INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Alginate is a linear copolymer composed of -D-mannuronic acid (M) and its C-5 epimer, -L-guluronic acid (G). The M and G residues are organized in blocks of consecutive M residues (M blocks), consecutive G residues (G blocks), or alternating M and G (MG blocks), and the lengths and distributions of the different block types vary among alginates isolated from brown algae or from different bacteria belonging to the genera Azotobacter and Pseudomonas (36, 37). Alginates are the most abundant polysaccharides in brown algae (comprising up to 40% of the dry matter), and their functions are to supply strength and flexibility to the algal tissues (38). The bacterium Azotobacter vinelandii produces alginate both as a vegetative state capsule and as an integrated part of a particular resting stage form (cyst) of this organism (31). The opportunistic pathogen Pseudomonas aeruginosa produces alginate as a capsule-like exopolysaccharide during infection of the lungs of cystic fibrosis patients (12, 23). Alginates from brown algae and A. vinelandii have M, G, and MG blocks (29, 36, 37), while alginates from P. aeruginosa and other Pseudomonas species do not contain G blocks (34, 36). In contrast to the alginates produced by brown algae, bacterial alginates are partially O-acetylated at O-2 and/or O-3 on mannuronic acid residues (36).

The relative amount and distribution of G residues determine most of the physicochemical properties of the polymer. Alginates with G blocks can form gels by reversible cross-linking with divalent cations such as Ca²⁺, Ba²⁺, and Sr²⁺ (41), and the gelling and viscosifying properties of alginate are utilized in pharmaceutical, food, textile, and paper industries (26). In addition, alginate has a very interesting potential in a variety of biotechnological applications and in biomedicine. Alginate rich in M blocks stimulates cytokine production (27) and has a much higher antitumor activity than alginates with a high fraction of G blocks (14). G-rich alginates can be used for encapsulation of cells and enzymes (35), and Langerhans islets immobilized in alginates rich in G have been evaluated as a potential treatment for type 1 diabetes (39, 40).

Both in brown algae and in alginate-producing bacteria, the polymer is first synthesized as mannuronan, and the enzyme mannuronan C-5-epimerase catalyzes the epimerization of M to G at the polymer level (7, 12, 21, 22). Ertesvåg et al. (7) have previously reported the cloning and expression of five genes encoding a family of Ca²⁺-dependent epimerases in A. vinelandii (algE1 to -5). The deduced AlgE protein sequences consist of two types of structural modules, designated A (385 amino acids each; one or two copies) and R (155 amino acids each; one to seven copies), and each R module contains four to six nine-amino-acid-long repeated sequences corresponding to putative Ca²⁺-binding motifs. The molecular masses of AlgE1 to -5 vary from 57.7 (AlgE4) to 191 kDa (AlgE3), depending on the number of A and R modules in the proteins. Four of the epimerase genes are clustered in the chromosome (algE1 to -4), while algE5 is located in another part of the A. vinelandii genome. Nuclear magnetic resonance (NMR) spectroscopy analyses demonstrate that the reaction products at least of AlgE2 and AlgE4 differ with respect to sequence distributions of M and G residues. AlgE2 leads to formation of mainly G blocks, while AlgE4 forms predominantly alginates with MG blocks.

The A. vinelandii chromosome also encodes a Ca²⁺-independent mannuronan C-5-epimerase, designated AlgG (30). Sequence alignments demonstrate that algG does not belong to the algE gene family but shares 66% sequence identity to a mannuronan C-5-epimerase gene (also designated algG) from P. aeruginosa (12). The algG gene in P. aeruginosa is localized in a cluster of alg genes encoding enzymes involved in alginate biosynthesis, and sequence analysis of genomic DNA flanking algG in A. vinelandii suggests that this gene also is part of an alg gene cluster organized as in P. aeruginosa (30).

Southern blot analysis of genomic A. vinelandii DNA using the 5'-terminal 800 bp in the A sequence of algE2 as the probe (A probe) demonstrated that the chromosome probably encodes more A-like sequences than are present in algE1 to -5 (7). In this report, we show that the A. vinelandii genome encodes two additional mannuronan C-5-epimerase genes, designated algE6 and algE7, and also a third highly related gene apparently not encoding an active epimerase.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Bacterial strains, phages, and plasmids. Strains, phages, and plasmids are listed in Table 1.

