Previous Article | Next Article ![]()
Journal of Bacteriology, January 1999, p. 341-346, Vol. 181, No. 1
Division of Microbiology, GBF-National
Research Centre for Biotechnology, Braunschweig, Germany
Received 1 July 1998/Accepted 14 October 1998
The TecA broad-spectrum chlorobenzene dioxygenase of
Burkholderia sp. strain PS12 catalyzes the first step in
the mineralization of 1,2,4,5-tetrachlorobenzene. The catabolic genes
were localized on a small plasmid that belongs to the IncP Considerable quantities of
xenobiotics are released each year into the environment. Bacteria that
are able to use many of these compounds as sole sources of carbon and
energy have been isolated from natural habitats (33). The
aerobic metabolism of aromatic compounds is frequently initiated by
dioxygenases, followed by a dehydrogenation reaction catalyzed by a
cis-dihydrodiol dehydrogenase to give catechols or
substituted catechols (17), which serve as substrates for
oxygenolytic cleavage of the aromatic ring (21).
Chlorocatechols are usually channelled into the Krebs cycle by modified
ortho-cleavage pathways, whereas methylcatechols are most
commonly metabolized by meta-cleavage routes (27, 32, 34).
Experimental combination of genes encoding the first two enzymes of a
toluene degradation pathway with those coding for chlorocatechol degradation produced a functional metabolic sequence for the
mineralization of chlorobenzenes via a modified ortho
pathway (31). It has been proposed that the
1,2,4-trichlorobenzene degrader Pseudomonas sp. strain P51
evolved by recruitment of the tod pathway genes of the
toluene-degrading bacterium Pseudomonas putida F1, followed by mutational drift of the todCBA toluene dioxygenase and
todD dehydrogenase genes to yield the tcb genes
encoding the first two enzymes in the transformation of chlorobenzenes
(40-44). Sequences flanking the tcb genes were
suggested to be evolutionary remnants of the todE extradiol
dioxygenase and todF hydrolase genes, which had become
inactivated by major DNA deletions such that misrouting of catechol
into the unproductive meta pathway would no longer be
possible (44).
Although a number of chlorobenzene-degrading bacteria have been
isolated over the past few years, very few, such as
Burkholderia sp. strain PS12, are able to degrade
tetrachlorobenzene (5). The evolution of such bacteria able
to degrade higher chlorinated xenobiotics is of interest not only from
the environmental and biotechnological points of view but also from the
genetic point of view. We investigated the localization, organization,
and sequences of genes that flank the tecAB chlorobenzene
degradation genes of strain PS12, which led us to propose an
evolutionary route from the tod toluene degradation gene to
the tec and tcb chlorobenzene degradation genes.
Southern analysis of BamHI-, BglII-, and
double-digested PS12 total DNA revealed a single band, indicating that
the tecA gene is present at only one locus (Fig.
1A). To analyze whether the tec genes reside on a plasmid, PS12 total DNA prepared as
described previously (38) was separated in a 0.9% agarose
gel by pulsed-field gel electrophoresis (PFGE) (36). The
presence of three plasmids, designated pPS12-1, pPS12-2, and pPS12-3,
all of which were present in two forms and all of which are smaller
than the 50-kbp reference plasmid of Comamonas testosteroni
T-2 used as a size marker (Fig. 1B), was observed. The tecA
genes were localized by Southern blotting (Hybond N; Amersham) of the
pulsed-field gel and hybridization under stringent conditions with the
tecA1 gene probe derived by PCR amplification from plasmid
pSTE7 with primers prSTB1 and prSTB2 (forward,
atgaatcacaccgacacctcccct; reverse,
tcagcgtgtggcgttcagcgcggc). Positive signals were obtained
with the two forms of plasmid pPS12-1 (Fig. 1C).
