Previous Article | Next Article 
Journal of Bacteriology, May 1999, p. 3033-3038, Vol. 181, No. 10
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The A Modules of the Azotobacter vinelandii
Mannuronan-C-5-Epimerase AlgE1 Are Sufficient for both
Epimerization and Binding of Ca2+
Helga
Ertesvåg* and
Svein
Valla
UNIGEN Center for Molecular Biology and
Department of Biotechnology, Norwegian University of Technology and
Science, N-7489 Trondheim, Norway
Received 3 October 1998/Accepted 9 March 1999
 |
ABSTRACT |
The industrially important polysaccharide alginate is composed of
the two sugar monomers
-D-mannuronic acid (M) and its
epimer
-L-guluronic acid (G). In the bacterium
Azotobacter vinelandii, the G residues originate from
a polymer-level reaction catalyzed by one periplasmic and at least five
secreted mannuronan C-5-epimerases. The secreted enzymes
are composed of repeats of two protein modules designated A (385 amino
acids) and R (153 amino acids). The modular structure of one of the
epimerases, AlgE1, is
A1R1R2R3A2R4.
This enzyme has two catalytic sites for epimerization, each site
introducing a different G distribution pattern, and in this article we
report the DNA-level construction of a variety of truncated forms of the enzyme. Analyses of the properties of the corresponding proteins showed that an A module alone is sufficient for epimerization and that
A1 catalyzed the formation of contiguous stretches of G
residues in the polymer, while A2 introduces single G
residues. These differences are predicted to strongly affect the
physical and immunological properties of the reaction product. The
epimerization reaction is Ca2+ dependent, and direct
binding studies showed that both the A and R modules bind this cation.
The R modules appeared to reduce the Ca2+ concentration
needed for full activity and also stimulated the reaction rate
when positioned both N and C terminally.
 |
INTRODUCTION |
Alginate is an industrially
important polysaccharide which is manufactured from brown algae
(30). It is also produced by some species of the bacterial
genera Azotobacter and Pseudomonas (6,
12-14, 18). Its biosynthesis has been most extensively studied
in Pseudomonas aeruginosa due to the detrimental infections by alginate-producing strains of this species in the lungs of patients
suffering from cystic fibrosis (21). However, most of the
Azotobacter vinelandii biosynthetic genes have now been cloned and sequenced (4, 9, 19, 22, 23, 26).
The polysaccharide is composed of 1-4-linked
-D-mannuronic acid (M) and
-L-guluronic
acid (G), both of which are distributed nonrandomly. An alginate
molecule can be described as a mixture of blocks of different lengths
of consecutive M residues (M blocks) or G residues (G blocks) or of
alternating M and G residues (MG blocks). The amount and distribution
of G residues determine the gel-forming, water-binding, and immunogenic
properties of an alginate and also its solubility in acid (28,
30). The polymer is first synthesized as mannuronan, and the G
residues are introduced by the action of mannuronan
C-5-epimerases (17). This group of enzymes
thus determines most of the important properties of the alginate, and they can also be used to tailor alginate in vitro. Alginate is now being evaluated as a gel-forming agent for
encapsulation of cells for transplantation into humans (31).
This usage requires a homogeneous alginate with good gelling properties
(long G blocks) and without long stretches of M blocks, which could
stimulate the immune system (28). These demands may be most
easily met by using alginate epimerized in vitro.
A. vinelandii encodes both a periplasmic epimerase
(AlgG) (26) and a family of secreted epimerases
(AlgE) (7, 10, 32). The AlgE epimerases
are all composed of one or two copies of a 385-amino-acid module
(A module) and one to seven copies of a 153-amino-acid module (R
module). Even though the homology within each group of modules is quite
high, different epimerases introduce different G distribution
patterns (10, 11, 32). All the AlgE epimerases are
dependent on Ca2+ for activity, although the
Ca2+ concentration needed for optimal activity is not the
same for different epimerases (9). Based on sequence
similarities to other enzymes, it has been proposed that the A modules
are responsible for binding of the alginate and thus probably contain
the catalytic site as well (15). The R modules are
homologous to the C-terminal part of a group of secreted proteins which
are exported by a C-terminal signal sequence and contain four to six
repeats of a nine-amino-acid motif shown to bind Ca2+ in
other proteins (2, 7). Thus the R modules probably bind Ca2+ and perhaps also participate in the secretion of the
enzymes. Since all epimerases contain at least one R module C
terminal to each A module, it has been thought that an A module with a downstream R module constitutes the minimal epimerase.