Growth of bacteria and phages. A. vinelandii was grown at 30°C with shaking in nitrogen-free medium (9.8 mM K₂HPO₄-KH₂PO₄, 0.8 mM MgSO₄ · 7H₂O, 3.4 mM NaCl, 8.7 µM Na₂MoO₄ · 2H₂O, 54 µM FeSO₄ · 7H₂O, 1% sucrose). Escherichia coli cells were for most purposes grown in L broth or on L agar at 37°C (32). For all activity measurements, the cells were grown in threefold-concentrated L broth. When relevant, the E. coli media were supplemented with 0.2 mg of ampicillin per ml (unless otherwise stated). When the cells were to be used for growth of phages, the L broth was supplemented with 10 mM MgSO₄ and 0.2% maltose.

Standard recombinant DNA technology. Restriction endonuclease digestions, ligations, and agarose gel electrophoresis were performed in accordance with standard protocols (32). Transformations were performed as described by Chung et al. (2). Genomic DNA from A. vinelandii was isolated by using a genomic DNA kit from Qiagen. Plasmid isolations were performed by the use of a plasmid midi kit from Qiagen (for sequencing) or a Wizard miniprep kit from Promega. DNA sequencing was performed by using cycle sequencing with an Amply Taq kit on an Applied Biosystems model 373 automatic sequencer. The genes were sequenced on both strands by the Biotechnology Centre, University of Oslo, and at Medigene, Martinsried, Germany.

Screening of an A. vinelandii gene library and Southern blot analyses. An EMBL3 gene library prepared from A. vinelandii DNA (5) was plated on E. coli NM538 on L agar (32). The overlaying agar contained 0.7% agarose, 0.2% maltose, and 10 mM MgSO₄. A total of 6,000 phages were examined in the screening procedure. The Dig system (Biochemica, Boehringer Mannheim) was used to label the A probe (random-primed DNA labeling), and gene library screening and Southern blot analyses were performed as specified by the manufacturer.

Protein sequence comparisons and relationships. Protein alignments were done with the MACAW program (33), and phylogenetic analyses were done with the PHYLIP program package, version 3.5c (9). Protein distance matrices were calculated with the Protdist program, using a Dayhoff PAM matrix (4). The Fitch program rooted with AlgE7A was used to create the unrooted tree for the A modules, while the Neighbour program rooted with AlgE7R2 was used to create the unrooted tree for the R modules (11). The Drawgram program was used to plot the phenograms.

Cloning of algE6, algE7, algY, and the hybrid genes algE4-algY and algY-algE4 into expression vectors. The open reading frame encoding AlgE6 was cloned into pTrc99A by a two-step protocol. In step 1, the 1.0-kb 5' end of algE6 was PCR amplified from pBG18 (Fig. 1A). PCR primer 1 (5' GAAGCGGAGCCATGGATTACAACG 3') was constructed to change two of the bases proximal and upstream of the ATG start codon from AT to CC (underlined), introducing a new NcoI site. Primer 2 was a vector primer for pLITMUS28 (5' CGCCAGGGTTTTCCCAGTCACGAC 3' (New England Biolabs). The PCR fragment was then ligated into pTrc99A, generating pBG24. In step 2, a 1.8-kb DNA fragment from pBG28 containing the 3' part of algE6 was ligated into pBG24, generating pBG29.

View larger version (22K): [in this window] [in a new window]   FIG. 1.   Physical map of genomic A. vinelandii DNA showing the chromosomal locations of algE1 to -4, algE6 and algE7 (A), algY (B), and algE5 (C). The genes and their direction of transcription are indicated by filled arrows. The modular structure of the deduced AlgE6, AlgE7, and AlgY proteins are illustrated below the arrows. The inserts in the different plasmids and phages are presented as lines. Restriction sites: BglII (B), BsaWI (Bsa), BstEII (Bst), EcoRI (E), HindIII (H), KpnI (K), NcoI (N), SalI (S), and XmaI (X). For BsaWI, EcoRI, KpnI, XmaI (A), SalI (B), and BstEII (A and B), only the restriction sites used in the different cloning steps are shown (see Materials and Methods and Table 1). Note that only part of the insert in EP1 is shown.