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Genetic and Biochemical Analyses of the
tec Operon Suggest a Route for Evolution of
Chlorobenzene Degradation Genes
![]()
ABSTRACT
Top
Abstract
Text
References
incompatibility group. PCR analysis of the genetic environment of the
tec genes indicated high similarity to the
transposon-organized catabolic tcb chlorobenzene degradation genes of Pseudomonas sp. strain P51. Sequence
analysis of the regions flanking the tecA genes revealed an
upstream open reading frame (ORF) with high similarity to the
todF 2-hydroxy-6-oxo-2,4-heptadienoate hydrolase gene of
Pseudomonas putida F1 and a discontinuous downstream ORF
showing high similarity to the todE catechol
2,3-dioxygenase gene of strain F1. Both homologues in strain P51 exist
only as deletion remnants. We suggest that different genetic events
thus led to inactivation of the perturbing meta-cleavage
enzymes in strains P51 and PS12 during the evolution of efficient
chlorobenzene degradation pathways. Biochemical characterization of
TodF-like protein TlpF and a genetically refunctionalized TodE-like
protein, TlpE, produced in Escherichia coli provided data
consistent with the proposed relationships.
![]()
TEXT
Top
Abstract
Text
References

View larger version (51K):
[in a new window]
FIG. 1.
Southern analysis of PS12 DNA. Total DNA of
1,2,4,5-tetrachlorobenzene-grown Burkholderia sp. strain
PS12 (lane PS12) was digested with BamHI (lane a),
BamHI-BglII (lane b), and BglII (lane
c) and electrophoretically separated on an agarose gel. The
tcbAaAbAcAd dioxygenase genes (lane P51) from
Pseudomonas sp. strain P51 were amplified from plasmid
pTBCB60 (42) with primers prSTB1 and prSTB4 (forward,
atgaatcacaccgacacctcccct [the tecA1
start codon is in boldface]; reverse,
tcatgctgagtctccttgttgtgc [the tcbAd
stop codon is in boldface]) and were used as a positive control. The
gel was analyzed by Southern hybridization with the tecA1
gene probe of PS12 (A). Total DNAs from strain PS12 and
toluenesulfonate-grown C. testosteroni T-2 (lane T-2) were
subjected to PFGE, stained with ethidium bromide (B), and analyzed by
Southern hybridization with the tecA1 gene probe of PS12 (C)
and the IncP
-specific trfA2 gene probe derived from
plasmid R751 (D). The bracket arrow indicates the positions of the two
PS12-1 plasmid species which gave signals with both probes. The
positions of other plasmids are indicated by horizontal bars. The
reference plasmids of strain T-2 (pTSA [85 kb, IncP
] and pT2T [50
kb, unknown incompatibility group]) served as DNA molecular size
markers and as controls for probe specificity in Southern experiments.
In addition, the positions of the slots containing chromosomal (C) and
nicked chromosomal (NC) DNAs are indicated. Excess blank lanes between
the PS12 and T-2 samples were digitally removed with Photoshop software
(Adobe).
Plasmids of the IncP incompatibility group often carry catabolic genes.
In order to determine if strain PS12 contains an IncP plasmid and to
classify it, PCR was carried out on PS12 total DNA and reference
plasmids RP4 (IncP
) (10) and R751 (IncP
) (26) by using as templates the previously described
conserved primers prSTB59 and prSTB60 (forward,
cgaaattcrtrtgggagaagta; reverse, cgyttgcaatgcaccaggtc); prSTB61 and
prSTB62 (forward, atgaagaaacggctnaccga; reverse,
ttcctgtttyytcttggcgtc), and prSTB63 and prSTB64 (forward,
cagcctcgcagagcaggat; reverse, cagccgggcaggataggtgaagt) (18), which are based on replicon-specific DNA regions
(trfA2, korA, and oriT). Pairwise
sequence alignments (data not shown) of all three PS12-derived PCR
products showed higher similarities to the corresponding sequences of
IncP
plasmid R751 (90, 90, and 91% nucleotide sequence identity,
respectively) than to those of IncP
plasmid RP4 (85, 77, and 70%
nucleotide sequence identity, respectively).
