Previous Article | Next Article ![]()
Journal of Bacteriology, June 1999, p. 3478-3485, Vol. 181, No. 11
Department of Microbiology and Molecular
Genetics1 and Department of Entomology
and Plant Pathology,2 Oklahoma State University,
Stillwater, Oklahoma 74078, and Department of Microbiology
and Immunology, University of Illinois College of Medicine,
Chicago, Illinois 606123
Received 5 January 1999/Accepted 24 March 1999
Both Pseudomonas aeruginosa and the phytopathogen
P. syringae produce the exopolysaccharide alginate.
However, the environmental signals that trigger alginate gene
expression in P. syringae are different from those in
P. aeruginosa with copper being a major signal in P. syringae. In P. aeruginosa, the alternate sigma
factor encoded by algT ( The exopolysaccharide alginate is a
copolymer of O-acetylated A region mapping at 68 min on the P. aeruginosa
chromosome harbors a gene cluster consisting of algT
(algU), mucA, mucB (algN), mucC, and mucD. These genes modulate the
conversion to constitutive alginate production; at the head of this
regulatory hierarchy is algT (algU). The
alternative sigma factor encoded by algT, Other genes controlling the regulation of alginate production include
algR1 (algR), algR2 (algQ),
algR3 (algP), and algB (20, 53). AlgR1 functions as a response regulator member of the
two-component signal transduction system and binds to multiple sites
upstream of algC and algD (12, 24, 39,
65). Both the algD and algR1 promoters show
a consensus sequence at the Like P. aeruginosa, phytopathogenic strains of
P. syringae are normally nonmucoid in vitro. Kidambi et
al. (28) previously showed that exposure to copper ions
stimulated alginate production in selected strains of P. syringae. Furthermore, an indigenous plasmid designated pPSR12
conferred constitutive alginate production to P. syringae pv. syringae FF5. pPSR12 does not contain homologs of the
biosynthetic or regulatory genes which control alginate production in
P. aeruginosa; instead this plasmid presumably contains regulatory genes which remain uncharacterized (28).
Mutagenesis of FF5(pPSR12) with Tn5 resulted in the
isolation of alginate-defective (Alg In the present study, the Alg Bacterial strains, plasmids, and media.
Table
1 lists the bacterial strains and
plasmids used in the present study. Pseudomonas spp. were
routinely maintained at 28°C on King's medium B (29),
mannitol-glutamate (MG) medium (25), or MG medium
supplemented with yeast extract at 0.25 g/liter (MGY);
Escherichia coli strains were grown on Luria-Bertani (LB) medium (36) at 37°C. Antibiotics were added to the media
at the following concentrations: ampicillin, 100 µg/ml; tetracycline, 25 µg/ml; kanamycin, 25 µg/ml; spectinomycin, 25 µg/ml;
streptomycin, 25 µg/ml; piperacillin, 250 µg/ml; and
chloramphenicol, 25 µg/ml.
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Regulation of Alginate Biosynthesis in
Pseudomonas syringae pv. syringae
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
22) and the response
regulator AlgR1 are required for transcription of algD, a
gene which encodes a key enzyme in the alginate biosynthetic pathway.
In the present study, we cloned and characterized the gene encoding
AlgR1 from P. syringae. The deduced amino acid sequence of
AlgR1 from P. syringae showed 86% identity to its P. aeruginosa counterpart. Sequence analysis of the region flanking
algR1 in P. syringae revealed the presence of
argH, algZ, and hemC in an arrangement virtually identical to that reported in P. aeruginosa. An algR1 mutant, P. syringae
FF5.32, was defective in alginate production but could be complemented
when algR1 was expressed in trans. The
algD promoter region in P. syringae
(PsalgD) was also characterized and shown to diverge
significantly from the algD promoter in P. aeruginosa. Unlike P. aeruginosa, algR1
was not required for the transcription of algD in P. syringae, and PsalgD lacked the consensus sequence
recognized by AlgR1. However, both the algD and
algR1 upstream regions in P. syringae contained the consensus sequence recognized by
22, suggesting that
algT is required for transcription of both genes.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-1,4-linked D-mannuronic acid
and its C-5 epimer, L-guluronic acid (46).
Alginate biosynthesis has been extensively studied in Pseudomonas
aeruginosa, where it functions as a major virulence factor in
strains infecting the lungs of cystic fibrosis patients (45). In P. aeruginosa, genes that encode
the biosynthesis and regulation of alginate map to four chromosomal
locations. With the exception of algC, which is located at
10 min, the structural genes are clustered within an 18-kb region
located at 34 min (18, 46). Structural genes that have been
characterized in this region include algA, which encodes a
bifunctional enzyme which functions as a phosphomannose isomerase and a
GDP-mannose pyrophosphorylase (54); algG, which
encodes a C-5 epimerase (7); algF,
algI, and algJ, which are involved in acetylation
of the alginate polymer (16, 17, 55); and algD,
which encodes GDP-mannose dehydrogenase (11). This region
also contains algE and algK, which encode proteins with putative roles in polymer export and synthesis, respectively (1, 9, 22), and algL, which encodes
alginate lyase (6, 49). Other genes which map within this
region include alg44, alg8, and algX
(alg60) (33, 41, 60); however, the functional
role of the proteins encoded by these genes remains unclear. Chitnis
and Ohman (8) postulated that the alginate biosynthetic gene
cluster in P. aeruginosa is organized as an operon with
transcription initiating at the algD promoter.
