Previous Article | Next Article 
Journal of Bacteriology, January 1999, p. 331-333, Vol. 181, No. 1
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
(R)-Citramalate Synthase in
Methanogenic Archaea
David M.
Howell,
Huimin
Xu, and
Robert H.
White*
Department of Biochemistry, Virginia
Polytechnic Institute and State University, Blacksburg, Virginia
24061-0308
Received 18 June 1998/Accepted 19 October 1998
 |
ABSTRACT |
The Methanococcus jannaschii gene MJ1392 was cloned,
and its protein product was hyperexpressed in Escherichia
coli. The resulting protein was purified and shown to catalyze
the condensation of pyruvate and acetyl coenzyme A, with the formation
of (R)-citramalate. Thus, this gene (cimA)
encodes an (R)-citramalate synthase (CimA). This is the
first identification of this enzyme, which is likely involved in the
biosynthesis of isoleucine.
 |
TEXT |
Citramalate (2-methylmalate) is a
biochemical intermediate known to be involved in several aspects of
bacterial metabolism, including, among others, the anaerobic metabolism
of glutamate via the methylaspartate pathway of Clostridium
tetanomorphum (2). In this pathway, glutamate is
converted via L-threo-
-methylaspartate [(2S,3R)-3-methylaspartate] to mesaconate
[(E)-2-methyl-2-butenedionic acid], which is then hydrated
by citramalate hydrolyase (15, 16) to
L-(+)-citramalate (S-citramalate). The resulting
citramalate is then cleaved by citramalate lyase to pyruvate and
acetate (1). Hydration of citraconic acid
[(Z)-2-methyl-2-butenedionic acid] to
D-(
)-citramalate (R-citramalate) has also been
described (13, 18). A similar pathway for the metabolism of
itaconate, via itaconyl coenzyme A (CoA) and citramalyl-CoA, to
acetyl-CoA and pyruvate has also been reported (5, 6). The
formation of either D-(
)- or
L-(+)-citramalate by the direct condensation of acetyl-CoA
and pyruvate appears never to have been directly observed, but both of
these reactions have been proposed as a key step in a number of
biosynthetic pathways. Among these is the formation of isoleucine via
the pyruvate pathway, which, based on 13C nuclear magnetic
resonance labeling studies (7-9, 15), is the major pathway
for isoleucine formation in many species of methanogenic archaea.
Labeling studies in other organisms have produced similar results
(4, 23).
As part of studies aimed at establishing the identity of genes in the
methanogens that were possibly involved in the biosynthesis of
coenzymes, we cloned and overexpressed the Methanococcus
jannaschii gene MJ1392 and identified the reaction catalyzed by
the encoded enzyme. We report here that this gene product is
(R)-citramalate synthase. This is the first report of the
identification of such an enzyme, which we now designate CimA, which is
the product of the cimA gene.
Identification, cloning, and high-level expression of the gene
product.
The approach that was used to identify this gene was the
outcome of other work aimed at identifying the reactions catalyzed by
archaeal enzymes with sequences homologous to homocitrate synthase (NifV) (24). The searches for these genes in the
genomes of the methanogens M. jannaschii (3) and
Methanobacterium thermoautotrophicum
H (16)
were performed with the blast_to_rpraze method (The Institute for
Genomic Research, Rockville, Md.). The genome of M. jannaschii was found to contain three genes homologous to the homocitrate synthase gene (nifV) (MJ0503, MJ1392, and
MJ1543), and the M. thermoautotrophicum
H genome had
three genes homologous to the homocitrate synthase gene
(nifV) (MTH1630, MTH723, and MTH1481). The protein products
from one or more of these genes were targets for the enzymes involved
in the biosynthesis of
-ketosuberate (10) and thus
coenzyme B (7-mercaptoheptanoylthreonine phosphate). Since we did not
know the reactions catalyzed by the protein products of each of these
genes, we cloned each gene to determine the reactions involved.
Plasmid construct AMJGS60, containing the M. jannaschii gene
MJ1392, and the PUC18 vector were obtained from The Institute of
Genomic Research/American Type Culture Collection microbial genome
special collection. The oligonucleotide primers used to direct the PCR
formation of a specific gene cartridge had the following sequences: 5'
CATGCATATGATGGTAAGGATATTTGAT 3' and 5' GATCGGATCCTTAATTCAATAACATATTGAT 3'.
The high-level expression of the MJ1392 gene product in the
Escherichia coli host strain BL21(DE3) was accomplished by
constructing
a gene cartridge in vitro and cloning this cartridge into
the
pT
7-7 plasmid (
20) such that the gene
expression is controlled
by the T7 phage transcriptional and
translational regulatory elements,
which in turn are regulated by the
lac control elements. The recombinant
plasmid was
transformed into the host strain BL21(DE3)
E. coli cells,
and the BL21(DE3)
E. coli cells containing the
pT
7-7 plasmid,
with insert, were grown in LB medium
supplemented with 100 mg
of ampicillin per ml at 30°C to an
absorbance at 600 nm of 1.0.
Protein production was then induced by the
addition of isopropyl-