AlgE1 is the second most complex epimerase in that it contains
two A modules and four R modules (Fig.
1). We have previously reported
that this epimerase can be divided into two catalytically active parts: AlgE1-1, comprising the amino-terminal A module and the following three R modules, and AlgE1-2, comprising the second A module and the C-terminal R module (11). This
earlier study further showed that AlgE1-1 predominantly introduced G
blocks while AlgE1-2 introduced mainly MG blocks. The reaction rate of AlgE1-1 was found to be low compared to those of AlgE1-2 and the native
enzyme. In order to study the contribution of A and R modules to the
epimerization rate, epimerization pattern, and calcium dependence of
the epimerase, we have expressed several new truncated forms of
algE1.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1.
The modular structure of AlgE1. The restriction map of
the A. vinelandii DNA used in this study is shown at the
top. Only the Sau3AI site actually used is shown. The three
3' restriction sites originate from the vector. The epimerases
used in the study are shown below as solid lines with the plasmids
encoding them indicated at the left. The amino acids shown are those
encoded by vector DNA (underlined) or the preceding or succeeding
module.
|
|
 |
MATERIALS AND METHODS |
Standard techniques.
Escherichia coli JM109
(33) was grown at 37°C in L broth or L agar. Plasmid
isolation, enzymatic manipulations of DNA, and gel electrophoresis were
performed according to the methods of Sambrook et al. (27).
Transformations were performed as described by Chung et al.
(5). The construction of the plasmids is described in Table
1 and shown in Fig. 1. The primers used
for creating an in-frame stop codon at the 3' end of the sequence
encoding the A2 module were 5'
AGCGGATAACAATTTCACACAGGA 3', which binds to the vector upstream
of algE1, and 5'
CTCAAGCTTAGTCGGTCCCCTGCGG 3' (the
HindIII site is shown in boldface, and the bases
complementary to the UAA stop are underlined). Protein concentrations
were measured by the Bio-Rad Coomassie brilliant blue-based assay,
using bovine serum albumin as a standard.
Preparation of enzyme extracts.
E. coli JM109
containing the plasmid of interest was grown overnight in 3× L broth
(30 g of tryptone, 15 g of yeast extract, and 5 g of NaCl per
liter) supplemented with 100 µg of ampicillin/ml. The culture was
diluted 1:100 in the same, prewarmed medium and grown for 3 h
before being induced by IPTG
(isopropyl-
-D-thiogalactopyranoside; final
concentration, 0.5 mM). The cells were harvested by centrifugation after another 4 h, resuspended in one-tenth volume in 50 mM MOPS (3-[N-morpholino]propanesulfonic acid [pH 6.9])
containing 5 mM CaCl2, and disrupted by sonication. The
cell debris was removed by centrifugation at 10,000 × g for 30 min and filtration of the supernatant through a
0.2-µm-pore-size filter. The epimerases were then partially
purified by using a Pharmacia HiTrapQ ion-exchange column with 50 mM
MOPS (pH 6.9) containing 1 mM CaCl2 and a 0 to 1 M NaCl gradient.
Measurements of epimerase activity by radioisotope
assay.
Epimerase activities were quantified by measuring the
liberation of tritium from [5-3H]alginate to water as
described previously (29). Epimerase, 50 mM MOPS (pH 6.9),
and CaCl2 (final concentration, 3 mM unless otherwise
stated) were mixed in a total volume of 550 µl and prewarmed at
37°C for 30 min. Then, 50 µl of prewarmed
[5-3H]alginate from P. aeruginosa (2 mg/ml in
H2O; specific activity, 100,000 dpm/mg) (26) was
added, and the mixtures were incubated at 37°C. The alginate was
precipitated by adding 15 µl of NaCl and 800 µl of isopropanol and
was incubated at
50°C for at least 15 min. After centrifugation for
30 min, the activity in 1 ml of the supernatant was determined in a
liquid scintillation counter. All measurements were performed in
duplicate, and the results were confirmed by at least one independent
experiment. Since the activities of AlgE1 and truncated forms of AlgE1
are constant for more than 30 h at 37°C (8), the low
activity of some of the enzymes was compensated for by increasing the
incubation time in order to obtain counts between 1,000 and 2,000 dpm.