22,
is required for transcription of algD, algT, and
algR1 (21, 51). mucA is a negative
regulator of algT transcription and encodes an antisigma
factor with affinity for
22 (52, 62).
Mutations in mucA inactivate the MucA protein and result in
the Alg+ phenotype; however, these mutations are unstable
and spontaneous reversion to the Alg
phenotype often
occurs due to suppressor mutations in algT (14, 50,
52). The remaining muc genes also modulate the
expression of algT and have been described elsewhere
(19, 34, 52, 62).
35/10 region which is consistent with
recognition by
22, suggesting that an RNA
polymerase-
22 complex binds to both promoters and
positively regulates transcription (51).
) mutants, including
FF5.31 and FF5.32 (28). The Tn5 insertion in
FF5.31 was located in algL, which encodes alginate lyase.
Alginate production in FF5.31 was restored by pSK2, a cosmid clone
containing homologues of algD, alg8,
alg44, algG, algX, algL,
algF, and algA. The order and arrangement of the
alginate structural gene cluster were virtually identical to those
previously described for P. aeruginosa. Complementation
analyses, however, indicated that the structural gene clusters in
P. aeruginosa and P. syringae were
not functionally interchangeable when expressed from their native
promoters (44).
mutant FF5.32 was shown to
contain a Tn5 insertion in algR1. Unlike
P. aeruginosa, expression from the P. syringae algD promoter (PsalgD) did not require a functional copy of algR1. Nucleotide sequence analysis
indicated that PsalgD did not contain recognizable AlgR1
binding sites, which helps explain the differential regulation of
alginate gene expression in P. aeruginosa and
P. syringae.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Bacterial strains and plasmids used in this study
Molecular genetic techniques. Plasmid DNA was isolated from Pseudomonas spp. by alkali lysis (48). Restriction enzyme digests, agarose gel electrophoresis, Southern transfers, and isolation of DNA fragments from agarose gels were performed by standard methods (48). Genomic DNA was isolated from P. syringae by established procedures (56), and a total genomic library of FF5.32 was constructed in pRK7813 as described previously (2). Clones were mobilized into nonmucoid recipient strains by using a triparental mating procedure and the mobilizer plasmid pRK2013 (4).
DNA fragments were isolated from agarose gels by electroelution (48) and labelled with digoxigenin (Genius labelling and detection kit; Boehringer Mannheim, Indianapolis, Ind.) or with [
-32P]dCTP by using the Rad Prime DNA Labeling System
(Gibco BRL, Gaithersburg, Md.). Hybridizations and posthybridization
washes were conducted under high-stringency conditions (57).
Isolation and quantitation of alginate. Selected strains were inoculated by dilution streaking to MGY agar (three plates per strain) and incubated at 28°C for 72 h. Each plate was handled separately for quantification of alginate. The cells were washed from each plate and resuspended in 0.9% NaCl. Removal of cellular material from the mucoid growth and estimation of the alginate content and total cellular protein were performed as described previously (35). Alginic acid from seaweed (Macrocystis pyrifera; Sigma Chemical Co., St. Louis, Mo.) was used as a standard in these experiments. Mean values of three replicate determinations were expressed as micrograms of alginate per milligram of protein.
Construction of transcriptional fusions.
PsalgD was
initially cloned in pCR2.1 as a 2.7-kb PCR product. Plasmid pSK2 was
used as template, and the following oligonucleotides were used as
primers: forward primer, 5' TGGTGCTGGAAATATCCACACC (located
100 bp downstream of the presumed translational start site of
algD [P1 in Fig. 1A]); and
reverse primer, 5' AATTCTGCCAGTCCAGCCACTGAC (P2 in Fig. 1A).
Following amplification of the 2.7-kb PCR product, ligation in pCR2.1,
and transformation into E. coli DH5
, plasmid pAPD was
recovered. The promoter probe construct, pBBR.Gus, which contains a
promoterless glucuronidase gene (uidA) downstream of the
polylinker in pBBR1MCS (43), was used to more precisely define the promoter region upstream of algD. pAPD was
digested with HindIII and EcoRV, and the
2.7-kb insert was isolated, end-filled with Klenow, and ligated into
pBBR.Gus. Transformants were selected on LB agar containing
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
and chloramphenicol, and pAPDP was found to contain the algD::uidA fusion in the
transcriptionally active orientation.
|
GUS assays. Transcriptional activity was initially screened by spotting bacterial suspensions (absorbance at 600 nm of 0.1) on MG agar medium amended with spectinomycin and 20 µg of X-Gluc (5-bromo-4-chloro-3-indolylglucuronide) per ml; the plates were then incubated at 28°C for 24 to 72 h. Glucuronidase (GUS) activity was quantified by fluorometric analysis of cells grown for 18 to 20 h in 3 ml of MG medium. Fluorescence was monitored with a Fluoroscan II version 4.0 microplate reader (ICN Biomedicals, Inc., Costa Mesa, Calif.) in 96-well microtiter plates. GUS activity was expressed in units per milligram of protein, with 1 U being equivalent to 1 nmol of methylumbelliferone formed per min. Values presented for GUS activity represent the average of three replicates per experiment. When significant differences in GUS activity were detected, the experiment was repeated.
