
H. C. Norden,
R. F. Cain,
G. Parrish, and D. Duggan.
1956.
Studies on a radio-resistant micrococcus. I. Isolation, morphology, cultural characteristics, and resistance to gamma radiation.
Food Technol.
10:575-578.
|
| 2.
|
Asahara, H.,
P. M. Wistort,
J. F. Bank,
R. H. Bakerian, and R. P. Cunningham.
1989.
Purification and characterization of Escherichia coli endonuclease III from the cloned nth gene.
Biochemistry
28:4444-4449[Medline].
|
| 3.
|
Boiteux, S.,
J. Belleney,
B. P. Roques, and J. Laval.
1984.
Two rotameric forms of imidazole ring-opened 7-methylguanine are present in alkylated polynucleotides.
Nucleic Acids Res.
6:3673-3683[Abstract/Free Full Text].
|
| 4.
|
Boiteux, S.,
J. Belleney,
B. P. Roques, and J. Laval.
1984.
Two rotameric forms of imidazole ring-opened 7-methylguanine are present in alkylated polynucleotides.
Nucleic Acids Res.
6:3673-3683.
|
| 5.
|
Boiteux, S.,
T. R. O'Connor, and J. Laval.
1987.
Formamidopyrimidine-DNA glycosylase of Escherichia coli: cloning and sequencing of the fpg structural gene and overproduction of the protein.
EMBO J.
6:3177-3183[Medline].
|
| 6.
|
Boiteux, S.,
T. R. O'Connor,
F. Lederer,
A. Gouyette, and J. Laval.
1990.
Homogeneous Escherichia coli FPG. A DNA glycosylase which excises imidazole ring-opened purines and nicks DNA at apurinic/apyrimidine sites.
J. Biol. Chem.
265:3916-3922[Abstract/Free Full Text].
|
| 7.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of proteins utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[Medline].
|
| 8.
|
Castaing, B.,
A. Geiger,
H. Seliger,
P. Nehls,
J. Laval,
C. Zelwer, and S. Boiteux.
1993.
Cleavage and binding of a DNA fragment containing a single 8-oxoguanine by wild type and mutant FPG proteins.
Nucleic Acids Res.
21:2899-2905[Abstract/Free Full Text].
|
| 9.
|
Cheng, K. C.,
D. S. Cahill,
H. Kasai,
S. Nishimura, and L. A. Loeb.
1992.
8-Hydroxyguanine, an abundant form of oxidative DNA damage, causes G-T and A-C substitutions.
J. Biol. Chem.
267:166-172[Abstract/Free Full Text].
|
| 10.
|
Daly, M. J.,
L. Ouyang,
P. Fuchs, and K. W. Minton.
1994.
In vivo damage and RecA-dependent repair of plasmid and chromosomal DNA in the radiation-resistant bacterium Deinococcus radiodurans.
J. Bacteriol.
176:3508-3517[Abstract/Free Full Text].
|
| 11.
|
Demple, B., and L. Harrison.
1994.
Repair of oxidative damage to DNA: enzymology and biology.
Annu. Rev. Biochem.
63:915-948[Medline].
|
| 12.
|
Dianov, G., and T. Lindahl.
1994.
Reconstitution of the DNA base excision-repair pathway.
Curr. Biol.
4:1069-1076[Medline].
|
| 13.
|
Dianov, G.,
B. Sedgwick,
G. Daly,
M. Olsson,
S. Lovett, and T. Lindahl.
1994.
Release of 5'-terminal deoxyribose-phosphate residues from incised abasic sites in DNA by the Escherichia coli RecJ protein.
Nucleic Acids Res.
22:993-998[Abstract/Free Full Text].
|
| 14.
|
Eide, L.,
M. Bjors,
M. Pirovano,
I. Alseth,
K. G. Berdal, and E. Seeberg.
1997.
Base excision of oxidative purine and pyrimidine DNA damage in Saccharomyces cerevisiae by a DNA glycosylase with sequence similarity to endonuclease III from Escherichia coli.
Proc. Natl. Acad. Sci. USA
93:10735-10740[Abstract/Free Full Text].
|
| 15.
|
Evans, J. M.,
M. Maccabee,
Z. Hatahet,
J. Courcelle,
R. Bockrath,
H. Ide, and S. Wallace.
1993.
Thymine ring saturation products: lesion bypass, misinsertion and implications for mutagenesis.
Mutat. Res.
299:147-156[Medline].
|
| 16.
|
Graves, R. J.,
I. Felzenswalb,
J. Laval, and T. R. O'Connor.
1992.
Excision of the 5'-terminal deoxyribose phosphate from damaged DNA is catalyzed by the FPG protein of Escherichia coli.
J. Biol. Chem.
267:14429-14435[Abstract/Free Full Text].
|
| 17.
|
Grollman, A. P., and M. Moriya.
1993.
Mutagenesis by 8-oxoguanine: an enemy within.
Trends Genet.
9:246-249[Medline].
|
| 18.
|
Gutman, P. D.,
P. Fuchs,
L. Ouyane, and K. W. Minton.
1993.