When the Ca2+ requirements were measured, the analyses were
complicated by the fact that as the amounts of G and especially G
blocks increase, the substrate will bind more divalent cations, thus
possibly diminishing the amount of Ca2+ available to the
enzyme. To minimize this effect the reactions were stopped when the
degree of epimerization was less than 20%.
Measurements of G distribution pattern by NMR spectroscopy.
Epimerase, 50 mM MOPS (pH 6.9), CaCl2 (final
concentration, 3 mM), and 7.5 mg of alginate (degree of epimerization
[FG], <0.04) (prepared from P. aeruginosa as
described previously [26]) were mixed in a total
volume of 6 ml. The amount of enzyme and the incubation time were
adjusted for each enzyme to obtain an FG of between 0.3 and
0.5. After incubation at 37°C, the reactions were stopped by adding
Na2-EDTA (pH 8.0) to 10 mM, and the mixture was dialyzed
extensively against Milli-Q water. The pH was adjusted to 6.9, and the
alginate was freeze-dried and subsequently dissolved in
D2O. Nuclear magnetic resonance (NMR) spectra were obtained by using a 300-MHz Bruker spectrometer. The spectra were integrated, and FG, FGG, and FMG,GM were
calculated as described previously (15) by using the
equations FG + FM = 1, FGG + FGM + FMG + FMM = 1, and
FGM
FMG.
Binding of 45Ca2+.
The presence of
calcium-binding proteins was detected by 45Ca2+
autoradiography as described by Maruyama et al. (20). The
proteins were separated on a sodium dodecyl sulfate (SDS)-8%
polyacrylamide gel and blotted onto nitrocellulose. After washing four
times with 10 mM imidazol (pH 6.8) containing 60 mM KCl, 5 mM
MgCl2, and 20 mM Na2-EDTA (first wash only),
the filter was incubated in 20 ml of the same buffer (lacking
Na2-EDTA) containing 60 µCi of
45CaCl2. The filter was washed in deionized
water, air dried, and autoradiographed on Hyperfilm
-max (Amersham).
The proteins on the filter were stained with 0.1% amido black.
 |
RESULTS AND DISCUSSION |
Construction of the expression plasmids.
To further analyze
the functional role of the different modules in AlgE1, we constructed
new truncated forms of the enzyme by removing one or more of the
modules at the DNA level (Fig. 1). E. coli cells containing
the different plasmids were induced with IPTG, and the corresponding
partially purified proteins were analyzed by SDS-polyacrylamide gel
electrophoresis (PAGE) (Fig. 2). The
dominant band in each lane has an apparent molecular mass corresponding
to that expected for the recombinant proteins, taking into account that
the AlgE epimerases migrate as if their molecular masses are
somewhat larger than those calculated from their amino acid sequences
(7, 11).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2.
Denaturing gel electrophoresis of proteins expressed by
the different plasmids. The proteins were stained with Coomassie
brilliant blue. The structures of the epimerases were as
follows: lane A, R3A2 (pHE51); lane B,
A2R4 (pHE56); lane C,
R3A2R4 (pHE27); lane D,
A2 (pHE58); lane E, A1 (pHE42); lane F,
A1R1 (pHE29); lane G,
A1R1R2 (pHE35); lane H,
A1R1R2R3 (pHE37); lane
I,
A1R1R2R3A2
(pHE57); lane J,
A1R1R2R3A2R4
(pHH1). Six micrograms of protein was loaded in each lane. The proteins
were partially purified by ion-exchange chromatography, except for the
epimerase in lane B, which was further purified by gel
filtration (11). The numbers indicate molecular masses (in
kilodaltons) of a molecular mass standard.
|
|
The A modules are sufficient for epimerization.