The PFGE Southern blot membrane, after removal of tecA1, was
reprobed under stringent conditions with the IncP
-specific
trfA2 probe. The probe hybridized strongly with the positive
control (85-kbp plasmid pTSA) and with both forms of plasmid pPS12-1
(Fig. 1D), indicating that the plasmid on which the tec
genes reside belongs to the IncP
subgroup.
A PCR strategy was used to analyze the genetic organization flanking the previously described 5.5-kb gene cluster of Burkholderia sp. strain PS12 containing the tecA genes, an open reading frame (ORF) encoding a putative protein with similarity to the TodF hydrolase and another ORF for a truncated TecB dehydrogenase (5). Oligonucleotide primers were designed on the basis of known sequences from strain PS12 (5) and Pseudomonas sp. strain P51 (40, 41, 43, 44). The sizes of fragments obtained by PCR with genomic DNA from PS12 as the template (Fig. 2B) suggest an organization in the vicinity of the tec genes similar to that of transposon Tn5280 (43) (Fig. 2C). This transposon (Fig. 2A) harbors the genes encoding TcbA chlorobenzene dioxygenase and TcbB dehydrogenase of strain P51 (42, 44) in the vicinity of the chlorocatechol degradation genes (40) and a LysR-type regulator gene (41). Our experiments indicated that an entire tecB gene is located downstream of the tecA chlorobenzene dioxygenase genes. The distance between tecB and the end of a putative insertion element is approximately 0.4 kb more than was found in strain P51. This suggested the presence of a full-length version of a catechol 2,3-dioxygenase gene, in contrast to the structure in strain P51, which has only a gene remnant. Also, a complete tlpF hydrolase homologue was found upstream of the tecA genes, in contrast to the remnant found in strain P51.
|
Biochemical analysis of the products of the tcb flanking regions in strain P51 was not possible due to the deleted sequences. However, the presence of complete flanking sequences in strain PS12 (Fig. 2C) permitted such studies to assess evolutionary relationships among strains PS12, P51, and F1.
The TecB dehydrogenase located downstream of the tecA gene and encoded on plasmid pCR12 (Table 1) has been shown to be active against several cis-chlorobenzene dihydrodiols (unpublished data). Downstream of the tecB gene is a 0.9-kb sequence which exhibits high similarity (82%) to the todE catechol 2,3-dioxygenase gene of P. putida F1 (45). This tlpE* (TodE-like protein E) pseudogene is, however, inactive, and the putative functional gene has apparently been inactivated by mutations introducing one frameshift and two premature translational stops. In order to determine whether corrections of these three defects would result in a functional dioxygenase, we repaired them with equivalent sequences from the todE gene by three successive rounds of splicing by overlap extension-PCR (25) using pCR12 as the template and appropriate overlapping oligonucleotide primers prSTB116 and prSTB118 (forward, gaaggagagacaacatgagcattcaaagg [the tlpE* start codon is in boldface]; reverse, ctgaccgatagccgccaggtgcgcg [the codon for Trp that replaces the tlpE* stop codon is in boldface]), prSTB117 and prSTB120 (forward, ccggatcgactcgcgcacctggcggctatc [with the tlpE* stop codon replaced with a codon for Trp [boldface]); reverse, gccgaacgggtccgtacaggaaataag [with the tlpE* frameshift cgct replaced with cg-t [boldface]); prSTB119 and prSTB122 (forward, gggcttatttcctgtacggacccgttc [with the tlpE* frameshift agcg replaced with a-cg [boldface]; reverse, cccagcccttggtatagaaggcgag with the tlpE* stop codon replaced with a codon for Tyr [boldface]); and prSTB121 and prSTB123 (forward, cagcgctcgccttctataccaaggggc [with the tlpE* stop codon replaced with a codon for Tyr [boldface]; reverse, tcatgcgggcggctggaacttgtgc [with the tlpE* stop codon [boldface]), containing the corresponding todE wild-type sequences of strain F1. Gel-purified PCR products served as megaprimers in the subsequent amplification reactions. The resulting refunctionalized catechol 2,3-dioxygenase gene, designated tlpE (TodE-like protein E), was subsequently cloned into pCR2.1 to produce plasmid pCR18 and subcloned into pBluescript II KS(+) to produce plasmid pSTE56.
