Previous Article | Next Article 
Journal of Bacteriology, June 1999, p. 3321-3329, Vol. 181, No. 11
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Cell Cycle Expression and Transcriptional
Regulation of DNA Topoisomerase IV Genes in
Caulobacter
Doyle V.
Ward
and
Austin
Newton*
Department of Molecular Biology, Princeton
University, Princeton, New Jersey 08544
Received 29 July 1998/Accepted 5 April 1999
 |
ABSTRACT |
DNA replication and differentiation are closely coupled during the
Caulobacter crescentus cell cycle. We have previously shown that DNA topoisomerase IV (topo IV), which is encoded by the
parE and parC genes, is required for
chromosomal partitioning, cell division, and differentiation in this
bacterium (D. Ward and A. Newton, Mol. Microbiol. 26:897-910,
1997). We have examined the cell cycle regulation of parE
and parC and report here that transcription of these topo
IV genes is induced during the swarmer-to-stalked-cell transition when
cells prepare for initiation of DNA synthesis. The regulation of
parE and parC expression is not strictly
coordinated, however. The rate of parE transcription
increases ca. 20-fold during the G1-to-S-phase transition
and in this respect, its pattern of regulation is similar to those of
several other genes required for chromosome duplication. Transcription
from the parC promoter, by contrast, is induced only two-
to threefold during this cell cycle period. Steady-state ParE levels
are also regulated, increasing ca. twofold from low levels in swarmer
cells to a maximum immediately prior to cell division, while
differences in ParC levels during the cell cycle could not be detected.
These results suggest that topo IV activity may be regulated primarily
through parE expression. The presumptive promoters of the
topo IV genes display striking similarities to, as well as differences
from, the consensus promoter recognized by the major
Caulobacter sigma factor 
73. We also present
evidence that a conserved 8-mer sequence motif located in the spacers
between the 
10 and 35 elements of the parE and
parC promoters is required for maximum levels of
parE transcription, which raises the possibility that it
may function as a positive regulatory element. The pattern of
parE transcription and the parE and
parC promoter architecture suggest that the topo IV genes
belong to a specialized subset of cell cycle-regulated genes required
for chromosome replication.
| |
INTRODUCTION |
Differentiation in Caulobacter
crescentus results from asymmetric cell division, which produces
two distinct cell types: a motile swarmer cell with a set of
differentiated structures, including a polar flagellum, bacteriophage
receptors, and pili and a nonmotile stalked cell. Formation of the new
swarmer cell results from a series of discrete morphogenic events that
are closely coordinated with cell cycle progression and occur at the
stalk-distal pole of the dividing cell (reviewed in references
3 and 24). This developmental
sequence is dependent on completion of successive cell cycle
checkpoints, and there is now evidence that the regulation of cell
division and developmental events is mediated by two-component signal
transduction pathways (6, 27, 44).
The progeny swarmer and stalked cells differ not only in morphology and
motility but also in their capacities to initiate DNA replication. The
stalked cell initiates chromosome replication (S phase) immediately
upon division, and the period of replication is followed by a
postsynthetic gap (G2 phase). The swarmer cell, by
contrast, undergoes a presynthetic gap (G1 phase) and
differentiates into a stalked cell before it initiates chromosome DNA
replication (5). DNA replication is regulated in these cell
types, at least in part, by the response regulator protein CtrA, which
binds to the origin of replication in the swarmer cell and represses
DNA initiation (34).
Several genes encoding proteins required for DNA replication or repair
are also cell cycle regulated in C. crescentus. Their transcription is induced at or near the time of the
swarmer-to-stalked-cell transition, which immediately precedes
initiation of DNA replication. The first of these genes to be described
is dnaC, which was originally identified genetically as a
gene required for DNA chain elongation (26). dnaC
is now known to encode a HolB homologue, a component of the DNA
replication complex (28). Other genes with similar patterns
of cell-cycle-regulated transcription include dnaA
(45), which encodes a replication initiation protein;
dnaN and dnaX (36, 42), which encode
subunits of DNA polymerase; and gyrB (35, 36),
which encodes a subunit of DNA gyrase. The dnaC gene has not
been fully characterized, but the promoters of the other replication
genes share two conserved sequence elements, an 8-mer motif
(36) and a 13-mer motif, which appears to act as a negative
regulatory element (42). The 8-mer motif (GnnTTTCG) is
located at various positions in the vicinity of the 10 and 35
sequences (from 45 in dnaNpprox to +15 in
dnaKp), but no functional analysis of this sequence had been
reported prior to this study.
We have recently identified two other genes required for chromosome
replication and segregation in C. crescentus,
parE and parC (41). These genes encode
subunits of DNA topoisomerase IV (topo IV), which is the enzyme
responsible for the decatenation of replicated daughter chromosomes in
bacteria (reviewed in reference 17). Conditional
C. crescentus parE or parC mutants do not
accurately segregate chromosomal DNA (41), but they differ
from topo IV mutants in other bacteria that have been described
(11, 14, 15, 18, 37). They fail to complete cell division,
do not display asymmetrically located nucleoids, and do not give rise to anucleate cells (41). In addition to disrupting a late
stage in cell division, C. crescentus topo IV mutants also
fail to synthesize polar pili (40).
In this work, we have examined the expression of parE and
parC in synchronous cell cultures and demonstrate that, like
DNA replication genes examined previously in C. crescentus,
their transcription is cell cycle regulated. Although activation of the
parE and parC promoters coincides with the
swarmer-cell-to-stalked-cell transition, when cells prepare for
initiation of DNA replication, parE is the more strongly
regulated of the two genes. These results and analysis of steady-state
ParE and ParC protein levels suggest that topo IV activity may be
regulated at the level of parE expression. Analysis of the
5' regulatory regions of parE and parC suggests that these genes contain promoters that are similar in some respects to
the consensus promoter recognized by the major Caulobacter sigma factor 73 (19). The parE and
parC promoters also contain a conserved 8-mer sequence in
the spacer sequence between the 10 and 35 elements that is required
for maximum levels of parE transcription and may function as
a positive regulatory element. We discuss the possibility that
parE and parC belong to a specialized class or
subclass of developmentally regulated genes involved in DNA synthesis
whose expression may be dependent on a secondary transcription factor(s).
| |
MATERIALS AND METHODS |
Strains and culture conditions.