DNA sequencing and analysis.
Nucleotide sequencing reactions
were performed by the dideoxynucleotide method with AmpliTaq
DNA polymerase (Perkin-Elmer, Foster City, Calif.). Automated DNA
sequencing was performed with an ABI 373A apparatus and the ABI PRISM
Dye Primer cycle-sequencing kit (Perkin-Elmer). Automated sequencing
was provided by the Oklahoma State University Recombinant DNA/Protein
Resource Facility. The Tn5 insertion in FF5.32 was localized
by sequencing the DNA flanking the transposon by using the
oligonucleotide 5' GGTTCCGTTCAGGACGCTAC, which is derived
from the border region of IS50. Sequence data were aligned
and homology searches were executed by using the University of
Wisconsin Genetics Computer Group (UWGCG) sequence analysis package,
version 9.0. Sequences associated with
22 and AlgR1
binding were located by using the MOTIFS program included with the
UWGCG software.
Nucleotide sequence accession numbers. The nucleotide sequences described in this study were deposited in GenBank under accession no. AF131199 (fimS-algR1-hemC) and AF131068 (PsalgD).
| |
RESULTS |
|---|
|
|
|---|
Location of Tn5 insertion in FF5.32. A genomic library of FF5.32 was constructed in pRK7813, and a clone containing the Tn5 insertion from FF5.32 was recovered and designated pAP32. The internal BamHI site in Tn5 and 2.5 kb of FF5.32 DNA were cloned from pAP32 into pBluescript SK(+), resulting in a clone named pAP32.1 (Fig. 2). A primer specific for the border region of IS50 was used to sequence approximately 300 bp of FF5.32 DNA flanking the Tn5 insertion site. This sequence showed 76% nucleotide identity to algR1 from P. aeruginosa, and the Tn5 insertion was located at nucleotide 51 of algR1 from P. aeruginosa (12).
|
Cloning of algR1 from P. syringae. A genomic library of P. syringae pv. syringae FF5(pPSR12) was previously constructed in pRK7813 (44). In the current study, the 2.3-kb HindIII-EcoRI fragment from pAP32.1 (Fig. 2) was used to screen the library for clones containing the complete algR1 coding region. Seven cosmid clones hybridized with the probe; two clones designated pMF4 and pMF6 were chosen for further study and contained a 2.7-kb EcoRI fragment which hybridized with the probe. This fragment was subcloned from pMF6 in pBluescript SK(+), resulting in pMF6.1 (Fig. 2). Sequence information for pMF6.1 was generated with the T7 and T3 primers and indicated that this fragment contained DNA homologous to argH, fimS, and algR1. In previous studies, the fimS gene showed relatedness to sensor kinases of two-component systems and mapped immediately upstream of algR1 in P. aeruginosa (61). It is important to note that fimS, which was also named algZ (63), is distinct from the algZ described by Baynham and Wozniak (3). To avoid further confusion in nomenclature, the name "fimS" will be used hereafter to describe the sensor kinase which maps adjacent to algR1. In P. syringae, argH, which encodes arginosuccinate lyase, mapped adjacent to fimS; in P. aeruginosa, argH was divergently transcribed with respect to both fimS and algR1 (37, 63). Sequence analysis of pMF6.1 indicated that this arrangement is conserved in P. syringae (Fig. 2).
Sequence analysis indicated that pMF6.1 contained 560 bp of algR1 but lacked approximately 180 bp located at the 3' end. Southern blot analysis of pMF6 and pMF6.1 suggested that the intact algR1 was probably contained in a 2.0-kb PstI fragment; this was subcloned in pBluescript SK(+) and designated pMF6.2 (Fig. 2). pMF6.2 was completely sequenced on both strands and shown to contain DNA homologous to the 3' end of fimS (585 bp), an intact copy of algR1 (747 bp), and the 5' end of hemC (432 bp). In P. aeruginosa, hemC encodes porphobilinogen deaminase and maps adjacent to algR1 (40). The P. syringae homologues showed a high degree of relatedness to the corresponding P. aeruginosa genes; for example, nucleotide identity between fimS, algR1, and hemC in the two species was 88, 84, and 80%, respectively. Furthermore, the algR1 homologue in P. syringae showed extensive relatedness (86 to 88% nucleotide identity) to algR from Azotobacter vinelandii (42) and to pprA, an algR1 homologue in P. putida (59). In P. aeruginosa, AlgR1 contains two aspartate residues (D54 and D85) which have been suggested to function as phosphorylation sites (32, 61); both aspartate residues were present in the predicted translation product of algR1 from P. syringae. A consensus sequence for
22
was located 108 bp upstream of the algR1 translational
start site, a location which is also conserved in P. aeruginosa (63).