|
The polypeptide sequences of the refunctionalized TlpE catechol 2,3-dioxygenase and the TodE enzyme exhibited 83% identity and clustered phylogenetically with meta-cleavage enzymes preferring polycyclic aromatic substrates (14). Comparison of the polypeptide sequence with the sequence (24) of the corresponding structure-solved BphC enzyme (14, 19) from Burkholderia sp. strain LB400 (6) revealed that all residues that are iron ligands or play a structural and direct catalytic role (Fig. 3A) are conserved.
|
Cell extracts of Escherichia coli DH5
(pSTE56) cultures
grown overnight in Luria-Bertani medium
(36) containing 0.1-mg/ml ampicillin and 1.0 mM
isopropyl-
-D-thiogalactopyranoside were prepared as
previously described, and the protein concentration was
determined (7). Enzyme activities were assayed
spectrophotometrically by monitoring the product formation
from catechol (2-hydroxymuconic semialdehyde [2HMSA];
375 = 36 mM
1 cm
1),
3-methylcatechol (2-hydroxy-6-oxohepta-2,4-dienoate [HOHDA];
388 = 16.8 mM
1 cm
1), or
2,3-dihydroxybiphenyl (2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate [HOPDA];
434 = 13.2 mM
1
cm
1) (15, 35), respectively, in phosphate
buffer (50 mM, pH 7.5).
Refunctionalized TlpE* catechol 2,3-dioxygenase was able to oxidize
catechol, 3-methylcatechol, and 2,3-dihydroxybiphenyl to products with
the expected absorption maxima at 376, 388, and 436 nm, respectively.
The highest Vmax was obtained with
3-methylcatechol (1,200 ± 60 µM min
1
g
1), followed by catechol (715 ± 16 µM
min
1 g
1) and 2,3-dihydroxybiphenyl
(365 ± 38 µM min
1 g
1), which is the
same order found with the TodE of strain F1 (23). However,
TlpE dioxygenase shows the highest substrate preference, expressed by
the relative specificity constant
Vmax/Km (16), for 2,3-dihydroxybiphenyl (given as 100), followed by 3-methylcatechol (65) and catechol (0.6), which reflects the low
Km values for 3-methylcatechol (1 ± 0.2 µM) and especially 2,3-dihydroxybiphenyl (0.2 ± 0.1 µM)
compared to catechol (57 ± 4 µM). As high concentrations of
3-methylcatechol inhibited the TlpE enzyme, a substrate inhibition model (1, 22) was used to calculate the kinetic parameters of 3-methylcatechol oxidation. The inhibition constant
Kss was determined to be 130 ± 25 µM.
Transformation of 3-chlorocatechol by the TlpE dioxygenase was not
observed, although 67 nM 3-chlorocatechol reduced the initial oxidation
rate of 50 µM catechol by 50% and 1 µM 3-chlorocatechol completely
abolished catechol transformation (4, 28). This inhibition
indicates that its original role was in the metabolism of
methylbenzenes rather than chlorobenzenes.
An ORF identified upstream of the tecA gene had high similarity, with 87 and 89% identity on the nucleotide and polypeptide levels, respectively (5), to the todF gene from P. putida F1 (30). This gene, designated tlpF, is very similar to the corresponding meta-cleavage pathway gene fragment found in Pseudomonas sp. strain P51 (99.5% similarity in 201 nucleotides) (44). Pairwise sequence comparison with other bacterial hydrolases involved in the degradation of aromatic compounds and a human serine hydrolase indicates that the TlpF hydrolase belongs to the group of serine hydrolases involved in the meta-cleavage pathway for mononuclear aromatics (Fig. 3B).