-
D-thiogalactopyranoside
(IPTG) to
a final concentration of 1 mM. After the addition of
IPTG, the cells
were cultured for another 2 h, harvested by centrifugation,
and
frozen at

20°C until
used.
Preparation of cell extract and purification of citramalate
synthase.
The activity of the hyperexpressed M. jannaschii enzyme was measured in E. coli cell extracts
prepared by sonication of the E. coli cell pellets (100 to
200 mg [wet weight]) in 2 ml of 0.1 M TES
[N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid], pH 7.5, buffer. High expression of the desired protein was confirmed by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) (12% polyacrylamide) of the SDS-soluble cellular
proteins, which showed a band at the expected molecular mass of 50 kDa,
in agreement with the known gene sequence. The amino-terminal sequence
of MJ1392 was calculated to be MMVRIFDTTL on the basis of the DNA
sequence. The sequence of the overexpressed protein band was found to
be MLVRIFDTTL. The difference observed in the second amino acid in these sequences would result from a single base pair substitution in
the third base of the methionine codon and could be the result of an
error in the gene sequence reported. The similarity between these
sequences further supports the likelihood that the desired protein was obtained.
SDS-PAGE analysis of the proteins in both the soluble extract and the
resulting insoluble pellet showed that most of the desired
protein was
in the pellet. Attempts to recover active enzyme from
the insoluble
protein in the pellet by the methods of Sambrook
et al. (
14)
were not successful. The enzyme was thus purified
from the soluble
fraction. Induction of protein synthesis in the
presence of 1 mM
2-mercaptoethanol or by growth and induction
protein synthesis at
30°C did not allow greater solubilization
of the desired protein. The
protein band or enzymatic activity
was not present in the
E. coli cells that did not contain the
gene
insert.
Protein purification was initiated by the addition of solid ammonium
sulfate (to 45% saturation) to the soluble protein fraction.
The
sample was then centrifuged at 16,000 ×
g for 2 min; the
resulting
supernatant was then brought to 55% ammonium sulfate
saturation
and centrifuged for 5 min at 16,000 ×
g. At this
point, CimA was
located in the pellet, which was then dissolved in
buffer containing
20 mM TES buffer (pH 7.0), 5 mM MgCl
2,
and 150 mM
KCl.
The resuspended ammonium sulfate sample was then heated at 60°C for
10 min and centrifuged at 16,000 ×
g for 4 min, and the
supernatant was placed on a Pharmacia Superose 6 column equilibrated
in
the same buffer at a flow rate of 0.5 ml/min. The elution time
of the
enzyme corresponded to a molecular mass of 93 to 128 kDa,
indicating
that its functional conformation is that of a dimer.
This has been
observed for other enzymes analogous to the
nifV gene
product (
24). Activity assays, discussed below, were used
to
monitor the purification steps (Table
1).
The thermostability of the enzyme was measured by incubating samples
(100 to 200 µl) at various temperatures for 10 min. The
denatured
protein was removed by centrifugation, and the supernatant
was assayed
for enzymatic activity as discussed below. The enzyme
showed moderate
stability to elevated temperatures (Fig.
1) but
did not exhibit the
stability expected when compared with other
thermophilic proteins
expressed by gene cloning (
19). Increasing
the ionic
strength with potassium chloride did not alter the thermostability.
Other factors must be present for this
protein to maintain its
activity at the growth temperatures of the
thermophilic
M. jannaschii.
Enzymatic activity and substrate specificity.
The enzyme
activity was assayed by monitoring the production of CoA over time by a
procedure similar to that used by Srere (17). Samples to be
assayed were brought to a final volume of 100 µl by mixing with TES
buffer (0.1 M, pH 7.5), and made 1 mM acetyl-CoA and 1 mM pyruvate by
the addition of 0.1 M solutions of these substrates. The resulting
solutions were then incubated at 50°C for 1 h. To the resulting
incubation mixture were added 50 µl of 10 mM
5,5'-dithio-bis(2-nitrobenzoic acid) in 0.1 Tris-HCl (pH 8.0), 70 µl
of 1 M Tris-HCl (pH 8.0), and distilled water to a total volume of 0.9 ml. The absorbance at 412 nm was recorded and blanked against an
identical incubation sample without the pyruvate. The micromoles of
HS-CoA produced were calculated from a standard curve generated with
known concentrations (0 to 110 µM) of 2-mercaptoethanol. The
production of CoA was found to be linear over the 1-h time period of
the assay, and product formation was a linear function of the amount of
enzyme added. The protein concentration of each of the samples was
determined by the bicinchoninic acid method (Pierce Scientific Co.), as
described by the manufacturer, with bovine serum albumin serving as the standard.
The specific activity of CimA was 2.9 µmol/min/mg of protein, which
agrees with that observed for other, similar, enzymes
(
24).
The
Kms for pyruvate and for acetyl-CoA have
been determined
to be 0.85 and 0.14 mM, respectively. The enzyme was
specific
for acetyl-CoA and pyruvate. Incubation of the enzyme with