C. crescentus strains
used were all derived from strain CB15 (ATCC 19089). Strains were grown
in PYE (32) medium or M2 minimal salts medium containing
0.2% glucose (12) supplemented with tetracycline (2 µg/ml) as indicated. Temperature-sensitive (Ts) alleles of
parE (divC307 and divD308) and
parC (divF310) have been characterized previously
(41). Plasmids were introduced into C. crescentus
by conjugation (30). Synchronous cultures were prepared on a
density gradient of colloidal silica (no. 7631-86-9; Dupont)
(7).
Radioimmune precipitation assays.
Synchronous cell
preparations were diluted to an optical density at 660 nm of 0.1 in
media prewarmed to 30°C. After a 10-min equilibration period, 2-ml
samples were pulse-labeled for 10 min with 20 µCi of
[35S]methionine (Amersham Corporation)/ml. After cell
lysis, samples were divided. The rate of 
-galactosidase or FlgE
synthesis was monitored by radioimmune precipitation with either
anti--galactosidase monoclonal antibody (Promega) or anti-FlgE
antiserum (16). Immunoprecipitates were subjected to sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and
analyzed by using a Molecular Dynamics PhosphorImaging system.
Western analysis of ParE and ParC proteins.
Carboxy-terminal peptides of ParC and ParE were used to raise
rabbit polyclonal antibodies for use in Western analyses. The C-terminal BamHI-EcoRI fragment of the
parC clone pDW131 (41) was cloned into pRSETC
(Invitrogen) to create an N-terminally six-histidine (6×His)-tagged
parC-derived peptide. Similarly, the C-terminal
BamHI-XhoI fragment of pDW001 (41) was
cloned into pRSETC to create an N-terminally 6×His-tagged
parE-derived peptide. Each 6×His-tagged peptide was
purified under denaturing conditions over Ni-nitrilotriacetic acid
resin (QIAGEN Inc.) as described in reference 32a.
The peptides were dialyzed overnight against 1,000× volumes of
phosphate-buffered saline-0.1% Triton X-100 and used directly to
raise polyclonal antibodies. Sera obtained were used at dilutions of
1:4,000 in the Western analyses discussed below.
Synchronous swarmer cells of strain CB15F were allowed to proceed
through division. At each time point, an aliquot was removed, cells
were pelleted by centrifugation, and the pellet was lysed by the
addition of SDS-PAGE loading buffer. Equivalent volumes of culture were
loaded in each sample and subjected to electrophoresis on a 7.5%
polyacrylamide gel, transferred to Immobilon-P transfer membrane
(Millipore), and blotted with either ParE or ParC antiserum.
In one set of experiments, alkaline phosphatase (AP) conjugated to
anti-rabbit immunoglobulin G (IgG) (no. 1814206; Boehringer
Mannheim)
was used as the secondary antibody. In a second set
of experiments,
[
125I]IgG (Amersham) was used as the secondary antibody
to detect
antibody binding, as described previously (
31).
For quantification,
immunoblots using AP-conjugated antibody were
scanned as TIF files
by using Photolook (AGFA). Immunoblots using
125I-labeled IgGs were quantified by phosphorimaging
(Molecular Dynamics),
which gives a linear response to a wide range of
signals (
13).
Quantification was performed with ImageQuant
software (Molecular
Dynamics).
Nuclease S1 protection assays.
To prepare a probe for
determination of the start site of transcription for parE, a
493-bp fragment was amplified by PCR from pDW001 (41). The
oligonucleotides used, DWPARE39
(5'CGATGTACATGCGCGGCCGCTTGCGCACCG3') and
DWPARE41 (5'CACCTGCAGCTGAAGGCCCGCTACGCGCCG3'),
introduce mutations (underlined) which create NotI and
PstI sites, respectively. The PCR product was cloned as a
PstI-NotI fragment into pBluescript (Stratagene)
to create pDW166, and the fragment was used as a probe in nuclease S1
protection assays. The 5' end of the sequencing primer, DWPARE40
(5'GGCCGCTTGCGCACCGGCT3'), for the parE reference sequence ladder corresponds to the 5' overhang generated by digestion of pDW166 with NotI. A 594-bp
PstI-ApaLI fragment from pDW112, a pBluescript
derivative of pDW148 (41) was used as a probe for
determination of the transcriptional start site of parC. The 5' end of the sequencing primer, DWPARC50
(5'TGCACGGGCTTCAAGCCATCGCG3'), for the parC
reference sequence ladder corresponds to the 5' overhang generated by
ApaLI digestion.
Restriction fragments were 5'-end labeled by using T4 polynucleotide
kinase (New England Biolabs). RNA was isolated from CB15
as previously
reported (
25). S1 assays were performed as previously
described (
2). First, 5'-end-labeled restriction fragments
were hybridized to 100 µg of total cellular RNA at 65 and 60°C
for
parE and
parC, respectively. After treatment with
S1 nuclease,
the resistant DNA fragments were electrophoresed through a
polyacrylamide
gel and visualized by autoradiography. DNA sequencing
was performed
on pDW112 and pDW001 double-strand template by using a
Sequenase
7-deaza-dGTP sequencing kit (United States Biochemical) and
[
35S]dATP (Amersham Corp.).
Construction of lacZ promoter fusions.
To
construct the parE or parC promoter fusions for
determining cell cycle regulation of transcription, a
SalI-PstI fragment of pSUPZ1 containing the
promoterless lacZ gene (28) was cloned into
pBluescript to create pDW100. To create the parE promoter fusion to lacZ, the 5' XhoI-BamHI
fragment of pDW001 (41) was cloned into pBluescript. An
Asp718-SalI fragment was isolated from this
construct and cloned into pDW100. The entire fusion was transferred as
an Asp718-NotI fragment into pGH500 to create pDW104. To create the parC promoter fusion to
lacZ, the 5' PstI-XhoI fragment of
pDW112 was transferred to pRSETA (Invitrogen) and reisolated as an
Asp718-XhoI fragment. This fragment was cloned into pDW100, and the entire fusion was moved as an
Asp718-NotI fragment into nonreplicative plasmid
pGH500 (10) to create pDW138. Both promoter-reporter fusion
vectors, pDW104 and pDW138, are nonreplicative plasmids in C. crescentus and must integrate by homologous recombination to
confer tetracycline resistance to the host strain. Plasmids pDW104 and
pDW138 were mated into synchronizable strain CB15F to create strains
PC4828(parEp-lacZ) and
PC4480(parCp-lacZ), respectively. An
Asp718-XbaI fragment of pDW100 was cloned into plasmid pRK290 derivative pRK2L1 (23) to create
pDW109(promoterless lacZ).