Functional expression of the recombinant TlpF HOHDA hydrolase in
E. coli DH5
was shown by the conversion of 2HMSA, HOHDA, and HOPDA in reaction mixtures containing an extract of E. coli DH5
(pSTE3) cells prepared as described above for E. coli DH5
(pSTE56) cells. The meta-cleavage
products which were used as TlpF substrates were produced from
catechol, 3-methylcatechol, and 2,3-dihydroxybiphenyl by transformation
of 1 mM solutions in phosphate buffer with E. coli
DH5
(pSTE56) cells grown and washed as described above and resuspended to an A600 of 10.
The highest Vmax was obtained with HOHDA
(3,350 ± 250 µM min
1
g
1), followed by 2HMSA (800 ± 40 µM
min
1 g
1), which is the same order
found with the 2-hydroxymuconic semialdehyde hydrolase from TOL plasmid
pWW0 of P. putida mt-2 (13). The Km values were 4.4 ± 1.1 and 70 ± 5 µM, respectively. Hydrolysis of HOPDA (<5 µM min
1
g
1) was too low for kinetic analysis. In contrast to the
substrate preference observed with TlpE dioxygenase, Tlp hydrolase
prefers the monocyclic aromatic-derived substrates. Therefore, both
sequence analysis and biochemical properties show that the TodF and
TlpF proteins cluster with hydrolases involved in the degradation of monocyclic aromatics, whereas the TodE and TlpE enzymes cluster with
dioxygenases involved in the degradation of bicyclic aromatics. If
polycyclic aromatics that transform enzymes have evolved from those
that oxidize monocyclic aromatics, as suggested by Harayama and Rekik
(20), the TodF and TlpF hydrolases may be evolutionarily older than the TodE and TlpE dioxygenases. The tod operon
itself may thus be a mosaic of genes derived from different pathways for mono- and bicyclic substrates.
In summary, both primary structure analysis and biochemical data
strongly suggest that the tec and tcb
chlorobenzene degradation genes are closely related and that they
diverged rather recently. They seem to have their common origin in the
tod genes (or a common precursor) of the toluene degradation
pathway and have adapted for efficient chlorobenzene transformation.
The flanking evolutionary gene relics are most likely descendants of
the corresponding todE and todF genes.
Characterization of these evolutionary relics revealed different
mutational events
deletions in the case of P51 and point mutations
leading to a frameshift and the introduction of stop codons in the case
of PS12
having caused inactivation of the meta-cleavage
genes disadvantageous for chlorobenzene degradation during subsequent
divergence of the two strains.
Nucleotide sequence accession numbers.
The new nucleotide
sequences presented here have been deposited in the
GenBank database under accession no. AF073901
(trfA2), AF073902 (korA), and AF073903
(oriT) for the IncP
-specific sequences of plasmid
pPS12-1.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by contract BIO4-CT972040 of the BIOTECH program of the EC. K.N.T. expresses gratitude to the Fonds der Chemischen Industrie for generous support.
We thank E. R. B. Moore and his group for generous sequencing support and F. Junker for valuable suggestions concerning PFGE and for providing E. coli(RP4), E. coli(R751), and C. testosteroni T-2 cells. The assistance of I. Plumeier in this work is greatly appreciated. 3,4,6-Trichlorocatechol was kindly provided by H.-A. Arfmann. We are indebted to J. Armengaud and M. W. Klemba for helpful discussions and for critical reading of the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Bereich Mikrobiologie, AG Biodegradation, Gesellschaft für Biotechnologische Forschung mbH, Mascheroder Weg 1, D-38124 Braunschweig, Germany. Phone: 49/(0)5 31/61 81-4 67. Fax: 49/(0)5 31/61 81-4 11. E-mail: dpi{at}gbf.de.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Adams, R. H.,
C. M. Huang,
F. K. Higson,
V. Brenner, and D. D. Focht.
1992.
Construction of a 3-chlorobiphenyl-utilizing recombinant from an intergeneric mating.
Appl. Environ. Microbiol.