-ketoglutarate,

-ketoadipate,

-ketopimelate,

-ketoisovalerate, and acetyl-CoA
(each at 2.8 mM) produced no
detectable amount of possible condensation
products, as assayed by gas
chromatography-mass spectrometry (GC-MS)
of the methyl ester
derivatives of the possible products (
10).
Likewise,
incubation of the enzyme with acetyl-CoA (1 mM) and
propionyl-CoA (0.9 mM) failed to produce 2,3-dimethylmalate. The
finding that

-ketoisovalerate was not a substrate allows this
enzyme to be
distinguished from 2-isopropylmalate synthase, which
is also able to
catalyze the condensation of acetyl-CoA and pyruvate
(
11) to
form an isomer of citramalate, but with a
Km 2 orders
of magnitude larger than that of

-ketoisovalerate. Thus, on
the
basis of the substrates used by this enzyme, the earlier putative
identification of the MJ1392 gene product as isopropylmalate synthase
was
incorrect.
Analysis of products.
The citramalate product was confirmed by
GC-MS of its dimethyl ester derivative, as previously described
(10). The product was found to be (R)-citramalate
by GC-MS with a type G-TA Chiraldex column (0.25 mm by 40 m;
Advanced Separation Technologies Inc., Whippany, N.J.) programmed from
95°C to 180°C at 3°C per min. On the Chiraldex GC column,
dimethyl (S)-citramalate was found to elute before dimethyl
(R)-citramalate.
The determination that this enzyme is a citramalate synthase further
extends the number of natural products that are known
to be derived
from acetyl-CoA and