Identification, sequencing, and targeted mutagenesis of a DNA polymerase gene required for the extreme radioresistance of Deinococcus radiodurans.
J. Bacteriol.
175:3581-3590[Abstract/Free Full Text].
|
| 19.
|
Gutman, P. D.,
J. D. Carroll,
C. I. Masters, and K. W. Minton.
1994.
Sequencing, targeted mutagenesis and expression of a recA gene required for the extreme radioresistance of Deinococcus radiodurans.
Gene
141:31-37[Medline].
|
| 20.
|
Hansen, M. T.
1978.
Multiplicity of genome equivalents in the radiation-resistant bacterium Micrococcus radiodurans.
J. Bacteriol.
134:71-75[Abstract/Free Full Text].
|
| 21.
|
Jiang, D.,
Z. Hatahet,
J. O. Blaisdell,
R. J. Melamede, and S. S. Wallace.
1997.
Escherichia coli endonuclease VIII: cloning, sequencing, and overexpression of the nei structural gene and characterization of nei and nei nth mutants.
J. Bacteriol.
179:3773-3782[Abstract/Free Full Text].
|
| 22.
|
Kim, J., and S. Linn.
1988.
The mechanisms of action of E. coli endonuclease III and T4 UV endonuclease (endonuclease V) at AP sites.
Nucleic Acids Res.
16:1135-1141[Abstract/Free Full Text].
|
| 23.
|
Kuchino, Y.,
F. Mori,
H. Kasai,
H. Inoue,
S. Iwai,
K. Mura,
E. Ohtsuka, and S. Nishimura.
1987.
Misreading of DNA templates containing 8-hydroxydeoxyguanosine at the modified base and at adjacent residues.
Nature
327:77-79[Medline].
|
| 24.
|
Maccabee, M.,
J. S. Evans,
M. P. Glackin,
Z. Hatahet, and S. Wallace.
1994.
Pyrimidine ring fragmentation products. Effects of lesion structure and sequence context on mutagenesis.
J. Mol. Biol.
256:514-530.
|
| 25.
|
Masters, I. C.,
B. E. B. Moseley, and K. W. Minton.
1991.
AP endonuclease and uracil DNA glycosylase activities in Deinococcus radiodurans.
Mutat. Res.
254:263-272[Medline].
|
| 26.
|
Mattimore, V.,
K. S. Udupa,
G. A. Berne, and J. R. Battista.
1995.
Genetic characterization of forty ionizing radiation-sensitive strains of Deinococcus radiodurans: linkage information from transformation.
J. Bacteriol.
177:5232-5237[Abstract/Free Full Text].
|
| 27.
|
Melamede, R. J.,
Z. Hatahet,
Y. W. Kow,
H. Ide, and S. S. Wallace.
1994.
Isolation and characterization of endonuclease VIII from Escherichia coli.
Biochemistry
33:1255-1264[Medline].
|
| 28.
|
Michaels, M. L.,
J. Tchou,
A. P. Grollman, and J. H. Miller.
1992.
A repair system for 8-oxo-7,8-dihydrodeoxyguanine.
Biochemistry
31:10964-10968[Medline].
|
| 29.
|
Michaels, M. L., and J. H. Miller.
1992.
The GO system protects organisms from the mutagenic effect of the spontaneous lesion 8-hydroxyguanine (7,8-dihydro-8-oxoguanine).
J. Bacteriol.
174:6321-6325[Free Full Text].
|
| 30.
|
Minton, K. W.
1994.
DNA repair in the extremely radioresistant bacterium Deinococcus radiodurans.
Mol. Microbiol.
13:9-15[Medline].
|
| 31.
|
Minton, K. W.
1996.
Repair of ionizing-radiation damage in the radiation resistant bacterium Deinococcus radiodurans.
Mutat. Res.
363:1-7[Medline].
|
| 32.
|
Moseley, B. E. B., and A. Mattingly .Proc. Natl. Acad. Sci. USA.
1971.
Repair of irradiated transforming deoxyribonucleic acid in wild-type and radiation-sensitive mutant of Micrococcus radiodurans.
J. Bacteriol.
105:976-983[Abstract/Free Full Text].
|
| 33.
|
Moseley, B. E. B.
1983.
Photobiology and radiobiology of Micrococcus (Deinococcus) radiodurans.
Photochem. Photobiol. Rev.
7:223-274.
|
| 34.
|
Mun, C.,
J. Del Rowe,
M. Sandigursky,
K. Minton, and W. A. Franklin.
1994.
DNA deoxyribophosphodiesterase and an activity that cleaves DNA containing rhymine glycol adducts in Deinococcus radiodurans.
Radiat. Res.
138:282-285[Medline].
|
| 35.
|
Murray, R. G. E., and B. W. Brooks.
1986.
Deinococcus, p. 1035-1043.
In
P. Sneath, N. Mair, M. Sharpe, and J. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 2. Williams & Wilkins, Baltimore, Md.
|
| 36.
|
Saparbaev, M., and J. Laval.
1994.
Excision of the hypoxanthine from DNA containing dIMP residues by the Escherichia coli, yeast, rat, and human alkypurine DNA glycosylases.