Expression of AlgE6, AlgE7, AlgY, AlgE4-AlgY (encoded by pBG36) and AlgY-AlgE4 (encoded by pBG41) and preparation of crude extracts. One hundred milliliters of culture medium was inoculated to 1% from an overnight culture of strains SURE(pBG27), SURE(pBG29), SURE(pBG33), JM109(pBG36), and JM109(pBG41) in the same medium. The JM109(pBG36) medium was supplemented with 0.5 mg of ampicillin per ml due to some plasmid loss problems. After 3 h of incubation with shaking, the production of the corresponding enzymes was induced by adding isopropyl--D-thiogalactopyranoside (IPTG) at a concentration of 0.5 mM. The cells were harvested 3 to 4 h after induction, and the optical density at 600 nm was measured. The harvested cells were resuspended in 10 ml of MC buffer [20 mM 3-(N-morpholino)propanesulfonic acid (pH 6.9), 2.2 mM CaCl₂] and then disrupted by ultrasonication. The broken cells were centrifuged at 27,000 × g for 30 min, and the supernatants were filtered through a 0.2-µm-pore-size Millipore filter prior to activity measurements and partial purification by fast protein liquid chromatography (FPLC).

Measurements of epimerase activity by radioisotope assays. 5-³H-labeled alginate (specific activity, 144,330 dpm/mg of alginate, 95% mannuronic acid) was prepared by growing P. aeruginosa in a medium containing 5-³H-labeled glucose and used as substrate for the crude cell extracts in the radioisotope assays (30). Epimerase activities were measured in reaction mixtures (total volume of 0.6 ml) containing 0.1 mg of tritiated M-enriched alginate, 10 µl of cell extract, and MC buffer. Incubations were performed at 37°C for 1 h, and the reactions were terminated by adding 15 µl of 5 M NaCl and 0.8 ml of isopropanol. The alginate was precipitated at 80°C for 30 min and then centrifuged at 27,000 × g for 30 min. One milliliter of supernatant was used for determination of released ³H in a scintillation counter. All assays were performed in duplicate.

Partial purification of AlgE6, AlgE7, and AlgE4-AlgY by FPLC and measurements of epimerase activity by NMR spectroscopy. The filtered crude cell extracts were loaded onto a HiTrap Q Sepharose HP column (Pharmacia) equilibrated with MC buffer. The three enzymes were eluted with a 0 to 1 M NaCl gradient (in MC buffer). AlgE6 was eluted between 0.3 and 0.35 M NaCl, AlgE7 was eluted between 0.35 and 0.45 M NaCl, and AlgE4-AlgY was eluted between 0.37 and 0.42 M NaCl. The purification factors for AlgE6, AlgE7, and AlgE4-AlgY were 4.2, 9.2, and 14.5, respectively. The fractions with epimerase activity were used directly as a source of enzyme for incubation with alginate.

Nucleotide sequence accession numbers. The algE6, algE7, and algY nucleotide sequence data were deposited in the GenBank database under accession no. AF099799, AF099800, and AF099801, respectively.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Screening of an A. vinelandii gene library and Southern blot analyses of phage DNA. The A probe was used to screen a phage EMBL3 gene library prepared from A. vinelandii DNA. Forty reproducibly hybridizing plaques were identified, and DNA was prepared from each of the corresponding clones. The DNA preparations were digested with a series of restriction endonucleases selected on the basis of the known sequences of the regions containing algE1 to -5). Southern blot analyses of these digests (using the same probe as described above) indicated that 10 of the 40 clones contained A-hybridizing sequences not belonging to algE1 to -5. Further analyses of the 10 new clones showed that they originated from two separate regions of the A. vinelandii chromosome. One of these regions, represented by six phage clones, were found to be closely linked to the region from algE1 to -4. Further analyses of the DNA in these phages showed that one of them (EP35) covered all of the A-hybridizing signals represented by the group, and the insert in this phage was in addition found to cover algE4. The remaining four phages all overlapped and were found to contain only one A-homologous sequence. Phage EP1 was chosen for further studies of this group.

DNA sequencing and identification of three new putative epimerase genes. DNA fragments from the insert of phage EP35 were subcloned into the plasmid vector pLITMUS28, and the resulting recombinant plasmids were designated pBG5, pBG6, and pBG18 (Fig. 1A). DNA sequencing of parts of the inserts in these plasmids led to the identification of two new putative epimerase genes, designated algE6 and algE7. The 3' end of algE6 was found to lie only 276 bp upstream of algE4, while the 3' end of algE7 was found to lie about 5 kb upstream of the start of algE6.