-keto
acids.
 |
ACKNOWLEDGMENTS |
This work was supported by National Science Foundation grant MCB 963086.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, College of Agriculture and Life Science, Virginia
Polytechnic Institute and State University, 111 Engel Hall, Blacksburg,
VA 24061-0308. Phone: (540) 231-6605. Fax: (540) 231-9070. E-mail: rhwhite{at}vt.edu.
 |
REFERENCES |
| 1.
|
Barker, H. A.
1967.
Citramalate lyase of Clostridium tetanomorphum.
Arch. Mikrobiol.
59:4-12[Medline].
|
| 2.
|
Buckel, W., and H. A. Barker.
1974.
Two pathways of glutamate fermentation by anaerobic bacteria.
J. Bacteriol.
117:1248-1260[Abstract/Free Full Text].
|
| 3.
|
Bult, C. J.,
O. White,
G. J. Olsen,
L. Zhou,
R. D. Fleischmann,
G. G. Sutton,
J. A. Blake,
L. M. FitzGerald,
R. A. Clayton,
J. D. Gocayne,
A. R. Kerlavage,
B. A. Dougherty,
J.-F. Tomb,
M. D. Adams,
C. I. Reich,
R. Overbeek,
E. F. Kirkness,
K. G. Weinstock,
J. M. Merrick,
A. Glodek,
J. L. Scott,
N. S. M. Geoghagen,
J. F. Weidman,
J. L. Fuhrmann,
D. Nguyen,
T. R. Utterback,
J. M. Kelley,
J. D. Peterson,
P. W. Sadow,
M. C. Hanna,
M. D. Cotton,
K. M. Roberts,
M. A. Hurst,
B. P. Kaine,
M. Borodovsky,
H.-P. Klenk,
C. M. Fraser,
H. O. Smith,
C. R. Woese, and J. C. Venter.
1997.
Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii.
Science
273:1058-1073[Abstract].
|
| 4.
|
Charon, N. W.,
R. C. Johnson, and D. Peterson.
1974.
Amino acid biosynthesis in the spirochete Leptospira: evidence for a novel pathway of isoleucine biosynthesis.
J. Bacteriol.
117:203-211[Abstract/Free Full Text].
|
| 5.
|
Cooper, R. A., and H. L. Kornberg.
1964.
The utilization of itaconate by Pseudomonas sp.
Biochem. J.
91:82-91[Medline].
|
| 6.
|
Cooper, R. A.,
K. Itiaba, and H. L. Kornberg.
1965.
The utilization of aconate and itaconate by Micrococcus sp.
Biochem. J.
94:25-31[Medline].
|
| 7.
|
Eikmanns, B.,
R. Jaenchen, and R. K. Thauer.
1983.
Unusual pathway of isoleucine biosynthesis in Methanobacterium thermoautotrophicum.
Arch. Microbiol.
136:106-110.
|
| 8.
|
Ekiel, I.,
G. D. Sprot, and G. B. Patel.
1985.
Acetate and CO2 assimilation by Methanothrix concilii.
J. Bacteriol.
162:905-908[Abstract/Free Full Text].
|
| 9.
|
Ekiel, I.,
I. C. P. Smith, and G. D. Sprott.
1984.
Biosynthesis of isoleucine in methanogenic bacteria: a 13C NMR study.
Biochemistry
23:1683-1687.
|
| 10.
|
Howell, D. M.,
K. Harich,
H. Xu, and R. H. White.
1998.
The -keto acid chain elongation reactions involved in the biosynthesis of coenzyme B (7-mercaptoheptanoylthreonine phosphate) in methanogenic Archaea.
Biochemistry
37:10108-10117[Medline].
|
| 11.
|
Kohlhaw, G. B., and T. R. Leary.
1970.
-Isopropylmalate synthase (Salmonella typhimurium).
Methods Enzymol.
17a:771-777.
|
| 12.
|
Oda, Y.,
S. Suzuki, and H. Katsuki.
1987.
Physiological roles of two enzymes with fumarase activity in two pseudomonads.
Biochem. Int.
14:871-878[Medline].
|
| 13.
|
Raghavendra Rao, M. R.,
S. S. Subramanian,
H. I. Rahatekar, and S. V. Paranjape.
1963.
Enzymatic hydration of citraconate to ( )citramalate.
Biochem. Biophys. Res. Commun.
12:78-82[Medline].
|
| 14.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 15.
|
Schafer, S.,
T. Paame,
R. Vilu, and G. Fuchs.
1989.
13C-NMR study of acetate assimilation in Thermoproteus neutrophilus.
Eur. J. Biochem.
186:695-700[Medline].
|
| 16.
|
Smith, D. R.,
L. A. Doucette-Stamm,
C. Deloughery,
H. Lee,
J. Dubois,
T. Aldredge,
R. Bashirzadeh,
D. Blakely,
R. Cook,
K. Gilbert,
D. Harrison,
L. Hoang,
P. Keagle,
W. Lumm,
B. Pothier,
D. Qiu,
R. Spadafora,
R. Vicaire,
Y. Wang,
J. Wierzbowski,
R. Gibson,
N. Jiwani,
A. Caruso,
D. Bush,
H. Safer,
D. Patwell,
S. Prabhakar,
S. McDougall,
G. Shimer,
A. Goyal,
S. Pietrokovski,
G. M. Church,
C. J. Daniels,
J. Mao,
P. Rice,
J. Nölling, and J. N. Reeve.
1997.
The complete genome sequence of Methanobacterium thermoautotrophicum H: functional analysis and comparative genomics.
J. Bacteriol.
179:7135-7155[Abstract/Free Full Text].
|
| 17.
|
Srere, P. A.
1969.
Citrate synthase.
Methods Enzymol.
13:3-11.
|
| 18.
|
Subramanian, S. S., and M. R. Raghavendra Rao.