Complementation experiments.
pMF4 and pMF6, the cosmid clones
containing argH, fimS, algR1, and
hemC, were evaluated for their ability to complement
P. syringae pv. syringae FF5.32 for alginate
production. Transconjugants of FF5.32 containing pMF4 or pMF6 were
visibly mucoid and produced significantly more alginate than the mutant
FF5.32 did (Table 2). Since
Tn5 frequently causes polar mutations on downstream genes,
the 2.0-kb PstI fragment in pMF6.2 was used to investigate whether the Alg
phenotype in FF5.32 was caused by the
mutation in algR1. pMF6.2 contains an intact copy of
algR1 with the cognate
22 recognition site
and truncated copies of fimS and hemC (Fig. 2).
The 2.0-kb PstI fragment in pMF6.2 was subcloned in pRK415 to form pMF6.21 and pMF6.22, which contain algR1 in the
transcriptionally active and inactive orientations with respect to the
lac promoter (Table 1). Both pMF6.21 and pMF6.22 restored
alginate production to FF5.32 (Table 2), indicating that the
Alg
phenotype of FF5.32 was caused by the Tn5
insertion in algR1. FF5.32 was complemented with both clones
irrespective of the orientation of the lac promoter and
without the addition of
isopropyl-
-D-thiogalactopyranoside (IPTG), indicating
that a functional promoter for algR1 was present on the
2.0-kb PstI fragment. To further confirm that FF5.32 was indeed an algR1 mutant, we investigated whether this mutant
could be complemented by algR1 from P. aeruginosa. Plasmid pAD1039, which contains algR1 from
P. aeruginosa (Table 1), complemented FF5.32 and
restored alginate production in the mutant to a level equivalent to
FF5(pPSR12) (data not shown).
|
Expression of the PsalgD promoter does not require
AlgR1.
In P. aeruginosa, AlgR1 is required for
expression of the algD promoter (PalgD) and has
been shown to bind PalgD at several conserved sites
(24, 39). A portion of PsalgD was previously cloned as a 1-kb fragment in the promoter probe vector, pRG960sd, creating pSK3 (PsalgD::uidA;
transcriptionally active orientation) and pSK4
(uidA::PsalgD; transcriptionally
inactive) (44). In the present study, we investigated
whether PsalgD was transcriptionally active in FF5.32, the
algR1 mutant. GUS activities in FF5(pPSR12) and
FF5.32(pSK3) were not significantly different (Table
3), indicating that a functional copy of
algR1 was not required for transcription of algD
in P. syringae.
|
Analysis of the PsalgD promoter.
To more fully
characterize the minimum sequence necessary for algD
expression in P. syringae, we constructed a
series of deletions from the 5' (EcoRV) end of the
PsalgD promoter (Fig. 1B). A new construct, pAPDP
(Fig. 1B), was designed for this purpose since the pBBR.Gus
polylinker was more amenable to deletion analysis than was the
multicloning site in pRG960sd, the vector used for construction of
pSK3. Two deletion derivatives of pAPDP, pAPDP
15 and
pAPDP
23, proved useful for delineating the algD promoter region; sequence analysis indicated that these two constructs lacked
1.5 and 2.3 kb of DNA downstream of the EcoRV site,
respectively. FF5(pPSR12, pAPDP
15) (Fig. 1B) retained the full
level of GUS activity exhibited by FF5(pPSR12, pAPDP) (Fig. 1B),
suggesting that the 1.5-kb region downstream of the EcoRV
site was dispensable for promoter activity. However, GUS activity in
FF5(pPSR12, pAPDP
23) was 3.8-fold lower than in FF5(pPSR12,
pAPDP
15), demonstrating that deletion of an additional 0.8 kb from
the 5' end of pAPDP
15 virtually eliminated PsalgD
promoter activity (Fig. 1B).
15
indicated that it contained a putative AlgT (
22)
recognition site 508 bp upstream of the predicted algD
translational start site (Fig. 3). In
this respect, PsalgD is similar to the algD
promoter in P. aeruginosa where a long, untranslated
leader sequence is located between the algD translational
start site and the
22 binding region (11,
51). However, PsalgD lacked the AlgR1 binding sites,
which are located upstream of the algD transcriptional start
in P. aeruginosa (Fig. 3) (24, 38). The
absence of these conserved motifs for AlgR1 binding could explain why
the P. syringae algD promoter does not require a
functional copy of algR1 for transcriptional activity.
|
| |
DISCUSSION |
|---|
|
|
|---|
The AlgR1 mutant characterized in the present study, FF5.32, was previously shown to be completely defective in alginate synthesis (28), thereby demonstrating that AlgR1 is absolutely required for alginate production in P. syringae. However, the role of AlgR1 in P. syringae is unclear, since this protein is not required for algD expression; it remains possible that AlgR1 is required for transcriptional activation of algC in P. syringae, which is true in P. aeruginosa (65). Alternatively, AlgR1 may function differently in P. syringae, perhaps as part of a signal transduction cascade which controls alginate production. A complex regulatory network for alginate synthesis in P. syringae seems plausible, since plasmid-encoded regulatory genes are known to mediate the constitutive production of alginate in the P. syringae strains which harbor them (28).