58:647-654 |
| 2. | Ahmad, D., J. Fraser, M. Sylvestre, A. Larose, A. Khan, J. Bergeron, J. M. Juteau, and M. Sondossi. 1995. Sequence of the bphD gene encoding 2-hydroxy-6-oxo-(phenyl/chlorophenyl)hexa-2,4-dienoic acid (HOP/cPDA) hydrolase involved in the biphenyl/polychlorinated biphenyl degradation pathway in Comamonas testosteroni: evidence suggesting involvement of Ser112 in catalytic activity. Gene 156:69-74[Medline]. |
| 3. | Arand, M., D. F. Grant, J. K. Beetham, T. Friedberg, F. Oesch, and B. D. Hammock. 1994. Sequence similarity of mammalian epoxide hydrolases to the bacterial haloalkane dehalogenase and other related proteins. Implication for the potential catalytic mechanism of enzymatic epoxide hydrolysis. FEBS Lett. 338:251-256[Medline]. |
| 4. |
Bartels, A.,
H. J. Knackmuss, and W. Reineke.
1984.
Suicide inactivation of catechol-2,3-dioxygenase from Pseudomonas putida mt-2 by 3-chlorocatechols.
Appl. Environ. Microbiol.
47:500-505 |
| 5. | Beil, S., B. Happe, K. N. Timmis, and D. H. Pieper. 1997. Genetic and biochemical characterization of the broad spectrum chlorobenzene dioxygenase from Burkholderia sp. strain PS12: dechlorination of 1,2,4,5-tetrachlorobenzene. Eur. J. Biochem. 247:190-199[Medline]. |
| 6. | Bopp, L. H. 1986. Degradation of highly chlorinated PCBs by Pseudomonas sp. strain LB400. J. Ind. Microbiol. 1:23-29. |
| 7. | Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[Medline]. |
| 8. | Brady, L., A. M. Brzozowski, Z. S. Derewenda, E. Dodson, G. Dodson, S. Tolley, J. P. Turkenburg, L. Christiansen, B. Huge-Jensen, L. Norskov, L. Thim, and U. Menge. 1990. A serine protease triad forms the catalytic centre of a triacylglycerol lipase. Nature 343:767-770[Medline]. |
| 9. | Clowes, R. C., and W. Hayes. 1968. Experiments in microbial genetics. Blackwell Scientific Publications, Ltd., Oxford, England. |
| 10. |
Datta, N.,
R. W. Hedges,
E. J. Shaw,
R. B. Sykes, and M. H. Richmond.
1971.
Properties of an R factor from Pseudomonas aeruginosa.
J. Bacteriol.
108:1244-1249 |
| 11. | Derewenda, Z. S., and A. M. Sharp. 1993. News from the interface: the molecular structures of triacylglyceride lipases. Trends. Biochem. Sci. 18:20-25[Medline]. |
| 12. |
Diaz, E., and K. N. Timmis.
1995.
Identification of functional residues in a 2-hydroxymuconic semialdehyde hydrolase. A new member of the alpha/beta hydrolase-fold family of enzymes which cleaves carbon-carbon bonds.
J. Biol. Chem.
270:6403-6411 |
| 13. | Duggleby, C. J., and P. A. Williams. 1986. Purification and some properties of the 2-hydroxy-6-oxohepta-2,4-dienoate hydrolase (2-hydroxymuconic semialdehyde hydrolase) encoded by the TOL plasmid pWW0 from Pseudomonas putida mt-2. J. Gen. Microbiol. 132:717-726. |
| 14. |
Eltis, L. D., and J. T. Bolin.
1996.
Evolutionary relationships among extradiol dioxygenases.
J. Bacteriol.
178:5930-5937 |
| 15. |
Eltis, L. D.,
H.-J. Hofmann,
H. Hecht,
H. Lünsdorf, and K. N. Timmis.
1993.
Purification and crystallization of 2,3-dihydroxybiphenyl 1,2-dioxygenase.