The proteins
were then analyzed for epimerase activity, and as expected
(11), all enzymes containing an A module with a C-terminal R module were catalytically active (Table
2). The activity may also be measured in
the crude extract (11), but removal of most of the
contaminating proteins made it possible to compare the activities of
the different epimerases. Interestingly, the protein containing
an A module with an N-terminal R module but no C-terminal R module
(R3A2) was also active, although the activity
was somewhat lower than that of the corresponding enzyme with the R
module positioned C terminally (A2R4). Finally,
all R modules were removed and each A module was expressed alone. Even
though the reaction rates were much lower, it was clear that the A
modules alone are sufficient for epimerization. A construct containing
the R1 module only was also made (pHE54), and crude extracts from cells containing this plasmid did not display any measurable epimerase activity, indicating that the A modules
are both necessary and sufficient for epimerization. A construct
encoding R4 fused to the last 118 amino acids of
A2 was also made (pHE89). This plasmid did not encode any
active epimerase either, confirming that the R modules are not
sufficient for activity. The result also showed that the
C-terminal third of the A module is not sufficient for activity.
All strains encoding the active epimerases were grown, and the
proteins were partially purified in the same experiment. The
experiment
was repeated in order to see if the differences were
caused by
occasional variations in enzyme purity for one or more
of the enzymes.
Even though the specific activities in the two
experiments vary (Fig.
2), the figures in Table
2 indicate a
significant difference between
the two A modules, with the A
2 module displaying a
reaction rate much higher than that of A
1.
A C-terminal R
module increased the reaction rate about 10-fold
for each A
module. An N-terminal R module also increased the reaction
rate,
although not to the same extent. This shows that both an
N-terminal and
a C-terminal R module influence the reaction rate
of an A
module.
The A modules determine the structure of the reaction product.
Alginate containing less than 6% G was epimerized by the
A1 and A2 modules and analyzed by NMR
spectroscopy. The spectra (Fig. 3) show
that the A1 module predominantly introduces G residues into
G blocks, since the GG peak is much more dominant than the GM peak. The A2 module, on the other hand,
predominantly introduces single G residues (as indicated by a dominant
GM signal and very small GG peak). Similar
analyses were performed for all the truncated epimerases to see
if the number of R modules somehow influenced the structure of the
epimerized alginate. The experiment was performed at least twice for
each enzyme. The results from the experiments having FG
closest to 0.3 are summarized in Fig. 4,
which shows the fractions of G, G blocks, and MG blocks present in the
alginate. All the enzymes which contain only the A1 module
introduced more G blocks than MG blocks, while all the enzymes
containing only the A2 module made MG blocks and almost no
G blocks. It has been found that AlgE4 is also able to make G blocks,
although at a much lower rate than it makes MG blocks (16).
As shown previously (11), the
FGG/FGM ratio increases with increasing
FG, and the differences in this ratio among the
enzymes containing only the first A module are thus not unexpected.
Since there did not seem to be any correlation between the amount of G
blocks produced and the number or position of R modules for any of
these truncated enzymes, it must be concluded that the A modules are
sufficient not only for catalysis but also for determining the
structure of the epimerized alginate.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
1H NMR (300 MHz) spectra of alginate
epimerized by A1 (a) and A2 (b). The residues
causing the signal are underlined, the numbers denote which H is
causing the signal, and the nonunderlined residues refer to the
neighboring residue.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4.
NMR analyses of alginate epimerized by the truncated
epimerases. The lengths of the bars show the G content, the
filled parts of the bars show the fraction of G blocks, and the open
parts show the fraction of MG blocks.
|
|
The removal of only the R
4 module from whole AlgE1 had a
significant effect on the epimerization pattern of the enzyme.
This
may, however, be explained by assuming that the
R
4 module has
some effect on the activity of the
A
2 module relative to that
of the A
1,
such that the reaction rate of A
2 becomes lower when
R
4 is not present. The significant difference in
specific activity
between the proteins
R
3A
2R
4 and
R
3A
2 (Table
2) seems to support
this
hypothesis.
So far, 10 different A modules in AlgE epimerases from
A. vinelandii have been described (
10,
32).
Since all of these
modules are highly homologous, it should be possible
to determine
which parts of them are responsible for the G distribution
pattern
and the differences in reaction rates. This might be done by
exchanging
parts of the modules between different epimerase
genes, and such
experiments have now been initiated in our
laboratory.