Amino acid sequence analyses of the deduced proteins encoded by algE6, algE7, and algY. Inspection of the deduced amino acid sequences of AlgE6 and AlgE7 showed that the A module represented the amino-terminal part of the putative proteins and that the sequences also contained three repeats each of the sequences homologous to the R modules found in AlgE1 to -5 (Fig. 1A). This structure is thus new, since none of the proteins AlgE1 to -5 contain three R modules. A similar analysis of AlgY revealed that the modular structure of this putative protein is AR, as in AlgE4 (Fig. 1B). Alignment of the sequences of the A modules of the three putative proteins (Fig. 2) showed that the percentages of homology were 64 (AlgE6-AlgE7), 65 (AlgE6-AlgY), and 63 (AlgE7-AlgY). Based on this alignment, we constructed a consensus sequence, ConA*, and aligned it against the previously reported consensus sequence (ConA) of the A modules in AlgE1 to -5. The percentage of homology between the two sequences is 72, suggesting that all A sequences have a common evolutionary origin. However, closer inspection of the alignments showed that some local regions were not very similar to those previously reported. This point is most clearly seen for the 11 amino acids double underlined in Fig. 2 (amino acids 117 to 127 in the ConA sequence). All of these residues are 100% conserved in the A modules of AlgE1 to -5 (7). The AlgE6 sequence deviates by only one residue (isoleucine to alanine) from this sequence, but in AlgE7 and AlgY five and seven, respectively, of the residues are different. Three of these nonconserved amino acids are identical in AlgE7 and AlgY (residues 121 to 123 in the ConA sequence). Similarly, amino acids 92 to 102 in ConA are all identical in AlgE1 to -5, and two of these residues are different in AlgE6 (single underlining in Fig. 2). In AlgE7 and AlgY, on the other hand, 6 of the 11 residues are different. Two of these nonconserved amino acids (residues 98 and 99) are identical in AlgE7A and AlgYA, where a serine and an asparagine are replaced with a histidine and an aspartic acid, respectively.

View larger version (61K): [in this window] [in a new window]   FIG. 2.   Alignment of the A modules in AlgE6, AlgE7, and AlgY. The ConA* sequence represents the consensus sequence (more than 50% identity) derived from AlgE6A, AlgE7A, and AlgYA; the ConA sequence represents the consensus sequence (more than 50% identity) derived from the A modules in AlgE1 to -5. Open spaces indicate no identity, and dashes indicate gaps. Single dots indicate that the corresponding amino acid is the same as in ConA*, while double dots represent amino acid identity between ConA* and ConA. Each number to the right indicates the position (relative to the N-terminal end of the deduced protein) of the terminal residue in that line.

View larger version (47K): [in this window] [in a new window]   FIG. 3.   Alignment of the R modules in AlgE6, AlgE7, and AlgY. Notation is as in Fig. 2 except that open spaces indicate 50% identity or less. The vertical lines at the top indicate the start of each nonameric putative Ca2+-binding motif, while the broken vertical lines near the termini represent the end of the R modules (left) and the start of the S motifs (right). The S motif refers to the extra terminal amino acids in AlgE6, AlgE7, and AlgY, which are not a formal part of the R modules in the proteins (7). The ConS* sequence represents the consensus sequence (50% identity or more) derived from the S motifs in AlgE6A, AlgE7A and AlgYA; the ConS sequence represents the consensus sequence (more than 50% identity) derived from AlgE1S to -E5S.

View larger version (17K): [in this window] [in a new window]   FIG. 4.   Phenograms constructed on the basis of alignments of the A modules in AlgE1 to -7 and AlgY (A) and the R modules in AlgE1 to -7 and AlgY (B). The A and R modules in AlgE6, AlgE7, and AlgY are underlined.