Proc. Natl. Acad. Sci. USA
91:5873-5878[Abstract/Free Full Text].
|
| 37.
|
Shibutani, S.,
M. Takeshita, and A. P. Grollman.
1991.
Insertion of specific bases during DNA synthesis past the oxidation-damaged base 8-oxodG.
Nature
349:431-434[Medline].
|
| 38.
|
Smith, M. D.,
C. I. Masters, and B. E. B. Moseley.
1992.
Molecular biology of radiation resistant bacteria, p. 258-280.
In
R. A. Herbert, and R. J. Sharp (ed.), Molecular biology and biotechnology of extremophiles. Chapman & Hall, New York, N.Y.
|
| 39.
|
Sun, B.,
K. A. Latham,
M. L. Dodson, and R. S. Lloyd.
1995.
Studies of the catalytic mechanism of five DNA glycosylases intermediates. Probing for enzyme-DNA imino J.
Biol. Chem.
270:19501-19508[Abstract/Free Full Text].
|
| 40.
|
Sweet, D. M., and B. E. B. Moseley.
1976.
The resistance of Micrococcus radiodurans to killing and mutation by agents which damage DNA.
Mutat. Res.
34:175-186[Medline].
|
| 41.
|
Tchou, J.,
H. Kasai,
S. Shibutani,
M. H. Chung,
J. Laval,
A. P. Grollman, and S. Nishimura.
1991.
8-Oxoguanine (8-hydroxyguanine) DNA glycosylase and its substrate specificity.
Proc. Natl. Acad. Sci. USA
88:4690-4694[Abstract/Free Full Text].
|
| 42.
|
Tchou, J., and A. P. Grollman.
1995.
The catalytic mechanism of Fpg protein. Evidence for a Schiff base intermediate and amino terminus localization of the catalytic site.
J. Biol. Chem.
270:11671-11677[Abstract/Free Full Text].
|
| 43.
|
Towbin, H. T.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 44.
|
Udupa, K. S.,
P. A. O'Cain,
V. Mattimore, and J. R. Battista.
1994.
Novel ionizing radiation-sensitive mutants of Deinococcus radiodurans.
J. Bacteriol.
176:7439-7446[Abstract/Free Full Text].
|
| 45.
|
Wood, M. L.,
M. Dizgaroglu,
E. Gajewski, and J. M. Essigmann.
1990.
Mechanistic studies of ionizing radiation and oxydative mutagenesis: effects of a single 8-hydroxyguanine (7-hydro-8-oxoguanine) residue inserted at a unique abasic site in a viral genome.
Biochemistry
26:7024-7032.
|
Journal of Bacteriology, January 1999, p. 262-269, Vol. 181, No. 1
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lipton, M. S., Pasa-Tolic', L., Anderson, G. A., Anderson, D. J., Auberry, D. L., Battista, J. R., Daly, M. J., Fredrickson, J., Hixson, K. K., Kostandarithes, H., Masselon, C., Markillie, L. M., Moore, R. J., Romine, M. F., Shen, Y., Stritmatter, E., Tolic', N., Udseth, H. R., Venkateswaran, A., Wong, K.-K., Zhao, R., Smith, R. D.
(2002). From the Cover: Global analysis of the Deinococcus radiodurans proteome by using accurate mass tags. Proc. Natl. Acad. Sci. USA
99: 11049-11054
[Abstract]
[Full Text]
-
Li, X., Lu, A-L.
(2001). Molecular Cloning and Functional Analysis of the MutY Homolog of Deinococcus radiodurans. J. Bacteriol.
183: 6151-6158
[Abstract]
[Full Text]
-
Matsumoto, Y., Zhang, Q.-M., Takao, M., Yasui, A., Yonei, S.
(2001). Escherichia coli Nth and human hNTH1 DNA glycosylases are involved in removal of 8-oxoguanine from 8-oxoguanine/guanine mispairs in DNA. Nucleic Acids Res
29: 1975-1981
[Abstract]
[Full Text]
-
White, O., Eisen, J. A., Heidelberg, J. F., Hickey, E. K., Peterson, J. D., Dodson, R. J., Haft, D. H., Gwinn, M. L., Nelson, W. C., Richardson, D. L., Moffat, K. S., Qin, H., Jiang, L., Pamphile, W., Crosby, M., Shen, M., Vamathevan, J. J., Lam, P., McDonald, L., Utterback, T., Zalewski, C., Makarova, K. S., Aravind, L., Daly, M. J., Minton, K. W., Fleischmann, R. D., Ketchum, K. A., Nelson, K. E., Salzberg, S., Smith, H. O., Craig, J., Venter, , Fraser, C. M.
(1999). Genome Sequence of the Radioresistant Bacterium Deinococcus radiodurans R1. Science
286: 1571-1577
[Abstract]
[Full Text]
-
Hazra, T. K., Izumi, T., Venkataraman, R., Kow, Y. W., Dizdaroglu, M., Mitra, S.
(2000). Characterization of a Novel 8-Oxoguanine-DNA Glycosylase Activity in Escherichia coli and Identification of the Enzyme as Endonuclease VIII. J. Biol. Chem.
275: 27762-27767
[Abstract]
[Full Text]