JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fakhr, M. K.
Right arrow Articles by Bender, C. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fakhr, M. K.
Right arrow Articles by Bender, C. L.

Journal of Bacteriology, June 1999, p. 3478-3485, Vol. 181, No. 11
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Regulation of Alginate Biosynthesis in Pseudomonas syringae pv. syringae

Mohamed K. Fakhr,1 Alejandro Peñaloza-Vázquez,2 Ananda M. Chakrabarty,3 and Carol L. Bender1,2,*

Department of Microbiology and Molecular Genetics1 and Department of Entomology and Plant Pathology,2 Oklahoma State University, Stillwater, Oklahoma 74078, and Department of Microbiology and Immunology, University of Illinois College of Medicine, Chicago, Illinois 606123

Received 5 January 1999/Accepted 24 March 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Both Pseudomonas aeruginosa and the phytopathogen P. syringae produce the exopolysaccharide alginate. However, the environmental signals that trigger alginate gene expression in P. syringae are different from those in P. aeruginosa with copper being a major signal in P. syringae. In P. aeruginosa, the alternate sigma factor encoded by algT (sigma 22) and the response regulator AlgR1 are required for transcription of algD, a gene which encodes a key enzyme in the alginate biosynthetic pathway. In the present study, we cloned and characterized the gene encoding AlgR1 from P. syringae. The deduced amino acid sequence of AlgR1 from P. syringae showed 86% identity to its P. aeruginosa counterpart. Sequence analysis of the region flanking algR1 in P. syringae revealed the presence of argH, algZ, and hemC in an arrangement virtually identical to that reported in P. aeruginosa. An algR1 mutant, P. syringae FF5.32, was defective in alginate production but could be complemented when algR1 was expressed in trans. The algD promoter region in P. syringae (PsalgD) was also characterized and shown to diverge significantly from the algD promoter in P. aeruginosa. Unlike P. aeruginosa, algR1 was not required for the transcription of algD in P. syringae, and PsalgD lacked the consensus sequence recognized by AlgR1. However, both the algD and algR1 upstream regions in P. syringae contained the consensus sequence recognized by sigma 22, suggesting that algT is required for transcription of both genes.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The exopolysaccharide alginate is a copolymer of O-acetylated beta -1,4-linked D-mannuronic acid and its C-5 epimer, L-guluronic acid (46). Alginate biosynthesis has been extensively studied in Pseudomonas aeruginosa, where it functions as a major virulence factor in strains infecting the lungs of cystic fibrosis patients (45). In P. aeruginosa, genes that encode the biosynthesis and regulation of alginate map to four chromosomal locations. With the exception of algC, which is located at 10 min, the structural genes are clustered within an 18-kb region located at 34 min (18, 46). Structural genes that have been characterized in this region include algA, which encodes a bifunctional enzyme which functions as a phosphomannose isomerase and a GDP-mannose pyrophosphorylase (54); algG, which encodes a C-5 epimerase (7); algF, algI, and algJ, which are involved in acetylation of the alginate polymer (16, 17, 55); and algD, which encodes GDP-mannose dehydrogenase (11). This region also contains algE and algK, which encode proteins with putative roles in polymer export and synthesis, respectively (1, 9, 22), and algL, which encodes alginate lyase (6, 49). Other genes which map within this region include alg44, alg8, and algX (alg60) (33, 41, 60); however, the functional role of the proteins encoded by these genes remains unclear. Chitnis and Ohman (8) postulated that the alginate biosynthetic gene cluster in P. aeruginosa is organized as an operon with transcription initiating at the algD promoter.

A region mapping at 68 min on the P. aeruginosa chromosome harbors a gene cluster consisting of algT (algU), mucA, mucB (algN), mucC, and mucD. These genes modulate the conversion to constitutive alginate production; at the head of this regulatory hierarchy is algT (algU). The alternative sigma factor encoded by algT, sigma 22, is required for transcription of algD, algT, and algR1 (21, 51). mucA is a negative regulator of algT transcription and encodes an antisigma factor with affinity for sigma 22 (52, 62). Mutations in mucA inactivate the MucA protein and result in the Alg+ phenotype; however, these mutations are unstable and spontaneous reversion to the Alg- phenotype often occurs due to suppressor mutations in algT (14, 50, 52). The remaining muc genes also modulate the expression of algT and have been described elsewhere (19, 34, 52, 62).