Both the A and the R modules bind calcium.
The repeated motifs
in the R modules are homologous to a calcium-binding motif found in a
metalloprotease from P. aeruginosa (2),
suggesting a possible role for the R modules in the binding of
this cation. To analyze this, the proteins were blotted on membranes from SDS-polyacrylamide gels and incubated with
45Ca2+ (Fig. 5).
Binding of the radioisotope was easily visualized for whole AlgE1 (lane
A) and several truncated forms containing at least one A module and one
to three of the R modules (lanes B to E). Interestingly, expression of
only A1 showed that this module alone binds
Ca2+ (lane F). A similar result was obtained for
A2 alone (not shown). Exposure of the membrane to
Na2-EDTA prior to the binding of calcium was found to
stimulate the binding of the radioisotope (not shown), presumably
because this pretreatment leads to the removal of already-bound nonradioactive Ca2+.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 5.
45Ca2+ binding by different
truncated enzymes. Lanes: A,
A1R1R2R3A2R4;
B, A1R1R2R3; C,
A1R1R2; D,
A1R1; E, R3A2; F,
A1; G, CelB-R3; H, CelB; I and J (underlined),
amido-black-stained filter after removal of the bound
45Ca2+ of CelB and CelB-R3 (lanes H
and G), respectively. The enzymes in lanes A to F were partially
purified, whereas crude extracts were loaded in lanes G and
H.
|
|
Based on these experiments, we concluded that either the R
modules are not involved in binding of the cation or both
modules
are capable of binding. To distinguish between these two
possibilities,
we have also studied the binding of
45Ca
2+ to the R module only. Expression from
pHE54 was not sufficiently
high to allow visualization of the protein
after SDS-PAGE directly
from crude extracts, and since this module
apparently did not
display any epimerase activity, it was
difficult to make an R-module
preparation containing protein
concentrations comparable to those
of the other truncated forms of
AlgE1. To overcome this problem,
we fused (at the DNA level) the
R
3 module to the CelB protein
(phosphoglucomutase)
from
Acetobacter xylinum. This fusion partner
was chosen
because we have previously shown that it could be expressed
at very
high levels in
E. coli (
3). Lane H shows that
CelB
itself does not bind the radioisotope, although it is clearly
visible on the amido-black-stained membrane (lane I). The crude
extract
of the fusion protein contains many contaminating proteins
(lane
J), but only the fusion protein binds radioisotope. It could
therefore be concluded that both the A and the R modules bind
Ca
2+.
In some of the lanes, more than one protein appeared to bind the
radioisotope. These signals vary from one extract to another
and are
believed to result from a tendency of the epimerases to
form
several distinct bands when separated on denaturing polyacrylamide
gels
(
16).
The R modules modulate the enzymes' requirements for calcium.
To study the role of the R modules further, we determined the optimal
concentrations of Ca2+ for activity of AlgE1 and its
truncated forms. We observed that the shapes of the curves varied
somewhat among the different enzymes, as, for instance, those lacking
A1 displayed a very slight slope around their optimal
values. It therefore seemed more meaningful to also compare the values
at which each enzyme displayed 50% activity, and both these values and
those that were obtained for optimal activity are shown in Fig.
6. The A1 module seems
to need slightly more Ca2+ for 50% activity than the
A2 module. The R modules appear to lower the requirements
for Ca2+, such that the more R modules are present, the
less of the cation is needed for full activity. This is, however, not
true for A1R1R2R3, which needs more Ca2+ than
A1R1R2. The explanations for
these observations are not clear, partly because the exact role of the
R modules has not been determined. In particular, interpretations are
complicated by the fact that Ca2+ is bound by alginate as
well as by both the A and the R modules. It could be that the R modules
function as a source of Ca2+ for the catalytic part (the A
module) and that the positioning of the R module relative to the A
module affects its efficiency in donating the cation to the catalytic
part. Alternatively, one might imagine that the R-module
Ca2+ complex stimulates binding of the
epimerase to the substrate, thus indirectly stimulating the
epimerization process.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6.