Mutations were introduced in the
parE and
parC
gene promoters by sequential PCR as described previously (
1)
except that
cloned
Pfu polymerase (Stratagene) was employed.
Reactions contained
20 mM
(NH
4)
2SO
4, 75 mM Tris (pH 9.0 at
25°C), 0.01% Tween 20,
2 mM MgSO
4, and 10% dimethyl
sulfoxide. Deoxyoligonucleotide primers
used in PCR amplification were
supplied by GIBCO BRL Custom Primers.
Mutagenized
parC
constructs were amplified by using primers DWPARC71
(5'GTGT
GGTACCTG
CTGCAGACCATCC3') and
DWPARC72 (5'CTTGGG
CTCGAGGACCAGACG3').
DWPARC71
contains the native
PstI site and an
Asp718 site
(underlined
[see Fig.
5B]) to facilitate cloning. DWPARC72 contains
the native
XhoI site (underlined [see Fig.
5B]). PCR
products amplified by
using DWPARC71 and DWPARC72 were cloned into
pBluescript as
Asp718-
XhoI
fragments, and the
mutations were confirmed by DNA sequencing.
The 5'
parC
promoter deletions were generated by PCR using different
5'
deoxyoligonucleotides (see Fig.
5B). Mutagenized
parE
constructs
were amplified by using primers DWPARE51
(5'CGCG
CTCGAGGTCGGCAAGCT3')
and DWPARE86
(5'TATA
AAGCTTGGGCATGCCGCGAC3'). The constructs
contain
the native
XhoI site and an introduced
HindIII site, respectively
(underlined [see Fig.
5A]).
The
HindIII restriction site replaces
a native
SalI site in the
parE gene. PCR products
amplified by
using DWPARE51 and DWPARE86 were cloned into pBluescript
as
XhoI-
HindIII
fragments, and the mutations
were confirmed by sequencing. In
addition, 5'
parE promoter
deletions were generated (see Fig.
5A).
All pBluescript derivatives were cloned as
Asp718-
HindIII fragments into pRKlac290
(
8). The pRKlac290 derivatives were
mated into
C. crescentus wild-type strain CB15 and assayed for
-galactosidase
activity. (The sequences of the fusion junctions
for both
parE and
parC are presented in Fig.
5.) The
full-length
parE and
parC promoter fragments in
the pRKlac290 derivatives
correspond to those used in constructs pDW104
and pDW138 for examination
of cell cycle regulation (see
above).
-Galactosidase activity assays.
Promoter activity of
reporter constructs pDW104(parEp-lacZ) and
pDW138(parCp-lacZ) in strains PC4828 and PC4480,
respectively, and of control construct pDW109(promoterless
lacZ) in strain CB15 was assayed as described previously
(22). Expression from parEp-lacZ and
parCp-lacZ yielded 101 and 98 U of activity,
respectively. Expression from the control plasmid, pDW109, yielded 4 U
of activity.
-Galactosidase activity of the mutant promoter-
lacZ
fusion constructs (see Table
1 and Fig.
5) was assayed as described
previously (
39) except that overnight cultures were grown in
PYE medium supplemented with 2 µg of tetracycline/ml and diluted
1:5
into fresh medium and incubated for 4 to 5 h. The activity
of each
construct was determined from an average of five to seven
independent
experiments. In each experiment, values for
-galactosidase
activity
were normalized; the wild-type fusions were assigned
a value of 100, and the control plasmid pRKlac290 was assigned
a value of 0. The
normalized values from each experiment were
then averaged to produce
the data presented in Results (see Table
1).
| |
RESULTS |
The parE and parC promoters are cell cycle
regulated.
To examine topo IV regulation during the C. crescentus cell cycle, we determined the rates of parE
and parC transcription in synchronous cultures. The
transcription of other DNA topoisomerases, such as the
Escherichia coli topA, gyrA, and gyrB
genes, are known to respond to the superhelical state of DNA at their
promoters (4, 20, 21). A similar effect has not been
reported for parE or parC, but to minimize
nonphysiological effects of transcription of the genes from multicopy
plasmids, we examined expression from the parE and
parC promoters by using transcription fusions to the
lacZ reporter gene integrated in the chromosome (see
Materials and Methods).
The
parEp and
parCp fusions were transferred into
the synchronizable strain CB15F to construct the strains PC4828
(
parEp-
lacZ)
and PC4480
(
parCp-
lacZ; see Materials and Methods). Swarmer
cells
were isolated from each strain and allowed to proceed through
a
synchronous round of division, and progeny swarmer and stalked
cells
were isolated after the completion of cell division. The
rates of
transcription from the
parE and
parC promoters
were then
determined in the synchronous swarmer and stalked cell
cultures
by radioimmune assays on cells pulse-labeled with
[
35S]methionine. The rate of flagellar hook protein
(FlgE) synthesis,
which is expressed late in the cell cycle at the
S-to-G
2-phase
transition (
38), was determined as
an internal
control.
Transcription from the
parE promoter (Fig.
1A) occurred at an extremely low rate in
early G
1-phase swarmer cells. After a
lag of ca. 20 min,
the rate of transcription increased ca. 20-fold
in the cell cycle to
maximum levels at 0.4 division unit, which
corresponds to that of early
S-phase cells that had just undergone
stalk formation (as monitored by
microscopic observation). Transcription
continued at a high rate during
the stalked cell portion of the
cell cycle and decreased just before
division as cells became
highly pinched. Transcription began to
increase as the cells entered
the next cell cycle.
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Transcriptional regulation of parEp in
synchronous swarmer and stalked cell cultures. (A) Transcriptional
activity of a parEp-lacZ fusion (PC4828) during
the C. crescentus swarmer cell cycle as assayed by
radioimmune precipitation of -galactosidase. Division occurred at
150 min. (B) Transcriptional activity of a
parEp-lacZ fusion (PC4828) during the C. crescentus stalked cell cycle as assayed by radioimmune
precipitation of -galactosidase. Division occurred at 120 min.
Activity is plotted as a percentage of maximal expression. Note that
1.0 division unit for the stalked cell cycle corresponds approximately
to the period of 0.4 to 1.0 division unit of the swarmer cell cycle.
Expression of pulse-labeled FlgE protein served as an internal control
for these synchrony experiments and those shown in Fig. 2. The times of
swarmer to stalked cell differentiation and completion of cell division
(1.0 division unit) are indicated at the bottoms of panels A and B
along with the corresponding G1, S, and G2
phases.
|
|
Transcription from the
parE promoter was also low in the
isolated stalked cell population. However, it began to increase
immediately
and reached a maximum level of ca. fivefold of the initial
rate
between 0.2 and 0.4 division unit (Fig.