Other genes controlling the regulation of alginate production include algR1 (algR), algR2 (algQ), algR3 (algP), and algB (20, 53). AlgR1 functions as a response regulator member of the two-component signal transduction system and binds to multiple sites upstream of algC and algD (12, 24, 39, 65). Both the algD and algR1 promoters show a consensus sequence at the -35/10 region which is consistent with recognition by sigma 22, suggesting that an RNA polymerase-sigma 22 complex binds to both promoters and positively regulates transcription (51).

Like P. aeruginosa, phytopathogenic strains of P. syringae are normally nonmucoid in vitro. Kidambi et al. (28) previously showed that exposure to copper ions stimulated alginate production in selected strains of P. syringae. Furthermore, an indigenous plasmid designated pPSR12 conferred constitutive alginate production to P. syringae pv. syringae FF5. pPSR12 does not contain homologs of the biosynthetic or regulatory genes which control alginate production in P. aeruginosa; instead this plasmid presumably contains regulatory genes which remain uncharacterized (28). Mutagenesis of FF5(pPSR12) with Tn5 resulted in the isolation of alginate-defective (Alg-) mutants, including FF5.31 and FF5.32 (28). The Tn5 insertion in FF5.31 was located in algL, which encodes alginate lyase. Alginate production in FF5.31 was restored by pSK2, a cosmid clone containing homologues of algD, alg8, alg44, algG, algX, algL, algF, and algA. The order and arrangement of the alginate structural gene cluster were virtually identical to those previously described for P. aeruginosa. Complementation analyses, however, indicated that the structural gene clusters in P. aeruginosa and P. syringae were not functionally interchangeable when expressed from their native promoters (44).

In the present study, the Alg- mutant FF5.32 was shown to contain a Tn5 insertion in algR1. Unlike P. aeruginosa, expression from the P. syringae algD promoter (PsalgD) did not require a functional copy of algR1. Nucleotide sequence analysis indicated that PsalgD did not contain recognizable AlgR1 binding sites, which helps explain the differential regulation of alginate gene expression in P. aeruginosa and P. syringae.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Bacterial strains, plasmids, and media. Table 1 lists the bacterial strains and plasmids used in the present study. Pseudomonas spp. were routinely maintained at 28°C on King's medium B (29), mannitol-glutamate (MG) medium (25), or MG medium supplemented with yeast extract at 0.25 g/liter (MGY); Escherichia coli strains were grown on Luria-Bertani (LB) medium (36) at 37°C. Antibiotics were added to the media at the following concentrations: ampicillin, 100 µg/ml; tetracycline, 25 µg/ml; kanamycin, 25 µg/ml; spectinomycin, 25 µg/ml; streptomycin, 25 µg/ml; piperacillin, 250 µg/ml; and chloramphenicol, 25 µg/ml.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Bacterial strains and plasmids used in this study

Molecular genetic techniques. Plasmid DNA was isolated from Pseudomonas spp. by alkali lysis (48). Restriction enzyme digests, agarose gel electrophoresis, Southern transfers, and isolation of DNA fragments from agarose gels were performed by standard methods (48). Genomic DNA was isolated from P. syringae by established procedures (56), and a total genomic library of FF5.32 was constructed in pRK7813 as described previously (2). Clones were mobilized into nonmucoid recipient strains by using a triparental mating procedure and the mobilizer plasmid pRK2013 (4).

DNA fragments were isolated from agarose gels by electroelution (48) and labelled with digoxigenin (Genius labelling and detection kit; Boehringer Mannheim, Indianapolis, Ind.) or with [alpha -32P]dCTP by using the Rad Prime DNA Labeling System (Gibco BRL, Gaithersburg, Md.). Hybridizations and posthybridization washes were conducted under high-stringency conditions (57).

Isolation and quantitation of alginate. Selected strains were inoculated by dilution streaking to MGY agar (three plates per strain) and incubated at 28°C for 72 h. Each plate was handled separately for quantification of alginate. The cells were washed from each plate and resuspended in 0.9% NaCl. Removal of cellular material from the mucoid growth and estimation of the alginate content and total cellular protein were performed as described previously (35). Alginic acid from seaweed (Macrocystis pyrifera; Sigma Chemical Co., St. Louis, Mo.) was used as a standard in these experiments. Mean values of three replicate determinations were expressed as micrograms of alginate per milligram of protein.