J. Biol. Chem.
268:2727-2732 |
| 16. | Fersht, A. 1985. The basic equations of enzyme kinetics, p. 99-116. In A. Fersht (ed.), Enzyme structure and mechanism. W. C. Freeman & Co., San Francisco, Calif. |
| 17. | Gibson, D. T., and V. Subramanian. 1984. Microbial degradation of aromatic hydrocarbons, p. 181-252. In D. T. Gibson (ed.), Microbial degradation of organic compounds. Marcel Dekker, Inc., New York, N.Y. |
| 18. | Götz, A., R. Pukall, E. Smit, E. Tietze, R. Prager, H. Tschäpe, J. D. van Elsas, and K. Small. 1996. Detection and characterization of broad-host-range plasmids in environmental bacteria by PCR. Appl. Environ. Microbiol. 62:2621-2628[Abstract]. |
| 19. |
Han, S.,
L. D. Eltis,
K. N. Timmis,
S. W. Muchmore, and J. T. Bolin.
1995.
Crystal structure of the biphenyl-cleaving extradiol dioxygenase from a PCB-degrading pseudomonad.
Science
270:976-980 |
| 20. |
Harayama, S., and M. Rekik.
1989.
Bacterial aromatic ring-cleavage enzymes are classified into two different gene families.
J. Biol. Chem.
264:15328-15333 |
| 21. | Harayama, S., and K. N. Timmis. 1989. Catabolism of aromatic hydrocarbons by Pseudomonas, p. 151-174. In D. A. Hopwood, and K. Charter (ed.), Genetics of bacterial diversity. Academic Press, Inc., New York, N.Y. |
| 22. |
Higson, F. K., and D. D. Focht.
1989.
Bacterial metabolism of hydroxylated biphenyls.
Appl. Environ. Microbiol.
55:946-952 |
| 23. | Hirose, J., N. Kimura, A. Suyama, A. Kobayashi, S. Hayashida, and K. Furukawa. 1994. Functional and structural relationship of various extradiol aromatic ring-cleavage dioxygenases of Pseudomonas origin. FEMS Microbiol. Lett. 118:273-277[Medline]. |
| 24. | Hofer, B., L. D. Eltis, D. N. Dowling, and K. N. Timmis. 1993. Genetic analysis of a Pseudomonas locus encoding a pathway for biphenyl/polychlorinated biphenyl degradation. Gene 130:47-55[Medline]. |
| 25. | Horton, R. M. 1995. PCR-mediated recombination and mutagenesis. SOEing together tailor-made genes. Mol. Biotechnol. 3:93-99[Medline]. |
| 26. |
Jobanputra, R. S., and N. Datta.
1974.
Trimethoprim R factors in enterobacteria from clinical specimens.
J. Med. Microbiol.
7:169-177 |
| 27. |
Kaschabek, S. R.,
T. Kasberg,
D. Müller,
A. E. Mars,
D. B. Janssen, and W. Reineke.
1998.
Degradation of chloroaromatics: purification and characterization of a novel type of chlorocatechol 2,3-dioxygenase of Pseudomonas putida GJ31.
J. Bacteriol.
180:296-302 |
| 28. |
Klecka, G. M., and D. T. Gibson.
1981.
Inhibition of catechol 2,3-dioxygenase from Pseudomonas putida by 3-chlorocatechol.
Appl. Environ. Microbiol.
41:1159-1165 |
| 29. | Lau, P. C., J. Garnon, D. Labbe, and Y. Wang. 1996. Location and sequence analysis of a 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase-encoding gene (bpdF) of the biphenyl/polychlorinated biphenyl degradation pathway in Rhodococcus sp. M5. Gene 171:53-57[Medline]. |
| 30. | Menn, F. M., G. J. Zylstra, and D. T. Gibson. 1991. Location and sequence of the todF gene encoding 2-hydroxy-6-oxohepta-2,4-dienoate hydrolase in Pseudomonas putida F1. Gene 104:91-94[Medline]. |
| 31. | Oltmanns, R. H., H. G. Rast, and W. Reineke. 1988. Degradation of 1,4-dichlorobenzene by enriched and constructed bacteria. Appl. Microbiol. Biotechnol. 28:609-616. |
| 32. | Reineke, W., and H.-J. Knackmuss. 1988. Microbial degradation of haloaromatics. Annu. Rev. Microbiol. 42:263-287[Medline]. |
| 33. | Ribbons, D. W., and R. W. Eaton. 1982. Chemical transformation of aromatic hydrocarbons that support the growth of microorganisms, p. 60-79. In A. M. Chakrabarty (ed.), Biodegradation and detoxification of environmental pollutants. CRC Press, Inc., Boca Raton, Fla. |
| 34. |
Rojo, F.,
D. H. Pieper,
K. H. Engesser,
H. J. Knackmuss, and K. N. Timmis.
1987.