1B). Transcription
decreased
only slightly during the remainder of the cell cycle. These
results
demonstrated that the
parE promoter is
differentially regulated
in the swarmer and stalked cell cycles. The
rate of transcription
was highest during S-phase in both swarmer and
stalked cell synchronies,
indicating that
parE expression is
coordinated in some way with
DNA replication. In contrast to
parE expression, FlgE synthesis
reached a maximum both in
the swarmer and stalked cell cycles
at ca. 0.8 cell division unit, the
time at which
parE transcription
was decreasing (Fig.
1A and
B).
Transcription from the
parC promoter in swarmer cells
followed a similar but less pronounced pattern of cell cycle regulation
than that displayed by the
parE promoter (Fig.
2A). Levels of
parCp activity
displayed more than a twofold increase during the
G
1-to-S-phase transition in synchronous swarmer cells (Fig.
2A)
and fell only slightly, later in the cell cycle just before
division.
Transcription from the
parC promoter in
synchronous stalked cell
cultures increased only ca. 50% (Fig.
2B),
which may be an artifact
of the procedure used for cell synchrony (see
below).
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
Transcriptional regulation of parCp in
synchronous swarmer and stalked cell cultures. (A) Transcriptional
activity of a parCp-lacZ fusion (PC4480) during
the swarmer cell cycle as assayed by radioimmune precipitation of
-galactosidase. Division occurred at 120 min. (B) Transcriptional
activity of a parCp-lacZ fusion (PC4480) during
the stalked cell cycle as assayed by radioimmune precipitation of
-galactosidase. Division occurred at 90 min, which corresponds to
1.0 division unit. Activity is plotted as a percentage of maximal
expression. The cell cycle periods are as described in the legend for
Fig. 1 and the text.
|
|
We assessed the effects of the synchrony procedure on transcription by
using the
parEp-
lacZ fusion construct. Mock
synchronies
in which cells were subjected to density centrifugation at
4°C
were performed (see Materials and Methods). The resulting
gradient
was mixed to reconstitute an asynchronous culture. These cells
were then incubated at 30°C, and the pattern of
parEp
activity
was examined in a "mock" synchrony. A small, transient
increase
in transcription of ca. 1.5-fold was observed between 0 and
0.1
division unit of the cell cycle (data not shown). The increase
is
similar to the increase in transcription from the
dnaN
promoter
reported previously in mock-synchronized cells
(
36). This transient
increase in transcription presumably
reflects the temperature
shift to 30°C or some other aspect of the
synchronization procedure.
The increase occurred over a shorter period
of the cell cycle
than that observed for transcription from the
parE promoter in
swarmer and stalked cells or the
parC promoter in swarmer cells
(0.1 versus 0.4 division
unit; Fig.
1A and B and 2A). Thus, the
effects of the synchronization
protocol should not contribute
significantly to the pattern of
parE or
parC regulation seen in
these three
experiments where the amplitudes of changes in transcriptional
activities were large. It could, however, account for the smaller
change in transcription observed from the
parC promoter in
the
stalked cell cycle (Fig.
2B).
Steady-state levels of ParE and ParC proteins during the cell
cycle.
To determine the contribution of parE and
parC transcription to the cellular levels of the topo IV
subunits during the cell cycle, we examined the levels of the ParE and
ParC proteins. The steady-state levels of ParE and ParC were assayed in
synchronous swarmer cells of strain CB15F by Western blotting using
rabbit polyclonal antibodies raised against C-terminal fragments of the two proteins and AP-conjugated anti-rabbit IgG as the secondary antibody (see Materials and Methods). Culture samples were removed at
intervals throughout the cell cycle, the cells were collected by
centrifugation and lysed, and the lysates were subjected to analysis by
SDS-PAGE (Fig. 3; see Materials and
Methods).
View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Levels of ParE and ParC in synchronous cell cultures.
(A) The 80-kDa ParE protein was detected by Western analysis of samples
from a synchronous culture of strain CB15F at the times indicated. The
last three lanes contain lysates of wild-type strain CB15, strain
PC8830[divC307(Ts)], and strain
PC4885[divC307(Ts), sueA020(Cs)], a spontaneous
revertant of the divC307(Ts) strain grown at the restrictive
temperature of 37°C. The level of the ParE protein was reduced in the
divC307(Ts) strain and increased in the
sueA020(Cs) strain relative to wild-type levels. Levels of
ParE and ParC were quantified as described in Materials and Methods,
and the level in swarmer cells at 0 min was normalized to 1.0 U. These
measurements showed that the level of ParE increased from 1.0 U at 0 min to 2.1 U immediately before cell division at 0.8 to 0.9 division
unit and then decreased after cell division to 1.6 U at 1.2 division
units. Similar results were obtained when 125I-labeled
secondary antibodies were used; ParE levels determined in this assay
(see Materials and Methods) increased from 1.0 U at 0 min to 1.9 U
before division at 0.8 to 0.9 division unit and then decreased to 1.3 U
after division at 1.2 division units. (B) The 87-kDa ParC protein was
detected by Western analysis of lysates from a synchronous cell culture
of strain CB15F. Assays of lysates of wild-type strains CB15 and
PC8861[divF310(Ts)] grown at the restrictive temperature
of 37°C are shown in the last two lanes. The level of the ParC
protein was diminished in strain PC8861. Bands were quantified as
described in Materials and Methods, but reproducible changes in ParC
levels during the cell cycle were not detected.
|
|
We detected a discrete band at ca. 80 kDa by using the anti-ParE
polyclonal antiserum (Fig.
3A). Although the ParE peptide
is predicted
to contain 667 residues with a calculated size of
73.3 kDa, we
confirmed that the band detected corresponds to the
parE
gene product by comparing wild-type strain CB15 to a strain
containing
the Ts
parE allele
divC307(Ts) (
29,
41) that had
been grown at the nonpermissive temperature. The
level of the
80-kDa protein was specifically reduced in the
parE mutant strain.
A spontaneous revertant of the
divC307(Ts) mutant,
sueA020(Cs)
(strain PC4885),
which can complete cell division at 37°C, showed
an increase of the
80-kDa product under identical conditions of
growth (Fig.
3A).
The amount of ParE protein was lower at the beginning of a synchronous
swarmer cell cycle and increased ca. twofold during
mid to late S
phase. ParE levels peaked at the time of cell division
and decreased
immediately after division. The increase in ParE
protein, although not
as dramatic as the 20-fold increase observed
for
parE
transcription, occurs in the cell cycle soon after the
maximum rate of
parE transcription is reached and transcription
from the
parE promoter has begun to decrease (Fig.