Construction of transcriptional fusions. PsalgD was initially cloned in pCR2.1 as a 2.7-kb PCR product. Plasmid pSK2 was used as template, and the following oligonucleotides were used as primers: forward primer, 5' TGGTGCTGGAAATATCCACACC (located 100 bp downstream of the presumed translational start site of algD [P1 in Fig. 1A]); and reverse primer, 5' AATTCTGCCAGTCCAGCCACTGAC (P2 in Fig. 1A). Following amplification of the 2.7-kb PCR product, ligation in pCR2.1, and transformation into E. coli DH5alpha , plasmid pAPD was recovered. The promoter probe construct, pBBR.Gus, which contains a promoterless glucuronidase gene (uidA) downstream of the polylinker in pBBR1MCS (43), was used to more precisely define the promoter region upstream of algD. pAPD was digested with HindIII and EcoRV, and the 2.7-kb insert was isolated, end-filled with Klenow, and ligated into pBBR.Gus. Transformants were selected on LB agar containing 5-bromo-4-chloro-3-indolyl-beta -D-galactopyranoside (X-Gal) and chloramphenicol, and pAPDP was found to contain the algD::uidA fusion in the transcriptionally active orientation.


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1.   (A) Physical and functional map of the alginate structural gene cluster in Pseudomonas syringae pv. syringae FF5. The arrows within each open reading frame indicate the direction of translation. The locations of the primers (P1 and P2) used to amplify the algD promoter region are indicated. Abbreviations: F, algF; 44, alg44. (B) Expanded view of the region amplified with primers P1 and P2. The location and orientation of the coding region for algD are shown (horizontal arrow). The black boxes flanking the EcoRI site indicate the consensus sequence recognized by AlgT (sigma 22). The location and orientation of the algD::uidA transcriptional fusions are indicated; GUS activity is shown in the column adjacent to each construct. Values followed by the same letter were not significantly different (P = 0.01). Abbreviations: E, EcoRI; H, HindIII; V, EcoRV.

Exonuclease III (ExoIII) was used to determine the minimal size of the PsalgD promoter. pAPDP was digested with ClaI and ApaI, which generate ExoIII-sensitive and ExoIII-resistant sites, respectively. Staggered deletions in the PsalgD promoter region were generated by following the protocols supplied with the Erase-a-Base kit (Promega, Madison, Wis.). Transcriptional fusions were then mobilized into FF5(pPSR12) and assayed for glucuronidase activity as described below.

GUS assays. Transcriptional activity was initially screened by spotting bacterial suspensions (absorbance at 600 nm of 0.1) on MG agar medium amended with spectinomycin and 20 µg of X-Gluc (5-bromo-4-chloro-3-indolylglucuronide) per ml; the plates were then incubated at 28°C for 24 to 72 h. Glucuronidase (GUS) activity was quantified by fluorometric analysis of cells grown for 18 to 20 h in 3 ml of MG medium. Fluorescence was monitored with a Fluoroscan II version 4.0 microplate reader (ICN Biomedicals, Inc., Costa Mesa, Calif.) in 96-well microtiter plates. GUS activity was expressed in units per milligram of protein, with 1 U being equivalent to 1 nmol of methylumbelliferone formed per min. Values presented for GUS activity represent the average of three replicates per experiment. When significant differences in GUS activity were detected, the experiment was repeated.

DNA sequencing and analysis. Nucleotide sequencing reactions were performed by the dideoxynucleotide method with AmpliTaq DNA polymerase (Perkin-Elmer, Foster City, Calif.). Automated DNA sequencing was performed with an ABI 373A apparatus and the ABI PRISM Dye Primer cycle-sequencing kit (Perkin-Elmer). Automated sequencing was provided by the Oklahoma State University Recombinant DNA/Protein Resource Facility. The Tn5 insertion in FF5.32 was localized by sequencing the DNA flanking the transposon by using the oligonucleotide 5' GGTTCCGTTCAGGACGCTAC, which is derived from the border region of IS50. Sequence data were aligned and homology searches were executed by using the University of Wisconsin Genetics Computer Group (UWGCG) sequence analysis package, version 9.0. Sequences associated with sigma 22 and AlgR1 binding were located by using the MOTIFS program included with the UWGCG software.

Nucleotide sequence accession numbers. The nucleotide sequences described in this study were deposited in GenBank under accession no. AF131199 (fimS-algR1-hemC) and AF131068 (PsalgD).