1968.
Purification and properties of citraconase.
J. Biol. Chem.
243:2367-2372[Abstract/Free Full Text].
|
| 19.
|
Suzuki, T.,
Y. Inoki,
A. Yamagishi,
T. Iwasaki,
T. Wakagi, and T. Oshima.
1997.
Molecular and phylogenetic characterization of isopropylmalate dehydrogenase of a thermoacidophilic archaeon, Sulfolobus sp. strain 7.
J. Bacteriol.
179:1174-1179[Abstract/Free Full Text].
|
| 20.
|
Tabor, S., and C. C. Richardson.
1985.
A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes.
Proc. Natl. Acad. Sci. USA
82:1074-1078[Abstract/Free Full Text].
|
| 21.
|
Tanaka, K.,
K. Nakamura, and E. Mikami.
1991.
Fermentation of S-citramalate, citrate, mesaconate, and pyruvate by a gram-negative strictly anaerobic non-spore-former, Formivibrio citricus gen. nov., sp. nov.
Arch. Microbiol.
155:491-495.
|
| 22.
|
Wang, C. C., and H. A. Barker.
1969.
Activation of L-citramalate hydrolyase from Clostridium tetanomorphum.
J. Biol. Chem.
244:2527-2538[Abstract/Free Full Text].
|
| 23.
|
Westfall, H. N.,
J. W. Charon, and D. E. Peterson.
1983.
Multiple pathways for isoleucine biosynthesis in the spirochete Leptospira.
J. Bacteriol.
154:846-853[Abstract/Free Full Text].
|
| 24.
|
Zheng, L.,
R. H. White, and D. R. Dean.
1997.
Purification of Azotobacter vinelandii nifV-encoded homocitrate synthase.
J. Bacteriol.
197:5963-5966.
|
Journal of Bacteriology, January 1999, p. 331-333, Vol. 181, No. 1
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Atsumi, S., Liao, J. C.
(2008). Directed Evolution of Methanococcus jannaschii Citramalate Synthase for Biosynthesis of 1-Propanol and 1-Butanol by Escherichia coli. Appl. Environ. Microbiol.
74: 7802-7808
[Abstract]
[Full Text]
-
Risso, C., Van Dien, S. J., Orloff, A., Lovley, D. R., Coppi, M. V.
(2008). Elucidation of an Alternate Isoleucine Biosynthesis Pathway in Geobacter sulfurreducens. J. Bacteriol.
190: 2266-2274
[Abstract]
[Full Text]
-
Wu, J., Tao, Y., Zhang, M., Howard, M. H., Gutteridge, S., Ding, J.
(2007). Crystal Structures of Saccharomyces cerevisiae N-Myristoyltransferase with Bound Myristoyl-CoA and Inhibitors Reveal the Functional Roles of the N-terminal Region. J. Biol. Chem.
282: 22185-22194
[Abstract]
[Full Text]
-
Drevland, R. M., Waheed, A., Graham, D. E.
(2007). Enzymology and Evolution of the Pyruvate Pathway to 2-Oxobutyrate in Methanocaldococcus jannaschii. J. Bacteriol.
189: 4391-4400
[Abstract]
[Full Text]
-
Jahn, U., Huber, H., Eisenreich, W., Hugler, M., Fuchs, G.
(2007). Insights into the Autotrophic CO2 Fixation Pathway of the Archaeon Ignicoccus hospitalis: Comprehensive Analysis of the Central Carbon Metabolism. J. Bacteriol.
189: 4108-4119
[Abstract]
[Full Text]
-
Li, F., Hagemeier, C. H., Seedorf, H., Gottschalk, G., Thauer, R. K.
(2007). Re-Citrate Synthase from Clostridium kluyveri Is Phylogenetically Related to Homocitrate Synthase and Isopropylmalate Synthase Rather Than to Si-Citrate Synthase. J. Bacteriol.
189: 4299-4304
[Abstract]
[Full Text]
-
Friedmann, S., Alber, B. E., Fuchs, G.
(2007). Properties of R-Citramalyl-Coenzyme A Lyase and Its Role in the Autotrophic 3-Hydroxypropionate Cycle of Chloroflexus aurantiacus. J. Bacteriol.
189: 2906-2914
[Abstract]
[Full Text]
-
Hendrickson, E. L., Kaul, R., Zhou, Y., Bovee, D., Chapman, P., Chung, J., Conway de Macario, E., Dodsworth, J. A., Gillett, W., Graham, D. E., Hackett, M., Haydock, A. K., Kang, A., Land, M. L., Levy, R., Lie, T. J., Major, T. A., Moore, B. C., Porat, I., Palmeiri, A., Rouse, G., Saenphimmachak, C., Soll, D., Van Dien, S., Wang, T., Whitman, W. B., Xia, Q., Zhang, Y., Larimer, F. W., Olson, M. V., Leigh, J. A.
(2004). Complete Genome Sequence of the Genetically Tractable Hydrogenotrophic Methanogen Methanococcus maripaludis. J. Bacteriol.
186: 6956-6969
[Abstract]
[Full Text]
-
Xu, H., Zhang, Y., Guo, X., Ren, S., Staempfli, A. A., Chiao, J., Jiang, W., Zhao, G.
(2004). Isoleucine Biosynthesis in Leptospira interrogans Serotype lai Strain 56601 Proceeds via a Threonine-Independent Pathway. J. Bacteriol.
186: 5400-5409
[Abstract]
[Full Text]