1A). Maximal
ParE
protein levels are, therefore, reached somewhat later in
the cell cycle
than maximal
parE transcription.
Although the twofold increase in ParE observed using AP-conjugated
anti-rabbit IgG as the secondary antibody was reproducible,
we
confirmed this result by using quantitative Western blots in
which
125I-labeled IgG was used as the secondary antibody (see
Materials
and Methods and reference
31). Again, a
twofold increase in
ParE levels was observed during the synchrony with
the maximum
reached immediately before cell division, followed by a
slight
decrease immediately after cell division (see legend to Fig.
3 for
results).
The anti-ParC polyclonal antibody detected a protein with an estimated
size of 87 kDa relative to molecular mass markers (Fig.
3). The
predicted peptide is 759 residues with a calculated size
of 83 kDa.
Confirming the identity of this protein as the
parC gene
product is its sharply decreased level in a strain containing
the Ts
parC allele
divF310 (
29) grown at the
restrictive temperature
(Fig.
3B). Changes in the steady-state levels
of ParC could not
be detected during the synchronous swarmer cell cycle
(Fig.
3B).
This result is consistent with the small changes in the
rates
of
parC transcription observed during the cell cycle
(Fig.
2A).
Mapping of parE and parC transcription
start sites.
To locate the parE and parC
promoters, we determined the transcription start sites by nuclease S1
protection assays using 5'-end-labeled probes (see Materials and
Methods). A single protected fragment was observed for the
parE gene and the start site mapped to an A residue on the
template strand (Fig. 4A, lane 2).
Multiple protected fragments observed for the parC gene
correspond to potential start sites on three G residues on the template
strand (Fig. 4B, lane 2). No protected fragments were observed in the
control reactions with the labeled parE (Fig. 4A, lane 3) or
parC probe (Fig. 4B, lane 3) when only tRNA was added. The
proposed parE and parC start sites are indicated
on the respective DNA sequences in Fig. 5, along with the 10 and 35
promoter sequences and the position of the predicted translation start
sites.
View larger version (48K):
[in this window]
[in a new window]
|
FIG. 4.
Identification of transcription start sites for the
parE and parC genes. (A) S1 nuclease protection
of the parE transcript. Lanes: 1, probe plus 100 µg of
CB15 RNA; 2, probe plus 100 µg of CB15 RNA plus S1 nuclease; 3, probe
plus 100 µg of yeast tRNA plus S1 nuclease. The transcription start
site is indicated. (B) S1 nuclease protection of the parC
transcript. Lanes: 1, probe plus 100 µg of CB15 RNA; 2, probe plus
100 µg of CB15 RNA plus S1 nuclease; 3, probe plus 100 µg of yeast
tRNA plus S1 nuclease. The transcription start sites are indicated.
|
|
To determine the extent of the functional
parE and
parC promoters, we constructed a series of deletions 5' to
the respective
transcriptional start sites, as diagrammed in Fig.
5, and assayed
their effect on promoter
activity by using transcription fusions
to the
lacZ reporter
gene (see Materials and Methods). The three
deletions constructed for
each
parE and
parC resulted in little
or no
reduction of
-galactosidase activity compared to the full-length
promoter fragments starting at the 5'
XhoI (
parE)
and
PstI (
parC)
sites (Fig.
5). These results
indicate that all sequence elements
required for transcriptional
regulation lie within 141 bp 5' of
the
parE transcriptional
start and within 118 bp of the
parC transcriptional
start
site.
View larger version (40K):
[in this window]
[in a new window]
|
FIG. 5.
Sequence of parE and parC promoter
regions and fusion junctions to the lacZ reporter gene. (A)
Nucleotide sequence of the parE gene promoter region. (B)
Nucleotide sequence of the parC gene promoter region. The 5'
ends of promoter deletion constructs are indicated by arrows followed,
in parentheses, by their position relative to +1, and the promoter
activity relative to the activity of the full-length fragment (100 U)
(see text and Materials and Methods). An asterisk indicates
transcription initiation sites. Restriction sites, 35 and 10
sequences, translation stop codons and transcription initiation sites
are underlined. Transcription and translation initiation sequences are
in boldface. The translated ParE and ParC sequences are given above the
nucleotide sequence. The "..." represents a gap in the presented
sequence, and is followed by the sequence of the transcriptional fusion
junction to the lacZ reporter construct.
|
|
parE and parC promoter analysis and effect
of site-directed mutations.
As shown in Fig.
6, we aligned the parE and
parC promoters with those of other genes that are required
for DNA replication in C. crescentus and display a pattern
of cell cycle-regulated transcription similar to these topo IV genes.
The 10 and 35 sequences of the seven promoters display some
similarity to the C. crescentus 73-dependent
promoters (Fig. 6) (19).
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 6.
Alignment of parE and parC gene
promoters with other C. crescentus gene promoters and to the
73 consensus recognition sequence (Fig. 6)
(19). Bases matching the consensus sequence are underlined.
N = any base; S = C/G; W = A/T; Y = C/T. The
references for promoter sequences and transcriptional start sites are
as follows: dnaA (45), dnaN and
dnaX (36, 42), dnaK (1a),
and gyrB (35, 36).
|
|
We also examined the
parE and
parC promoters for
two conserved sequence elements previously reported in
C. crescentus replication
genes. One of these, a 13-mer sequence with
the consensus of ynCnCTCCGCnCs,
is located most frequently in the
10,
35 spacer region (
42).
The second, an 8-mer motif with a
consensus of GnnTTTCG, is found
at various locations within these
promoters (
36). Although we
were unable to identify a
sequence corresponding to the 13-mer
(Fig.
6), the
10,
35 spacers
of
parE and
parC contain a sequence
corresponding
to the 8-mer consensus (Fig.
6). Because
parE is
under
strong cell cycle regulation, we examined the contribution
of this
8-mer sequence to the transcriptional activity of the
parE
promoter in vivo. Site-directed mutagenesis was used to change
four
conserved residues (TTCG) in this sequence without changing
the
10,
35 spacing (pDW503; Table
1). The activity of the mutated
promoter
was decreased more than threefold, which suggests that
the sequence
mutated, and presumably the 8-mer sequence, is involved
in the positive
regulation of
parE promoter
activity.