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Location of Tn5 insertion in FF5.32. A genomic library of FF5.32 was constructed in pRK7813, and a clone containing the Tn5 insertion from FF5.32 was recovered and designated pAP32. The internal BamHI site in Tn5 and 2.5 kb of FF5.32 DNA were cloned from pAP32 into pBluescript SK(+), resulting in a clone named pAP32.1 (Fig. 2). A primer specific for the border region of IS50 was used to sequence approximately 300 bp of FF5.32 DNA flanking the Tn5 insertion site. This sequence showed 76% nucleotide identity to algR1 from P. aeruginosa, and the Tn5 insertion was located at nucleotide 51 of algR1 from P. aeruginosa (12).


View larger version (25K):
[in this window]
[in a new window]
 
FIG. 2.   Constructs used for the cloning and sequencing of algR1 from P. syringae pv. syringae FF5. pAP32.1 is a subclone containing Tn5 (shaded region) and flanking DNA from P. syringae pv. syringae FF5.32 (hatched region). The HindIII-EcoRI fragment in pAP32.1 was used as a probe for algR1 in the current study. pMF6.1 and pMF6.2 are subclones derived from pMF6, a cosmid which complemented FF5.32 for alginate production. The 2.0-kb PstI fragment in pMF6.2 was sequenced on both strands and shown to contain an intact copy of algR1. Abbreviations: B, BamHI; E, EcoRI; H, HindIII; P, PstI.

Genomic DNA from FF5(pPSR12) and FF5.32 was digested with EcoRI and analyzed by Southern blotting with the 2.3-kb HindIII-EcoRI fragment from pAP32.1 as a probe (Fig. 2). The probe hybridized to 2.7- and 8.4-kb EcoRI fragments in FF5(pPSR12) and FF5.32, respectively (data not shown). These results indicated that the region associated with algR1 was located in a 2.7-kb EcoRI fragment, and the 2.7-kb fragment was inactivated by Tn5 (5.7 kb) in FF5.32.

Cloning of algR1 from P. syringae. A genomic library of P. syringae pv. syringae FF5(pPSR12) was previously constructed in pRK7813 (44). In the current study, the 2.3-kb HindIII-EcoRI fragment from pAP32.1 (Fig. 2) was used to screen the library for clones containing the complete algR1 coding region. Seven cosmid clones hybridized with the probe; two clones designated pMF4 and pMF6 were chosen for further study and contained a 2.7-kb EcoRI fragment which hybridized with the probe. This fragment was subcloned from pMF6 in pBluescript SK(+), resulting in pMF6.1 (Fig. 2). Sequence information for pMF6.1 was generated with the T7 and T3 primers and indicated that this fragment contained DNA homologous to argH, fimS, and algR1. In previous studies, the fimS gene showed relatedness to sensor kinases of two-component systems and mapped immediately upstream of algR1 in P. aeruginosa (61). It is important to note that fimS, which was also named algZ (63), is distinct from the algZ described by Baynham and Wozniak (3). To avoid further confusion in nomenclature, the name "fimS" will be used hereafter to describe the sensor kinase which maps adjacent to algR1. In P. syringae, argH, which encodes arginosuccinate lyase, mapped adjacent to fimS; in P. aeruginosa, argH was divergently transcribed with respect to both fimS and algR1 (37, 63). Sequence analysis of pMF6.1 indicated that this arrangement is conserved in P. syringae (Fig. 2).

Sequence analysis indicated that pMF6.1 contained 560 bp of algR1 but lacked approximately 180 bp located at the 3' end. Southern blot analysis of pMF6 and pMF6.1 suggested that the intact algR1 was probably contained in a 2.0-kb PstI fragment; this was subcloned in pBluescript SK(+) and designated pMF6.2 (Fig. 2). pMF6.2 was completely sequenced on both strands and shown to contain DNA homologous to the 3' end of fimS (585 bp), an intact copy of algR1 (747 bp), and the 5' end of hemC (432 bp). In P. aeruginosa, hemC encodes porphobilinogen deaminase and maps adjacent to algR1 (40). The P. syringae homologues showed a high degree of relatedness to the corresponding P. aeruginosa genes; for example, nucleotide identity between fimS, algR1, and hemC in the two species was 88, 84, and 80%, respectively. Furthermore, the algR1 homologue in P. syringae showed extensive relatedness (86 to 88% nucleotide identity) to algR from Azotobacter vinelandii (42) and to pprA, an algR1 homologue in P. putida (59). In P. aeruginosa, AlgR1 contains two aspartate residues (D54 and D85) which have been suggested to function as phosphorylation sites (32, 61); both aspartate residues were present in the predicted translation product of algR1 from P. syringae. A consensus sequence for sigma 22 was located 108 bp upstream of the algR1 translational start site, a location which is also conserved in P. aeruginosa (63).