The organization of the region flanking AlgR1 is conserved in both
P. aeruginosa and P. syringae
(argH-fimS-algR1-hemC). In both species, the
22 recognition site preceding algR1 is
located within the 3' end of fimS (63). FimS
shows relatedness to the histidine protein kinases which function as
environmental sensors, and both AlgR1 and FimS are required for
twitching motility in P. aeruginosa, a process mediated
by type IV pili. Although type IV pili have been identified in
P. syringae (47), our efforts to demonstrate twitching motility in P. syringae pv. syringae FF5 were
completely unsuccessful; therefore, the involvement of AlgR1 in
twitching motility in P. syringae remains unclear. It
has also been proposed that FimS may function as the cognate sensor
kinase for AlgR1, but the exact role of FimS in alginate production
remains unclear (61, 63). Interestingly, phosphorylation of
AlgR1 was not required for alginate production in P. aeruginosa (32).
Sequence analysis of the algR1 and algD upstream
regions in P. syringae revealed the presence of
22 recognition sites (Fig. 3). The
22
recognition site identified in the algR1 upstream region was identical to that identified in P. aeruginosa, whereas
the
22 recognition sequence in PsalgD
differed from the corresponding sequence in P. aeruginosa by a single nucleotide (51). Although the
transcriptional start sites for algR1 and algD
were not identified in P. syringae, the positions of
the
22 recognition sites relative to the translational
start site are conserved in both species. The conservation of
22 recognition sequences upstream of
algR1 and algD strongly suggests that
transcriptional activation of these genes requires a functional copy of
algT. An algT homologue in P. syringae has recently been identified, and the role of
algT in the transcriptional activation of
algD and algR1 in P. syringae is
under investigation (27).
The percent nucleotide identity in the algD coding region of P. syringae pv. syringae and P. aeruginosa ranged from 80 to 90% (Fig. 3 and data not shown); however, upstream of the translational start site, the relatedness between the two species diverged and nucleotide identity decreased to approximately 20% (Fig. 3). This divergence is consistent with the absence of specific sequences in PsalgD which are known to be involved in transcriptional activation of algD in P. aeruginosa. These include the consensus sequences for binding AlgR1 (24), integration host factor (38), and cyclic AMP receptor protein (13). Although some signals for activation of the algD promoter are conserved in P. aeruginosa and P. syringae (5, 31, 44), the algD promoter in P. syringae is stimulated by exposure to copper ions (44) and does not require a functional copy of AlgR1 for transcriptional activation. Recently, Yu et al. (64) provided the first genetic evidence for the role of alginate in the virulence and epiphytic fitness of P. syringae. Consequently, the differential regulation of algD expression in P. syringae and CF isolates of P. aeruginosa and the marked divergence in their algD promoter regions probably reflect their adaptation to plant and human hosts, respectively.
It remains possible that some unknown regulatory protein binds to PsalgD and that this regulator recognizes different signals (such as copper) and activates the algD promoter in P. syringae. Perhaps this putative DNA binding protein was recruited during the evolutionary divergence of P. aeruginosa and P. syringae to accommodate a different signal and perhaps another activator. The algD::uidA transcriptional fusion described in the present investigation could be used to screen for mutants lacking the unknown activator. Such experiments are under way and will probably reveal additional differences in the regulation of alginate biosynthesis in human and phytopathogenic bacteria.
| |
ACKNOWLEDGMENTS |
|---|
M.F. and A.P.V. contributed equally to this paper, and both should be regarded as first authors.
M.F. acknowledges financial support from the Egyptian government for his dissertation research. C.B. acknowledges support from the Oklahoma Agricultural Experiment Station and Public Health Service grant AI 43311-01 from the National Institutes of Health. A.M.C. acknowledges support by NIH grant AI 16790-18.
We thank V. Rangaswamy and F. Alarcón-Chaidez for help with graphics and sequence analysis and V. Kapatral for providing pAD1039.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: 110 Noble Research Center, Department of Entomology and Plant Pathology, Oklahoma State University, Stillwater, OK 74078-3032. Phone: (405) 744-9945. Fax: (405) 744-7373. E-mail: cbender{at}okstate.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Aarons, S. J.,
I. W. Sutherland,
A. M. Chakrabarty, and M. P. Gallagher.
1997.
A novel gene, algK, from the alginate biosynthetic cluster of Pseudomonas aeruginosa.
Microbiology
143:641-652 |
| 2. |
Barta, T. M.,
T. G. Kinscherf, and D. K. Willis.
1992.
Regulation of tabtoxin production by the lemA gene in Pseudomonas syringae.
J. Bacteriol.
174:3021-3029 |
| 3. | Baynham, P. J., and D. J. Wozniak. 1996. Identification and characterization of AlgZ, an AlgT-dependent DNA-binding protein required for Pseudomonas aeruginosa algD transcription. Mol. Microbiol. 22:97-108[Medline]. |
| 4. |
Bender, C. L.,
S. A. Young, and R. E. Mitchell.
1991.
Conservation of plasmid DNA sequences in coronatine-producing pathovars of Pseudomonas syringae.