To identify residues within the
10 and
35 elements of the
parE and
parC promoters responsible for
determining transcriptional
activity in vivo, we introduced mutations
designed to make each
promoter either more or less like the proposed
73 promoter consensus sequence (Table
1). The
10
sequence elements
conform more closely to the
73
consensus than the
35 elements, with the strongest conservation
in
the first five or six residues of the
10 element (Fig.
6)
(
19). Site-directed mutations that changed any of the first
five bases of the
10 element in either the
parE (pDW511
and pDW504)
or the
parC (pDW500) promoter resulted in
changes in transcriptional
activity predicted from the
10 consensus
(Table
1). Transcription
was decreased substantially in constructs
pDW500(
parC) and pDW504(
parE),
which change
residues away from the
10 consensus sequence (Table
1).
Significantly, the activity of the
parC construct pDW500
was
reduced to levels equivalent to those of the promoterless
control
construct (pRKlac290), effectively eliminating transcriptional
activity. The activity of
parE construct pDW504 was reduced
to
50% of wild-type levels. The one mutation in this set of three
constructs that was toward consensus (pDW511;
parE) resulted
in
an increased rate of transcription (Table
1). The transcriptional
activity of the two site-directed mutations altering the last
two bases
of the
10 element, which is not strongly conserved
at these
positions, had either a small effect (pDW508;
parC) or
was
not consistent with the predicted effect (pDW518;
parE).
Mutations in the less-well-conserved
35 sequence elements of
parE and
parC generally resulted either in small
effects on
transcription or changes that did not conform to those
expected
from the
73 consensus sequence. In the
parE promoter, two changes toward
consensus (pDW514 and
pDW509) resulted in somewhat reduced transcription,
while changes away
from consensus resulted in either little change
(pDW510) or in
increased transcription (pDW506; Table
1). Similar
results were
obtained for mutations in the
parC 35 sequence element,
in
which one mutation away from consensus (pDW502) increased transcription
and a second mutation toward consensus (pDW501) produced little
change
(Table
1).
| |
DISCUSSION |
We have examined the cell cycle regulation of the
parE and parC genes, which encode the subunits of
the Caulobacter DNA topo IV. Our results show that
transcription of the two genes is induced during the
swarmer-to-stalked-cell transition when cells prepare for initiation of
DNA synthesis. The expression of parE and parC is
not strictly coordinated, however. The rate of parE
transcription (Fig. 1) is much more strongly regulated in the cell
cycle than that of parC (Fig. 2). The pattern of
parE promoter activation in the G1-to-S phase of
the cell cycle is similar to that of several other genes involved in
DNA replication and repair (summarized in reference
36). However, the promoter architecture of
parE and parC diverges in some respects from this
group of replication-related genes. The topo IV genes do not contain
the conserved 13-mer sequence, which has been proposed to function as a
negative regulatory element in the dnaX promoter
(42), but they do contain a conserved 8-mer sequence. We
provide genetic evidence that this 8-mer sequence, whose function has
not been previously reported, is required for maximum transcription
from the parE promoter. We speculate that this sequence
element may function as a positive regulatory element involved in the
cell cycle regulation of this specialized set of replication genes.
parE transcription is induced more than 20-fold during the
swarmer-to-stalked-cell transition (Fig. 1A), compared to a two- to
threefold increase in parC transcription (Fig. 2A). The
parE gene was also regulated in synchronous stalked cells,
where its transcription was induced ca. fivefold very early in the cell cycle. We attribute the small increase in parC transcription
in the stalked cell cycle to the effect of the synchronization protocol (compare Fig. 2B and 1B). These results suggest that topo IV activity may be regulated in part through parE expression. Consistent
with this possibility is the regulation of ParE protein levels during the swarmer cell cycle. ParE increased ca. twofold after the
swarmer-to-stalked-cell transition (Fig. 3A), while no change in the
levels of ParC during the cell cycle could be detected (Fig. 3B).
Recent localization experiments in Bacillus subtilis show
that ParC protein displays a bipolar localization pattern consistent with the suggestion that the topo IV subunits may function as part of a
membrane-associated apparatus involved in chromosome segregation
(11). Although ParE protein appears to be distributed throughout the B. subtilis cytoplasm, the polar localization
of ParC depends on ParE function. In the absence of ParE, polar
localization of ParC is abolished and ParC instead colocalizes with the
nucleoid. These results may reflect a dynamic pattern of ParC
localization or perhaps the fact that only a subpopulation of the ParC
and ParE complex is involved in polar localization (11). Our
results with Caulobacter do not address the question of
subcellular localization of ParC and ParE; however, the results of
Huang et al. (11) are consistent with the possibility that
topo IV activity in Caulobacter may be regulated by the
availability or activity of ParE during the cell cycle.
Many cell cycle and developmental events in Caulobacter are
regulated at the level of transcription initiation. In eubacteria, the
specificity of promoter recognition by RNA polymerase can be conferred
by specialized sigma factor binding to the core RNA polymerase to
reprogram RNA polymerase specificity (reviewed in reference
9). Thus, in the Caulobacter flagellar
gene hierarchy, which contains four classes of genes (I to IV; reviewed
in reference 43), transcription of the late class
III and IV flagellar genes requires the specialized sigma factor
54 and the transcriptional activator FlbD, which are
encoded by class II genes. By contrast, the early class II flagellar
genes, which contain noncanonical 73-dependent promoters
(44), depend on the transcriptional regulator CtrA for
activation in vivo (33) and in vitro (44).
Alignment of the putative topo IV gene promoters with those of
dnaA (45), dnaN and dnaX
(42), gyrB (36), and dnaK
(1a), reveal some similarity to the 73
consensus. Mutagenesis of the 10 sequence elements of parE
and parC generally yielded results expected of promoters
recognized by 73 (Table 1). By contrast, mutational
analysis of the less-well-conserved 35 sequence elements of
parE and parC did not yield expected results
(Table 1). One explanation for the latter results is that the
parE and parC promoters are recognized by an
alternative sigma factor with a 10 recognition sequence similar to
that of 73. An alternative explanation, which we favor,
is that the poorly conserved 35 elements reflect the requirement of
an auxiliary regulatory factor(s) necessary for efficient transcription
and cell cycle regulation of these 73-dependent
promoters. Since these promoters display a pattern of cell
cycle-regulated transcription that is markedly different from
CtrA-dependent genes and the promoters do not contain sequences conforming to the TTAAC direct repeat of the CtrA binding site (33), another transcription factor would presumably be
required. As discussed below, the analysis of the 8-mer sequence in the parE promoter is consistent with this possibility.