Ca2+ requirements of the truncated
epimerases. The lengths of the bars show the concentrations of
calcium needed for 100% activity, while the filled parts of the bars
show the concentrations needed for 50% activity. The concentrations of
Ca2+ used were 0.4 to 1.2 mM in 0.2 mM increments and 1.5 to 5.0 mM in 0.5 mM increments. The results for
A1R1R2R3A2R4,
A1R1R2R3, and
A2R4 are from Ertesvåg et al.
(11).
|
|
The modular structure of AlgE1, where the A modules alone are
sufficient for the reaction, may suggest that an ancestral
epimerase
contained only this module and that the R modules
were added to
the gene at a later stage. It has been proposed that the
Ca
2+-binding motifs found in the R modules participate in
the folding
of the protein and thus also facilitate its secretion
(
25).
In the case of AlgE1, it seems that the binding of
Ca
2+ by the R modules also increases the epimerization
rate, possibly
by increasing the amount of this cation available for
the catalytic
part.
 |
ACKNOWLEDGMENTS |
This work was supported by the Norwegian Research Council and by
Pronova Biopolymers AS.
We thank Gudmund Skjåk-Bræk and Wenche Iren Strand for providing the
alginate and analyzing the NMR samples.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: UNIGEN,
Medisinsk teknisk senter, N-7489 Trondheim, Norway. Phone: 47 73598680. Fax: 47 73598705. E-mail:
Helga.Ertesvag{at}unigen.ntnu.no.
 |
REFERENCES |
| 1.
|
Amann, I.,
B. Ochs, and K.-J. Abel.
1988.
Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli.
Gene
69:301-315[Medline].
|
| 2.
|
Baumann, U.,
S. Wu,
K. M. Flaherty, and D. B. McKay.
1993.
Three-dimensional structure of the alkaline protease of Pseudomonas aeruginosa: a two domain protein with a calcium binding parallel roll motif.
EMBO J.
12:3357-3364[Medline].
|
| 3.
|
Blatny, J. M.,
T. Brautaset,
H. Winther-Larsen,
P. Karunakaran, and S. Valla.
1997.
Improved broad-host-range RK2 vectors useful for high and low regulated gene expression levels in gram-negative bacteria.
Plasmid
38:35-51[Medline].
|
| 4.
|
Campos, M.-E.,
J. M. Martinez-Salazar,
L. Lloret,
S. Moreno,
C. Nunez,
G. Espin, and G. Soberon-Chavez.
1996.
Characterization of the gene coding for GDP-mannose dehydrogenase (algD) from Azotobacter vinelandii.
J. Bacteriol.
178:1793-1799[Abstract/Free Full Text].
|
| 5.
|
Chung, C. T.,
S. L. Niemela, and R. H. Miller.
1989.
One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution.
Proc. Natl. Acad. Sci. USA
86:2172-2175[Abstract/Free Full Text].
|
| 6.
|
Cote, G. L., and L. H. Krull.
1988.
Characterization of the exocellular polysaccharides from Azotobacter chroococcum.
Carbohydr. Res.
181:143-152.
|
| 7.
|
Ertesvåg, H.,
B. Doseth,
B. Larsen,
G. Skjåk-Bræk, and S. Valla.
1994.
Cloning and expression of an Azotobacter vinelandii mannuronan C-5-epimerase gene.
J. Bacteriol.
176:2846-2853[Abstract/Free Full Text].
|
| 8.
|
Ertesvåg, H.
1994.
Ph.D. thesis.
University of Trondheim, Trondheim, Norway.
|
| 9.
|
Ertesvåg, H.,
F. Erlien,
G. Skjåk-Bræk,
B. H. A. Rehm, and S. Valla.
1998.
Biochemical properties and substrate specificities of a recombinantly produced Azotobacter vinelandii alginate lyase.
J. Bacteriol.
180:3779-3784[Abstract/Free Full Text].
|
| 10.
|
Ertesvåg, H.,
H. K. Høidal,
I. K. Hals,
A. Rian,
B. Doseth, and S. Valla.
1995.
A family of modular type mannuronan C-5-epimerase genes controls alginate structure in Azotobacter vinelandii.
Mol. Microbiol.
16:719-731[Medline].
|
| 11.
|
Ertesvåg, H.,
H. K. Høidal,
G. Skjåk-Bræk, and S. Valla.
1998.