Assemblage of ortho cleavage route for simultaneous degradation of chloro- and methylaromatics.
Science
238:1395-1398 |
| 35. | Sala-Trepat, J. M., and W. C. Evans. 1971. The meta cleavage of catechol by Azotobacter species. 4-Oxalcrotonate pathway. Eur. J. Biochem. 20:400-413[Medline]. |
| 36. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 37. |
Sander, P.,
R.-M. Wittich,
P. Fortnagel,
H. Wilkes, and W. Francke.
1991.
Degradation of 1,2,4-trichloro- and 1,2,4,5-tetrachlorobenzene by Pseudomonas strains.
Appl. Environ. Microbiol.
57:1430-1440 |
| 38. | Smith, C. L., P. E. Warburton, A. Gaal, and C. R. Cantor. 1986. Analysis of genome organization and rearrangements by pulsed field gradient gel electrophoresis, p. 45-70. In J. K. Setlow, and A. Hollaender (ed.), Genetic engineering, vol. 8. Plenum Publishing Corp., New York, N.Y. |
| 39. | Thurnheer, T., T. Köhler, A. M. Cook, and T. Leisinger. 1986. Orthanilic acid and analogues as carbon sources for bacteria: growth physiology and enzymatic desulphonation. J. Gen. Microbiol. 132:1215-1220. |
| 40. |
van der Meer, J. R.,
R. I. Eggen,
A. J. Zehnder, and W. M. de Vos.
1991.
Sequence analysis of the Pseudomonas sp. strain P51 tcb gene cluster, which encodes metabolism of chlorinated catechols: evidence for specialization of catechol 1,2-dioxygenases for chlorinated substrates.
J. Bacteriol.
173:2425-2434 |
| 41. |
van der Meer, J. R.,
A. C. Frijters,
J. H. Leveau,
R. I. Eggen,
A. J. Zehnder, and W. M. de Vos.
1991.
Characterization of the Pseudomonas sp. strain P51 gene tcbR, a LysR-type transcriptional activator of the tcbCDEF chlorocatechol oxidative operon, and analysis of the regulatory region.
J. Bacteriol.
173:3700-3708 |
| 42. |
van der Meer, J. R.,
A. R. van Neerven,
E. J. de Vries,
W. M. de Vos, and A. J. Zehnder.
1991.
Cloning and characterization of plasmid-encoded genes for the degradation of 1,2-dichloro-, 1,4-dichloro-, and 1,2,4-trichlorobenzene of Pseudomonas sp. strain P51.
J. Bacteriol.
173:6-15 |
| 43. |
van der Meer, J. R.,
A. J. Zehnder, and W. M. de Vos.
1991.
Identification of a novel composite transposable element, Tn5280, carrying chlorobenzene dioxygenase genes of Pseudomonas sp. strain P51.
J. Bacteriol.
173:7077-7083 |
| 44. |
Werlen, C.,
H. P. Kohler, and J. R. van der Meer.
1996.
The broad substrate chlorobenzene dioxygenase and cis-chlorobenzene dihydrodiol dehydrogenase of Pseudomonas sp. strain P51 are linked evolutionarily to the enzymes for benzene and toluene degradation.
J. Biol. Chem.
271:4009-4016 |
| 45. |
Zylstra, G. J., and D. T. Gibson.
1989.
Toluene degradation by Pseudomonas putida F1. Nucleotide sequence of the todC1C2BADE genes and their expression in Escherichia coli.
J. Biol. Chem.
264:14940-14946 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»