Among the promoters aligned in Fig. 6, two features distinguish the
parE and parC sequences. One is the spacing
between the 10, 35 elements, which is 15 to 16 bp compared to the
10- to 14-bp spacing typical of 73-dependent
housekeeping promoters (19). The second is the absence of an
identifiable 13-mer motif. This sequence, which is present in the other
cell cycle-regulated promoters, has been suggested as a possible
repressor binding site in dnaX (42). All of the promoters contain the previously described 8-mer motif (Fig. 6) (36) in various positions, however. The 8-mer motif appears to be required for efficient transcription from the parE
promoter (Table 1), a result that is consistent with a positive
regulatory role for this sequence. It remains to be determined if the
8-mer and 13-mer motifs are binding sites for auxiliary regulatory
proteins involved in the cell cycle regulation of genes containing
these sequences.
| |
ACKNOWLEDGMENTS |
We are grateful to Noriko Ohta for advice and encouragement, to
Heping Jiang for valuable assistance in the preparation of media used
in these experiments, and to Teresa Slover for her indispensable help
in editing and assembling this manuscript.
This work was supported in part by Public Health Service grant GM22299
from the National Institutes of Health to A.N. and by National
Institutes of Health Cellular and Molecular Biology Pre-doctoral
Training grant 5-T326M07312 to D.V.W.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology, Princeton University, Princeton, NJ 08544. Phone: (609) 258-3854. Fax: (609) 258-6175. E-mail:
anewton{at}molbio.princeton.edu.
Present address: Department of Plant and Microbial Biology,
University of California, Berkeley, Berkeley, CA 94720.
| |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. Kingston, and D. Moore (ed.).
1995.
Short protocols in molecular biology, 3rd ed.
John Wiley and Sons, Inc., New York, N.Y.
|
| 1a.
|
Avedissian, M.,
D. Lessing,
J. W. Gober,
L. Shapiro, and S. L. Gomes.
1995.
Regulation of the Caulobacter crescentus dnaKJ operon.
J. Bacteriol.
177:3479-3484[Abstract/Free Full Text].
|
| 2.
|
Berk, J. A., and P. A. Sharp.
1977.
Sizing and mapping of early adenovirus mRNAs by gel electrophoresis of S1 endonuclease-digested hybrids.
Cell
12:721-732[Medline].
|
| 3.
|
Brun, Y. V.,
G. Marczynski, and L. Shapiro.
1994.
The expression of asymmetry during Caulobacter cell differentiation.
Annu. Rev. Biochem.
63:419-450[Medline].
|
| 4.
|
Ching, Y.,
T. Dinh, and R. K. Beran.
1988.
Multiple promoters for transcription of the Escherichia coli DNA topoisomerase I gene and their regulation by DNA supercoiling.
J. Mol. Biol.
202:735-742[Medline].
|
| 5.
|
Degnen, S. T., and A. Newton.
1972.
Chromosome replication during development in Caulobacter crescentus.
J. Mol. Biol.
64:671-680[Medline].
|
| 6.
|
Domian, I. J.,
K. C. Quon, and L. Shapiro.
1997.
Cell type-specific phosphorylation and proteolysis of a transcriptional regulator controls the G1-to-S transition in a bacterial cell cycle.
Cell
90:415-424[Medline].
|
| 7.
|
Evinger, M., and N. Agabian.
1977.
Envelope-associated nucleoid from Caulobacter crescentus stalked and swarmer cells.
J. Bacteriol.
132:294-301[Abstract/Free Full Text].
|
| 8.
|
Gober, J. W., and L. Shapiro.
1992.
A developmentally regulated Caulobacter flagellar promoter is activated by 3' enhancer and IHF binding elements.
Mol. Biol. Cell.
3:913-926[Abstract].
|
| 9.
|
Haldenwang, W. G.
1995.
The sigma factors of Bacillus subtilis.
Microbiol. Rev.
59:1-30[Abstract/Free Full Text].
|
| 10.
|
Hecht, G. B.,
T. Lane,
N. Ohta,
J. N. Sommer, and A. Newton.
1995.
An essential single domain response regulator required for normal cell division and differentiation in Caulobacter crescentus.
EMBO J.
14:3915-3924[Medline].
|
| 11.
|
Huang, W. M.,
J. L. Libbey,
P. van der Hoeven, and S. X. Yu.
1998.
Biopolar localization of Bacillus subtilis topoisomerase IV, an enzyme required for chromosome segregation.
Proc. Natl. Acad. Sci. USA
95:4652-4657[Abstract/Free Full Text].
|
| 12.
|
Johnson, R. C., and B. Ely.
1977.
Isolation of spontaneously derived mutants of Caulobacter crescentus.
Genetics
86:25-32[Abstract/Free Full Text].
|
| 13.
|
Johnston, R. F.,
S. C. Pickett, and D. L. Barker.
1990.
Autoradiography using storage phosphor technology.
Electrophoresis
11:355-360[Medline].
|
| 14.
|
Kato, J.,
Y. Nishimura,
R. Imamura,
H. Niki,
S. Hiraga, and H. Suzuki.
1990.
New topoisomerase essential for chromosome segregation in E. coli.
Cell
63:393-404[Medline].
|
| 15.
|
Kato, J.,
Y. Nishimura,
M. Yamada,
H. Suzuki, and Y. Hirota.
1988.
Gene organization in the region containing a new gene involved in chromosome partition in Escherichia coli.
J. Bacteriol.
170:3967-3977[Abstract/Free Full Text].
|
| 16.
|
Kornacker, M., and A. Newton.
1994.
Information essential for cell-cycle-dependent secretion of the 591-residue Caulobacter hook protein is confined to a 21-amino-acid residue sequence near the N-terminus.
Mol. Microbiol.
14:73-85[Medline].
|
| 17.
|
Luttinger, A.
1995.
The twisted `life' of DNA in the cell: bacterial topoisomerases.
Mol. Microbiol.
15:601-606[Medline].
|
| 18.
|
Luttinger, A. L.,
A. L. Springer, and M. B. Schmid.
1991.
A cluster of genes that affects nucleoid segregation in Salmonella typhimurium.
New Biol.
3:687-697[Medline].
|
| 19.
|
Malakooti, J.,
S. P. Wang, and B. Ely.
1995.
A consensus promoter sequence for Caulobacter crescentus genes involved in biosynthesis and housekeeping function.
J. Bacteriol.
177:4372-4376[Abstract/Free Full Text].
|
| 20.
|
Menzel, R., and M. Gellert.
1987.
Fusions of the Escherichia coli gyrA and gyrB control regions to the galactokinase gene are inducible by coumermycin treatment.