Expression analyses and measurements of epimerase activities. Some of the bases 5' to the putative start ATG of algE6, algE7, and algY were substituted in order to generate NcoI restriction endonuclease sites facilitating insertion of the genes at the ATG start site of the expression vector pTrc99A. The corresponding plasmids, designated pBG29 (algE6), pBG27 (algE7), and pBG33 (algY), were then transformed into E. coli SURE, and cultures of the corresponding transformants were used for analyses of epimerase expression from the trc promoter. The results of these experiments showed that IPTG-induced cells containing pBG29 and pBG27 expressed activities consistent with the expression of mannuronan C-5-epimerases. However, no activity was detected in extracts prepared from cells containing pBG33 (Table 2). This latter result was quite surprising since it is the only example among eight of a gene containing A and R modules that do not express epimerase activity in E. coli.

Analysis of reaction products by NMR spectroscopy. The recombinant proteins expressed by plasmids pBG29 (AlgE6), pBG27 (AlgE7), and pBG36 (active AlgE4-AlgY hybrid) were partially purified by FPLC and incubated with M-rich alginate, and the reaction products were finally analyzed by NMR spectroscopy. The data confirmed that AlgE6 is an epimerase and that it introduces G blocks into its substrate (Fig. 5 and Table 3). This enzyme is therefore functionally related to AlgE2 (7). The NMR data show that within 18 h the M-rich substrate, initially devoid of G blocks, is converted to a polymer with an average number of G residues in the G blocks, N_G > 1  15. This finding signifies a polymer with high cooperative binding capacity for calcium ions, and with a predicted strong gel-forming capacity.

View larger version (19K): [in this window] [in a new window]   FIG. 5.   1H NMR spectroscopy monitoring the action of AlgE6 on an alginate with molar fractions of 0.95 and 0 for M and GG, respectively. The samples were incubated for 5, 10, and 18 h, and the spectra were recorded at 90°C on a Bruker Avance DPX 300 MHz instrument. The samples contained 10 mg of alginate per ml in D2O at pH 6.8.

View larger version (17K): [in this window] [in a new window]   FIG. 6.   1H NMR spectrum of alginate epimerized by AlgE7 (same alginate substrate as in Fig. 5). In the spectrum, G, M, Gred, Mred, and denote internal G residues, internal M residues, reducing G and M residues and 4-deoxy-L-erythro-hex-4-enepyranosyluronate residues, respectively; each numbers refer to the position of the proton in the pyranosyl ring, and the nonunderlined M and G refer to the neighbor residues. The spectrum was recorded as explained in the legend to Fig. 5.

View larger version (8K): [in this window] [in a new window]   FIG. 7.   1H NMR spectrum of alginate epimerized by the AlgE4-AlgY hybrid (same alginate substrate as in Fig. 5). The spectrum was recorded as explained in the legend to Fig. 5.

Southern blot analyses of genomic A. vinelandii DNA. Since all known algE-type epimerase genes have now been sequenced, we were able to carry out a Southern blot analysis to see if all hybridizing signals could be assigned to algE1 to -7 or algY. Genomic A. vinelandii DNA was digested with BglII, NcoI, and HindIII (or combinations thereof) and subjected to Southern blot analysis using the A fragment as a probe (Fig. 8). All of the hybridization signals obtained in this analysis could be explained by the predicted hybridizing fragments shown in Fig. 1. These results therefore indicate that all algE-type genes present in the A. vinelandii genome have now been identified (see also Discussion).

View larger version (71K): [in this window] [in a new window]   FIG. 8.   Southern blot analysis of genomic A. vinelandii DNA hybridized against the A probe. The DNA was digested with BglII (lane 1), BglII-NcoI (lane 2), NcoI (lane 3), BglII-HindII (lane 4), and NcoI-HindIII (lane 5). Numbers on the left represent a -HindIII standard (in kilobases). Sizes of the hybridizing DNA fragments should be compared to those predicted in Fig. 1. Note that the signal intensities are strongly influenced by the number of A modules in a given fragment and by the extent of homology to the probe.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