Complementation experiments. pMF4 and pMF6, the cosmid clones containing argH, fimS, algR1, and hemC, were evaluated for their ability to complement P. syringae pv. syringae FF5.32 for alginate production. Transconjugants of FF5.32 containing pMF4 or pMF6 were visibly mucoid and produced significantly more alginate than the mutant FF5.32 did (Table 2). Since Tn5 frequently causes polar mutations on downstream genes, the 2.0-kb PstI fragment in pMF6.2 was used to investigate whether the Alg- phenotype in FF5.32 was caused by the mutation in algR1. pMF6.2 contains an intact copy of algR1 with the cognate sigma 22 recognition site and truncated copies of fimS and hemC (Fig. 2). The 2.0-kb PstI fragment in pMF6.2 was subcloned in pRK415 to form pMF6.21 and pMF6.22, which contain algR1 in the transcriptionally active and inactive orientations with respect to the lac promoter (Table 1). Both pMF6.21 and pMF6.22 restored alginate production to FF5.32 (Table 2), indicating that the Alg- phenotype of FF5.32 was caused by the Tn5 insertion in algR1. FF5.32 was complemented with both clones irrespective of the orientation of the lac promoter and without the addition of isopropyl-beta -D-thiogalactopyranoside (IPTG), indicating that a functional promoter for algR1 was present on the 2.0-kb PstI fragment. To further confirm that FF5.32 was indeed an algR1 mutant, we investigated whether this mutant could be complemented by algR1 from P. aeruginosa. Plasmid pAD1039, which contains algR1 from P. aeruginosa (Table 1), complemented FF5.32 and restored alginate production in the mutant to a level equivalent to FF5(pPSR12) (data not shown).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Alginate production by derivatives of P. syringae pv. syringae FF5

Expression of the PsalgD promoter does not require AlgR1. In P. aeruginosa, AlgR1 is required for expression of the algD promoter (PalgD) and has been shown to bind PalgD at several conserved sites (24, 39). A portion of PsalgD was previously cloned as a 1-kb fragment in the promoter probe vector, pRG960sd, creating pSK3 (PsalgD::uidA; transcriptionally active orientation) and pSK4 (uidA::PsalgD; transcriptionally inactive) (44). In the present study, we investigated whether PsalgD was transcriptionally active in FF5.32, the algR1 mutant. GUS activities in FF5(pPSR12) and FF5.32(pSK3) were not significantly different (Table 3), indicating that a functional copy of algR1 was not required for transcription of algD in P. syringae.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   GUS activity for P. syringae pv. syringae FF5 and FF5.32 containing various promoter constructs with the algD upstream region

Analysis of the PsalgD promoter. To more fully characterize the minimum sequence necessary for algD expression in P. syringae, we constructed a series of deletions from the 5' (EcoRV) end of the PsalgD promoter (Fig. 1B). A new construct, pAPDP (Fig. 1B), was designed for this purpose since the pBBR.Gus polylinker was more amenable to deletion analysis than was the multicloning site in pRG960sd, the vector used for construction of pSK3. Two deletion derivatives of pAPDP, pAPDPDelta 15 and pAPDPDelta 23, proved useful for delineating the algD promoter region; sequence analysis indicated that these two constructs lacked 1.5 and 2.3 kb of DNA downstream of the EcoRV site, respectively. FF5(pPSR12, pAPDPDelta 15) (Fig. 1B) retained the full level of GUS activity exhibited by FF5(pPSR12, pAPDP) (Fig. 1B), suggesting that the 1.5-kb region downstream of the EcoRV site was dispensable for promoter activity. However, GUS activity in FF5(pPSR12, pAPDPDelta 23) was 3.8-fold lower than in FF5(pPSR12, pAPDPDelta 15), demonstrating that deletion of an additional 0.8 kb from the 5' end of pAPDPDelta 15 virtually eliminated PsalgD promoter activity (Fig. 1B).