Appl. Environ. Microbiol.
57:993-999 |
| 5. |
Berry, A.,
J. D. DeVault, and A. M. Chakrabarty.
1989.
High osmolarity is a signal for enhanced algD transcription in mucoid and nonmucoid Pseudomonas aeruginosa strains.
J. Bacteriol.
171:2312-2317 |
| 6. | Boyd, A., M. Ghosh, T. B. May, D. Shinabarger, R. Keogh, and A. M. Chakrabarty. 1993. Sequence of the algL gene of Pseudomonas aeruginosa and purification of its alginate lyase product. Gene 131:1-8[Medline]. |
| 7. |
Chitnis, C. E., and D. E. Ohman.
1990.
Cloning of Pseudomonas aeruginosa algG, which controls alginate structure.
J. Bacteriol.
172:2894-2900 |
| 8. | Chitnis, C. E., and D. E. Ohman. 1993. Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure. Mol. Microbiol. 8:583-590[Medline]. |
| 9. | Chu, L., T. B. May, A. M. Chakrabarty, and T. K. Misra. 1991. Nucleotide sequence and expression of the algE gene involved in alginate biosynthesis by Pseudomonas aeruginosa. Gene 107:1-10[Medline]. |
| 10. |
Darzins, A., and A. M. Chakrabarty.
1984.
Cloning of genes controlling alginate biosynthesis from a mucoid cystic fibrosis isolate of Pseudomonas aeruginosa.
J. Bacteriol.
159:9-18 |
| 11. |
Deretic, V.,
J. F. Gill, and A. M. Chakrabarty.
1987.
Pseudomonas aeruginosa infection in cystic fibrosis: nucleotide sequence and transcriptional regulation of the algD gene.
Nucleic Acids Res.
15:4567-4581 |
| 12. |
Deretic, V.,
R. Kishit,
W. M. Konyecsni,
A. M. Chakrabarty, and T. K. Misra.
1989.
The algR gene, which regulates mucoidy in Pseudomonas aeruginosa, belongs to a class of environmentally responsive genes.
J. Bacteriol.
171:1278-1283 |
| 13. | DeVault, J. D., W. Hendrickson, J. Kato, and A. M. Chakrabarty. 1991. Environmentally regulated algD promoter is responsive to the cAMP receptor protein in Escherichia coli. Mol. Microbiol. 5:2503-2509[Medline]. |
| 14. |
DeVries, C. A., and D. E. Ohman.
1994.
Mucoid-to-nonmucoid conversion in alginate-producing Pseudomonas aeruginosa often results from spontaneous mutations in algT, encoding a putative alternative sigma factor, and shows evidence for autoregulation.
J. Bacteriol.
176:6677-6687 |
| 15. |
Figurski, D., and D. R. Helinski.
1979.
Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans.
Proc. Natl. Acad. Sci. USA
76:1648-1652 |
| 16. |
Franklin, M. J., and D. E. Ohman.
1993.
Identification of algF in the alginate biosynthetic gene cluster of Pseudomonas aeruginosa which is required for alginate acetylation.
J. Bacteriol.
175:5057-5065 |
| 17. |
Franklin, M. J., and D. E. Ohman.
1996.
Identification of algI and algJ in the Pseudomonas aeruginosa alginate biosynthetic gene cluster which are required for alginate O acetylation.
J. Bacteriol.
178:2186-2195 |
| 18. |
Gacesa, P.
1998.
Bacterial alginate biosynthesis recent progress and future prospects.
Microbiology
144:1133-1143 |
| 19. |
Goldberg, J. B.,
W. B. Gorham,
J. L. Flynn, and D. E. Ohman.
1993.
A mutation in algN permits trans activation of alginate production by algT in Pseudomonas species.
J. Bacteriol.
175:1303-1308 |
| 20. |
Govan, J. R. W., and V. Deretic.
1996.
Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.
Microbiol. Rev.
60:539-574 |
| 21. |
Hershberger, C. D.,
R. W. Ye,
M. R. Parsek,
Z.-D. Xie, and A. M. Chakrabarty.
1995.
The algT (algU) gene of Pseudomonas aeruginosa, a key regulator involved in alginate biosynthesis, encodes an alternative sigma factor ( E).
Proc. Natl. Acad. Sci. USA
92:7941-7945 |
| 22. |
Jain, S., and D. E. Ohman.
1998.
Deletion of algK in mucoid Pseudomonas aeruginosa blocks alginate polymer formation and results in uronic acid secretion.
J. Bacteriol.
180:634-641 |
| 23. | Jones, J. D. G., and N. Gutterson. 1987. An efficient mobilizable cosmid vector, pRK7813, and its use in a rapid method for marker exchange in Pseudomonas fluorescens strain HV37a. Gene 61:299-306[Medline]. |
| 24. |
Kato, J., and A. M. Chakrabarty.
1991.
Purification of the regulatory protein AlgR1 and its binding in the far upstream region of the algD promoter in P. aeruginosa.