The Azotobacter vinelandii mannuronan C-5-epimerase AlgE1 consists of two separate catalytic domains.
J. Biol. Chem.
273:30927-30932[Abstract/Free Full Text].
|
| 12.
|
Fett, W. F.,
P. Cescutti, and C. Wijey.
1996.
Exopolysaccharides of the plant pathogens Pseudomonas corrugata and Ps. flavescens and the saprophyte Ps. chlororaphis.
J. Appl. Bacteriol.
81:181-187.
|
| 13.
|
Gorin, P. A. J., and J. F. T. Spencer.
1966.
Exocellular alginic acid from Azotobacter vinelandii.
Can. J. Chem.
44:993-998.
|
| 14.
|
Govan, J. R. W.,
J. A. M. Fyfe, and T. R. Jarman.
1981.
Isolation of alginate-producing mutants of Pseudomonas fluorescens, Pseudomonas putida and Pseudomonas mendocina.
J. Gen. Microbiol.
125:217-220[Abstract/Free Full Text].
|
| 15.
|
Grasdalen, H.,
B. Larsen, and O. Smidsrød.
1979.
A p.m.r. study of the composition and sequence of uronate residues in alginates.
Carbohydr. Res.
68:23-31.
|
| 16.
| Høidal, H. K., H. Ertesvåg, G. Skjåk-Bræk,
B. T. Stokke, and S. Valla. The recombinant Azotobacter
vinelandii mannuronan C-5-epimerase AlgE4
epimerizes alginate by a non-random attack mechanism.
J. Biol. Chem., in press.
|
| 17.
|
Larsen, B., and A. Haug.
1971.
Biosynthesis of alginate. 3. Tritium incorporation with polymannuronic acid 5-epimerase from Azotobacter vinelandii.
Carbohydr. Res.
20:225-232[Medline].
|
| 18.
|
Linker, A., and R. S. Jones.
1964.
A polysaccharide resembling alginic acid from a Pseudomonas microorganism.
Nature
204:187-188[Medline].
|
| 19.
|
Lloret, L.,
R. Barreto,
R. Leon,
S. Moreno,
J. Martinez-Salazar,
G. Espin, and G. Soberon-Chavez.
1996.
Genetic analysis of the transcriptional arrangement of Azotobacter vinelandii alginate biosynthetic genes: identification of two independent promoters.
Mol. Microbiol.
21:449-457[Medline].
|
| 20.
|
Maruyama, K.,
T. Mikawa, and S. Ebashi.
1984.
Detection of calcium binding proteins by 45Ca autoradiography on nitrocellulose membrane after sodium dodecyl sulfate gel electrophoresis.
J. Biochem. (Tokyo)
95:511-519[Abstract/Free Full Text].
|
| 21.
|
May, T. B., and A. M. Chakrabarty.
1994.
Pseudomonas aeruginosa: genes and enzymes of alginate synthesis.
Trends Microbiol.
2:151-157[Medline].
|
| 22.
|
Mejia-Ruiz, H.,
J. Guzman,
S. Moreno,
G. Soberon-Chavez, and G. Espin.
1997.
The Azotobacter vinelandii alg8 and alg44 genes are essential for alginate synthesis and can be transcribed from an algD-independent promoter.
Gene
199:271-277[Medline].
|
| 23.
|
Mejia-Ruiz, H.,
S. Moreno,
J. Guzman,
R. Najera,
R. Leon,
G. Soberon-Chavez, and G. Espin.
1997.
Isolation and characterization of an Azotobacter vinelandii algK mutant.
FEMS Microbiol. Lett.
156:101-106[Medline].
|
| 24.
|
Norrander, J.,
T. Kempe, and J. Messing.
1983.
Improved M13 vectors using oligonucleotide-directed mutagenesis.
Gene
26:101-106[Medline].
|
| 25.
|
Ofstad, R., and B. Larsen.
1981.
The effect of calcium-ion concentration on poly-D-mannuronate C-5-epimerase, p. 485-493.
In
T. Levring (ed.), Proceedings of the 10th International Seaweed Symposium. Walter de Gruyter & Co., Berlin, Germany.
|
| 26.
|
Rehm, B. H.,
H. Ertesvåg, and S. Valla.
1996.