J. Bacteriol.
169:1272-1278[Abstract/Free Full Text].
|
| 21.
|
Menzel, R., and M. Gellert.
1983.
Regulation of the genes for E. coli DNA gyrase: homeostatic control of DNA supercoiling.
Cell
34:105-113[Medline].
|
| 22.
|
Miller, J. H.
1972.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 23.
|
Mullin, D. A., and A. Newton.
1989.
Ntr-like promoters and upstream regulatory sequence ftr are required for transcription of a developmentally regulated Caulobacter crescentus flagellar gene.
J. Bacteriol.
171:3218-3227[Abstract/Free Full Text].
|
| 24.
|
Newton, A., and N. Ohta.
1990.
Regulation of the cell division cycle and differentiation in bacteria.
Annu. Rev. Microbiol.
44:689-719[Medline].
|
| 25.
|
Ohta, N.,
L. S. Chen,
E. Swanson, and A. Newton.
1985.
Transcriptional regulation of a periodically controlled flagellar gene operon in Caulobacter crescentus.
J. Mol. Biol.
186:107-115[Medline].
|
| 26.
|
Ohta, N.,
M. Masurekar, and A. Newton.
1990.
Cloning and cell cycle-dependent expression of DNA replication gene dnaC from Caulobacter crescentus.
J. Bacteriol.
172:7027-7034[Abstract/Free Full Text].
|
| 27.
|
Ohta, N., and A. Newton.
1996.
Signal transduction in the cell cycle regulation of Caulobacter differentiation.
Trends Microbiol.
4:326-332[Medline].
|
| 28.
| Ohta, N., and A. Newton. Unpublished results.
|
| 29.
|
Ohta, N.,
A. J. Ninfa,
A. D. Allaire,
L. Kulick, and A. Newton.
1997.
Identification, characterization and chromosomal organization of cell division cycle genes in Caulobacter crescentus.
J. Bacteriol.
179:2169-2180[Abstract/Free Full Text].
|
| 30.
|
Ohta, N.,
E. Swanson,
B. Ely, and A. Newton.
1984.
Physical mapping and complementation analysis of transposon Tn5 mutations in Caulobacter crescentus: organization of transcriptional units in the hook gene cluster.
J. Bacteriol.
158:897-904[Abstract/Free Full Text].
|
| 31.
|
Paul, K. S.,
A. A. Bogan, and G. M. Waters.
1998.
Phosphatidylinositol transfer protein (PITP ) stimulates in vitro intra-Golgi transport.
FEBS Lett.
431:91-96[Medline].
|
| 32.
|
Poindexter, J. S.
1964.
Biological properties and classification of the Caulobacter group.
Bacteriol. Rev.
28:231-295[Free Full Text].
|
| 32a.
|
QIAGEN Incorporated.
1996.
The QIAexpressionist, 2nd ed.
QIAGEN Inc., Valencia, Calif.
|
| 33.
|
Quon, K. C.,
G. T. Marczynski, and L. Shapiro.
1996.
Cell cycle control by an essential bacterial two-component signal transduction protein.
Cell
84:83-93[Medline].
|
| 34.
|
Quon, K. C.,
B. Yang,
I. J. Domian,
L. Shapiro, and G. T. Marczynski.
1998.
Negative control of bacterial DNA replication by a cell cycle regulatory protein that binds at the chromosome origin.
Proc. Natl. Acad. Sci. USA
95:120-125[Abstract/Free Full Text].
|
| 35.
|
Rizzo, M. F.,
L. Shapiro, and J. Gober.
1993.
Asymmetric expression of the gyrase B gene from the replication-competent chromosome in the Caulobacter crescentus predivisional cell.
J. Bacteriol.
175:6970-6981[Abstract/Free Full Text].
|
| 36.
|
Roberts, R. C., and L. Shapiro.
1997.
Transcription of genes encoding DNA replication proteins is coincident with cell cycle control of DNA replication in Caulobacter crescentus.
J. Bacteriol.
179:2319-2330[Abstract/Free Full Text].
|
| 37.
|
Schmid, M. B.
1990.
A locus affecting nucleoid segregation in Salmonella typhimurium.
J. Bacteriol.
172:5416-5424[Abstract/Free Full Text].
|
| 38.
|
Sheffery, M., and A. Newton.
1981.
Regulation of periodic protein synthesis in the cell cycle: control of initiation and termination of flagellar gene expression.
Cell
24:49-57[Medline].
|
| 39.
|
Slauch, J. M., and T. J. Silhavy.
1991.
cis-acting ompF mutations that result in OmpR-dependent constitutive expression.
J. Bacteriol.
173:4039-4048[Abstract/Free Full Text].
|
| 40.
|
Sommer, J. M., and A. Newton.
1988.
Sequential regulation of developmental events during polar morphogenesis in Caulobacter crescentus: assembly of pili on swarmer cells requires cell separation.
J. Bacteriol.
170:409-415[Abstract/Free Full Text].
|
| 41.
|
Ward, D., and A. Newton.
1997.
Requirement of topoisomerase IV parC and parE genes for cell cycle progression and developmental regulation in Caulobacter crescentus.
Mol. Microbiol.
26:897-910[Medline].
|
| 42.
|
Winzeler, E., and L. Shapiro.
1996.
A novel promoter motif for Caulobacter cell cycle-controlled DNA replication genes.
J. Mol. Biol.
264:412-425[Medline].
|
| 43.
|
Wu, J., and A. Newton.
1997.
Regulation of the Caulobacter flagellar gene hierarchy; not just for motility.
Mol. Microbiol.
24:233-240[Medline].
|
| 44.
|
Wu, J.,
N. Ohta, and A. Newton.
1998.
An essential, multicomponent signal transduction pathway required for cell cycle regulation in Caulobacter.
Proc. Natl. Acad. Sci. USA
95:1443-1448[Abstract/Free Full Text].
|
| 45.
|
Zweiger, G., and L. Shapiro.
1994.
Expression of Caulobacter dnaA as a function of the cell cycle.
J. Bacteriol.
176:401-408[Abstract/Free Full Text].
|
Journal of Bacteriology, June 1999, p. 3321-3329, Vol. 181, No. 11
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wang, S. C., Shapiro, L.
(2004). The topoisomerase IV ParC subunit colocalizes with the Caulobacter replisome and is required for polar localization of replication origins. Proc. Natl. Acad. Sci. USA
101: 9251-9256
[Abstract]
[Full Text]
Top
Abstract
Introduction