Proc. Natl. Acad. Sci. USA
88:1760-1764 |
| 25. | Keane, P. J., A. Kerr, and P. B. New. 1970. Crown gall of stone fruit. II. Identification and nomenclature of Agrobacterium isolates. Aust. J. Biol. Sci. 23:585-595. |
| 26. | Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene 70:191-197[Medline]. |
| 27. | Keith, L. M. W., and C. L. Bender. Unpublished results. |
| 28. |
Kidambi, S. P.,
G. W. Sundin,
D. A. Palmer,
A. M. Chakrabarty, and C. L. Bender.
1995.
Copper as a signal for alginate synthesis in Pseudomonas syringae pv. syringae.
Appl. Environ. Microbiol.
61:2172-2179 |
| 29. | King, E. O., M. K. Ward, and D. E. Raney. 1954. Two simple media for the demonstration of pyocyanin and fluorescein. J. Lab. Clin. Med. 44:301-307[Medline]. |
| 30. | Kovach, M. E., R. W. Phillips, P. H. Elzer, R. M. Roop III, and K. M. Peterson. 1994. pBBR1MCS: a broad-host-range cloning vector. BioTechniques 16:800-802[Medline]. |
| 31. | Leitáo, J. H., A. M. Fialho, and I. Sá- Correia. 1992. Effects of growth temperature on alginate synthesis and enzymes in Pseudomonas aeruginosa variants. J. Gen. Microbiol. 138:605-610[Medline]. |
| 32. |
Ma, S.,
U. Selvaraj,
D. E. Ohman,
R. Quarless,
D. J. Hassett, and D. J. Wozniak.
1998.
Phosphorylation-independent activity of the response regulators AlgB and AlgR in promoting alginate biosynthesis in mucoid Pseudomonas aeruginosa.
J. Bacteriol.
180:956-968 |
| 33. | Maharaj, R., T. B. May, S.-K. Wang, and A. M. Chakrabarty. 1993. Sequence of the alg8 and alg44 genes involved in the synthesis of alginate by Pseudomonas aeruginosa. Gene 136:267-269[Medline]. |
| 34. |
Mathee, K.,
C. J. McPherson, and D. E. Ohman.
1997.
Posttranslational control of the algT (algU)-encoded 22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN).
J. Bacteriol.
179:3711-3720 |
| 35. | May, T. B., and A. M. Chakrabarty. 1994. Isolation and assay of Pseudomonas aeruginosa alginate. Methods Enzymol. 235:295-304[Medline]. |
| 36. | Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 37. |
Mohr, C. D., and V. Deretic.
1990.
Gene-scrambling mutagenesis: generation and analysis of insertional mutations in the alginate regulatory region of Pseudomonas aeruginosa.
J. Bacteriol.
172:6252-6260 |
| 38. | Mohr, C. D., and V. Deretic. 1992. In vitro interactions of the histone-like protein IHF with the algD promoter, a critical site for control of mucoidy in Pseudomonas aeruginosa. Biochem. Biophys. Res. Commun. 189:837-844[Medline]. |
| 39. |
Mohr, C. D.,
J. H. J. Leveau,
D. P. Krieg,
N. S. Hibler, and V. Deretic.
1992.
AlgR-binding sites within the algD promoter make up a set of inverted repeats separated by a large intervening segment of DNA.
J. Bacteriol.
174:6624-6633 |
| 40. | Mohr, C. D., S. K. Sonsteby, and V. Deretic. 1994. The Pseudomonas aeruginosa homologs of hemC and hemD are linked to the gene encoding the regulator of mucoidy AlgR. Mol. Gen. Genet. 242:177-184[Medline]. |
| 41. |
Monday, S. R., and N. L. Schiller.
1996.
Alginate synthesis in Pseudomonas aeruginosa: the role of AlgL (alginate lyase) and AlgX.
J. Bacteriol.
178:625-632 |
| 42. | Nunez, C. E., S. Moreno, G. Soberon-Chavez, and E. G. Espin. 1998. GenBank accession no. AF077237 . |
| 43. |
Peñaloza-Vázquez, A., and C. L. Bender.
1998.
Characterization of CorR, a transcriptional activator which is required for biosynthesis of the phytotoxin coronatine.
J. Bacteriol.
180:6252-6259 |
| 44. |
Peñaloza-Vázquez, A.,
S. P. Kidambi,
A. M. Chakrabarty, and C. L. Bender.
1997.
Characterization of the alginate biosynthetic gene cluster in Pseudomonas syringae pv. syringae.
J. Bacteriol.
179:4464-4472 |
| 45. | Pier, G. B. 1998. Pseudomonas aeruginosa: a key problem in cystic fibrosis. ASM News 64:339-347. |
| 46. | Rehm, B. H. A., and S. Valla. 1997. Bacterial alginates: biosynthesis and applications. Appl. Microbiol. Biotechnol. 48:281-288[Medline]. |
| 47. | Roine, E., D. M. Raineri, M. Romantschuk, M. Wilson, and D. N. Nunn. 1998. Characterization of type IV pilus genes in Pseudomonas syringae pv. tomato DC3000. Mol. Plant-Microbe Interact. 11:1048-1056[Medline]. |
| 48. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 49. |
Schiller, N. L.,
S. R. Monday,
C. M. Boyd,
N. T. Keen, and D. E. Ohman.
1993.