A new Azotobacter vinelandii mannuronan C-5-epimerase gene (algG) is part of an alg gene cluster physically organized in a manner similar to that in Pseudomonas aeruginosa.
J. Bacteriol.
178:5884-5889[Abstract/Free Full Text].
|
| 27.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 28.
|
Skjåk-Bræk, G., and T. Espevik.
1996.
Application of alginate gels in biotechnology and biomedicine.
Carbohydr. Eur.
14:19-25.
|
| 29.
|
Skjåk-Bræk, G., and B. Larsen.
1982.
A new assay for mannuronan C-5-epimerase activity.
Carbohydr. Res.
103:133-136.
|
| 30.
|
Smidsrød, O., and K. I. Draget.
1996.
Chemistry and physical properties of alginates.
Carbohydr. Eur.
14:6-12.
|
| 31.
|
Soon-Shiong, P.,
R. E. Heintz,
N. Merideth,
Q. X. Yao,
Z. Yao,
T. Zheng,
M. Murphy,
M. K. Moloney,
M. Schmehl,
M. Harris,
R. Mendez,
R. Mendez, and P. A. Sandford.
1994.
Insulin dependence in a type 1 diabetic patient after encapsulated islet transplantation.
Lancet
343:950-951[Medline].
|
| 32.
|
Svanem, B. I. G.,
G. Skjåk-Bræk,
H. Ertesvåg, and S. Valla.
1999.
Cloning and expression of three new Azotobacter vinelandii genes closely related to a previously described gene family encoding mannuronan C-5-epimerases.
J. Bacteriol.
181:68-77[Abstract/Free Full Text].
|
| 33.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[Medline].
|
Journal of Bacteriology, May 1999, p. 3033-3038, Vol. 181, No. 10
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Rozeboom, H. J., Bjerkan, T. M., Kalk, K. H., Ertesvag, H., Holtan, S., Aachmann, F. L., Valla, S., Dijkstra, B. W.
(2008). Structural and Mutational Characterization of the Catalytic A-module of the Mannuronan C-5-epimerase AlgE4 from Azotobacter vinelandii. J. Biol. Chem.
283: 23819-23828
[Abstract]
[Full Text]
-
Aachmann, F. L., Svanem, B. I. G., Guntert, P., Petersen, S. B., Valla, S., Wimmer, R.
(2006). NMR Structure of the R-module: A PARALLEL beta-ROLL SUBUNIT FROM AN AZOTOBACTER VINELANDII MANNURONAN C-5 EPIMERASE. J. Biol. Chem.
281: 7350-7356
[Abstract]
[Full Text]
-
Bjerkan, T. M., Bender, C. L., Ertesvag, H., Drablos, F., Fakhr, M. K., Preston, L. A., Skjak-Braek, G., Valla, S.
(2004). The Pseudomonas syringae Genome Encodes a Combined Mannuronan C-5-epimerase and O-Acetylhydrolase, Which Strongly Enhances the Predicted Gel-forming Properties of Alginates. J. Biol. Chem.
279: 28920-28929
[Abstract]
[Full Text]
-
Nyvall, P., Corre, E., Boisset, C., Barbeyron, T., Rousvoal, S., Scornet, D., Kloareg, B., Boyen, C.
(2003). Characterization of Mannuronan C-5-Epimerase Genes from the Brown Alga Laminaria digitata. Plant Physiol.
133: 726-735
[Abstract]
[Full Text]
-
Svanem, B. I. G., Strand, W. I., Ertesvag, H., Skjak-Brak, G., Hartmann, M., Barbeyron, T., Valla, S.
(2001). The Catalytic Activities of the Bifunctional Azotobacter vinelandii Mannuronan C-5-Epimerase and Alginate Lyase AlgE7 Probably Originate from the Same Active Site in the Enzyme. J. Biol. Chem.
276: 31542-31550
[Abstract]
[Full Text]
-
Ponting, C. P., Mott, R., Bork, P., Copley, R. R.
(2001). Novel Protein Domains and Repeats in Drosophila melanogaster: Insights into Structure, Function, and Evolution. Genome Res
11: 1996-2008
[Abstract]
[Full Text]