The A. vinelandii algE gene family represents an unusually complex system with respect to both gene structure and functional role, at least for a prokaryotic organism. Multicopy genes (20, 24, 42, 44) and proteins with repeated homologous sequences (10, 16, 25, 43) have previously been reported for some bacteria, but a chromosomal arrangement combining these elements as in the epimerase gene family appears to be rather unique. The reason why A. vinelandii has evolved at least seven structurally and functionally related genes to control the structure of its alginates is not fully understood. However, it seems very likely that the existence of these genes is strongly related to the ability of A. vinelandii to form metabolically dormant cysts, in which alginates of different structures presumably play a crucial role. In the cyst stage, the modified vegetative cells are surrounded by a capsule consisting of a thin outer layer (exine) and a thicker inner layer (intine). Alginates account for 40 and 72% of the exine and intine carbohydrates, respectively, and while the intine material resembles the alginates in the vegetative cell capsule (mostly MM and MG blocks; M/G ratio = 1.8), the alginates in the exine layer are richer in polyguluronic acid (M/G ratio = 0.45), and 42% of the diads are GG (28). If the predicted role of the epimerase system in cyst formation is correct, it also implies that the epimerase gene family can probably be seen as important components in a microbial differentiation process, analogous to the extensively studied spore formation in other bacteria.

If the above hypothesis is correct, it seems probable that each epimerase catalyzes the formation of alginates with different physical properties, as was previously shown for AlgE2 (G-block formation) and AlgE4 (MG-block formation). The NMR analyses of the AlgE6 product indicate that this enzyme is functionally related to AlgE2, but this does not necessarily mean that their reaction products are structurally or functionally equivalent. It could, for instance, be that the lengths of the G blocks and the spacing between them are different, and such differences might affect the properties of the corresponding alginates significantly. In fact, currently available data indicate that AlgE6 is capable of forming alginates with G blocks longer than those formed by AlgE2. It is well established in the literature that the alginate gel strength increases with increasing G-block length (38, 41), and the observations described above therefore also may be significant with respect to the use of in vitro-epimerized alginates in industry and biotechnology.

Interestingly, AlgE7 displays both epimerase and lyase activities. Gacesa (15) has proposed that the reaction mechanisms of these two types of enzymes are very similar. Both enzyme activities includes removal of the proton at C-5 in the uronic acid, but instead of replacing the C-5 proton in the final reaction step (epimerization), the lyase activity catalyzes a  elimination of the 4-O-glycosidic bond, producing unsaturated sugar derivatives at the nonreducing end. According to this proposal, it seems probable that the same active site is involved for both reactions with AlgE7. Whether the lyase reaction can be viewed as an abortive epimerization or as an epimerase-independent reaction is not clear. If the former is true, the apparent specificity for the G--G-M or G--M-M glycosidic linkage provides information about the direction of the epimerase action. A more thorough study of epimerase-lyase coupling is under way in our laboratory. The biological significance, if any, of the AlgE7 lyase activity is not known. It is possible, however, that cyst formation needs a fraction of shorter alginate oligomers and that AlgE7 contributes to this. A role in cyst germination also cannot be excluded.

The inability of algY to encode an active epimerase in E. coli was surprising, as all other enzymes belonging to this family are active after expression in this host. A Western blot analysis (antibody kindly provided by Hilde Kristin Høidal) showing that AlgY is produced in IPTG-induced E. coli cells excluded the possibility that the lack of activity is caused by some expression problems. The significance of this is unknown, but it could be that the enzyme is synthesized in an inactive form in E. coli, that it needs an unknown cofactor, or that it displays some activity other than epimerization. It could, for instance, be that it is a lyase with a substrate specificity not detected in our analyses. Concerning the latter hypothesis, it should be emphasized that some of the nonconserved amino acids are similar in AlgE7A and AlgYA. These particular residues are located in the N-terminal part of the enzyme, which when exchanged with the corresponding part from AlgE4 leads to an active epimerase.

The Southern blot analysis of genomic A. vinelandii DNA indicated that the chromosome does not contain any other genes hybridizing to the A sequence. Recent experiments have shown that the A module is responsible for the epimerization reaction (8), and it is therefore likely that all active AlgE proteins encoded by A. vinelandii have now been identified. The epimerase genes appear to be localized in three separate physical locations, in which algE5 and algY are localized separately. Moreover, algE7 is separated by approximately 5 kb from the main block containing algE1 to -4 and algE6. All of the enzymes therefore clearly do not originate from the same transcript. An operon organization in the block of six genes seems also unlikely, since the length of the region (25 kb) and the spacing between the genes are larger than expected for an operon structure (Fig. 1A and reference 7). By combining transcriptional and Western blot analyses of A. vinelandii cell cultures prepared during vegetative growth and at different stages in the encystment process, it should be possible to approach these problems in the near future.