Characterization of the Pseudomonas aeruginosa alginate lyase gene (algL): cloning, sequencing, and expression in Escherichia coli.
J. Bacteriol.
175:4780-4789 |
| 50. |
Schurr, M. J.,
D. W. Martin,
M. H. Mudd, and V. Deretic.
1994.
Gene cluster controlling conversion of alginate-overproducing phenotypes in Pseudomonas aeruginosa: functional analysis in a heterologous host and role in the instability of mucoidy.
J. Bacteriol.
176:3375-3382 |
| 51. |
Schurr, M. J.,
H. Yu,
J. C. Boucher,
N. S. Hibler, and V. Deretic.
1995.
Multiple promoters and induction by heat shock of the gene encoding the alternative sigma factor AlgU ( E) which controls mucoidy in cystic fibrosis isolates of Pseudomonas aeruginosa.
J. Bacteriol.
177:5670-5679 |
| 52. |
Schurr, M. J.,
H. Yu,
J. M. Martinez-Salazar,
J. C. Boucher, and V. Deretic.
1996.
Control of AlgU, a member of the E-like family of stress sigma factors, by the negative regulators MucA and MucB and Pseudomonas aeruginosa conversion to mucoidy in cystic fibrosis.
J. Bacteriol.
178:4997-5004 |
| 53. | Shankar, S., R. Ye, D. Schlictman, and A. M. Chakrabarty. 1995. Exopolysaccharide alginate synthesis in Pseudomonas aeruginosa: enzymology and regulation of gene expression. Adv. Enzymol. 70:221-255. |
| 54. |
Shinabarger, D.,
A. Berry,
T. B. May,
R. Rothmel,
A. Fialho, and A. M. Chakrabarty.
1991.
Purification and characterization of phosphomannose isomerase-guanosine diphospho-D-mannose pyrophosphorylase.
J. Biol. Chem.
266:2080-2088 |
| 55. | Shinabarger, D., T. B. May, A. Boyd, M. Ghosh, and A. M. Chakrabarty. 1993. Nucleotide sequence and expression of the Pseudomonas aeruginosa algF gene controlling acetylation of alginate. Mol. Microbiol. 9:1027-1035[Medline]. |
| 56. |
Staskawicz, B. J.,
D. Dahlbeck, and N. T. Keen.
1984.
Cloned avirulence gene of Pseudomonas syringae pv. glycinea determines race-specific incompatibility on Glycine max (L.) Merr.
Proc. Natl. Acad. Sci. USA
81:6024-6028 |
| 57. |
Sundin, G. W., and C. L. Bender.
1993.
Ecological and genetic analysis of copper and streptomycin resistance in Pseudomonas syringae pv. syringae.
Appl. Environ. Microbiol.
59:1018-1024 |
| 58. | Van den Eede, G., R. Deblaere, K. Goethals, M. V. Montagu, and M. Holsters. 1992. Broad host range and promoter selection vectors for bacteria that interact with plants. Mol. Plant-Microbe Interact. 5:228-234[Medline]. |
| 59. | Venturi, V., M. Otten, V. Korse, B. Brouwer, J. Leong, and P. Weisbeek. 1995. Alginate regulatory and biosynthetic gene homologs in Pseudomonas putida WCS358: correlation with the siderophore regulatory gene pfrA. Gene 155:83-88[Medline]. |
| 60. |
Wang, S.-K.,
I. Sà Correia,
A. Darzins, and A. M. Chakrabarty.
1987.
Characterization of the Pseudomonas aeruginosa alginate (alg) gene region II.
J. Gen. Microbiol.
133:2303-2314 |
| 61. |
Whitchurch, C. B.,
R. A. Alm, and J. S. Mattick.
1996.
The alginate regulator AlgR and an associated sensor FimS are required for twitching motility in Pseudomonas aeruginosa.
Proc. Natl. Acad. Sci. USA
93:9839-9843 |
| 62. |
Xie, Z.,
C. D. Hershberger,
S. Shankar,
R. W. Ye, and A. M. Chakrabarty.
1996.
Sigma factor-anti-sigma factor interaction in alginate synthesis: inhibition of AlgT by MucA.
J. Bacteriol.
178:4990-4996 |
| 63. |
Yu, H.,
M. Mudd,
J. C. Boucher,
M. J. Schurr, and V. Deretic.
1997.
Identification of the algZ gene upstream of the response regulator algR and its participation in control of alginate production in Pseudomonas aeruginosa.
J. Bacteriol.
179:187-193 |
| 64. | Yu, J., A. Peñaloza-Vázquez, and C. L. Bender. 1998. Role of the exopolysaccharide alginate in the pathogenicity of Pseudomonas syringae pv. syringae. Phytopathology 88:S102. |
| 65. |
Zielinski, N. A.,
R. Maharaj,
S. Roychoudhury,
C. E. Danganan,
W. Hendrickson, and A. M. Chakrabarty.
1992.
Alginate synthesis in Pseudomonas aeruginosa: environmental regulation of the algC promoter.
J. Bacteriol.
174:7680-7688 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»