Sequence analysis of the PsalgD promoter in pAPDPDelta 15 indicated that it contained a putative AlgT (sigma 22) recognition site 508 bp upstream of the predicted algD translational start site (Fig. 3). In this respect, PsalgD is similar to the algD promoter in P. aeruginosa where a long, untranslated leader sequence is located between the algD translational start site and the sigma 22 binding region (11, 51). However, PsalgD lacked the AlgR1 binding sites, which are located upstream of the algD transcriptional start in P. aeruginosa (Fig. 3) (24, 38). The absence of these conserved motifs for AlgR1 binding could explain why the P. syringae algD promoter does not require a functional copy of algR1 for transcriptional activity.


View larger version (80K):
[in this window]
[in a new window]
 
FIG. 3.   Alignment of the algD promoter sequences from P. syringae pv. syringae FF5 (Ps algD) and P. aeruginosa (Pa algD). The P. aeruginosa algD promoter was previously reported (24, 39); the nucleotides for this sequence are shown on the left, with +1 (asterisk) corresponding to the transcriptional start site. Nucleotides for the P. syringae pv. syringae algD promoter are shown on the right. The EcoRI site in the P. syringae sequence corresponds to the left border of EcoRI fragment 5 in Fig. 1A. Gaps (--) were used to maximize the alignment, and identical bases are shaded. The AlgR1 binding sites (ABS) in the P. aeruginosa algD promoter are shown in bold and double-underlined. The sigma 22 recognition sequence in both species is indicated in bold and single-underlined. The algD translational start site and coding region are shown in bold (algD-right-arrow).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The AlgR1 mutant characterized in the present study, FF5.32, was previously shown to be completely defective in alginate synthesis (28), thereby demonstrating that AlgR1 is absolutely required for alginate production in P. syringae. However, the role of AlgR1 in P. syringae is unclear, since this protein is not required for algD expression; it remains possible that AlgR1 is required for transcriptional activation of algC in P. syringae, which is true in P. aeruginosa (65). Alternatively, AlgR1 may function differently in P. syringae, perhaps as part of a signal transduction cascade which controls alginate production. A complex regulatory network for alginate synthesis in P. syringae seems plausible, since plasmid-encoded regulatory genes are known to mediate the constitutive production of alginate in the P. syringae strains which harbor them (28).

The organization of the region flanking AlgR1 is conserved in both P. aeruginosa and P. syringae (argH-fimS-algR1-hemC). In both species, the sigma 22 recognition site preceding algR1 is located within the 3' end of fimS (63). FimS shows relatedness to the histidine protein kinases which function as environmental sensors, and both AlgR1 and FimS are required for twitching motility in P. aeruginosa, a process mediated by type IV pili. Although type IV pili have been identified in P. syringae (47), our efforts to demonstrate twitching motility in P. syringae pv. syringae FF5 were completely unsuccessful; therefore, the involvement of AlgR1 in twitching motility in P. syringae remains unclear. It has also been proposed that FimS may function as the cognate sensor kinase for AlgR1, but the exact role of FimS in alginate production remains unclear (61, 63). Interestingly, phosphorylation of AlgR1 was not required for alginate production in P. aeruginosa (32).

Sequence analysis of the algR1 and algD upstream regions in P. syringae revealed the presence of sigma 22 recognition sites (Fig. 3). The sigma 22 recognition site identified in the algR1 upstream region was identical to that identified in P. aeruginosa, whereas the sigma 22 recognition sequence in PsalgD differed from the corresponding sequence in P. aeruginosa by a single nucleotide (51). Although the transcriptional start sites for algR1 and algD were not identified in P. syringae, the positions of the sigma 22 recognition sites relative to the translational start site are conserved in both species. The conservation of sigma 22 recognition sequences upstream of algR1 and algD strongly suggests that transcriptional activation of these genes requires a functional copy of algT. An algT homologue in P. syringae has recently been identified, and the role of algT in the transcriptional activation of algD and algR1 in P. syringae is under investigation (27).

The percent nucleotide identity in the algD coding region of P. syringae pv. syringae and P. aeruginosa ranged from 80 to 90% (Fig. 3 and data not shown); however, upstream of the translational start site, the relatedness between the two species diverged and nucleotide identity decreased to approximately 20% (Fig. 3). This divergence is consistent with the absence of specific sequences in PsalgD which are known to be involved in transcriptional activation of algD in P. aeruginosa. These include the consensus sequences for binding AlgR1 (24), integration host factor (38), and cyclic AMP receptor protein (13). Although some signals for activation of the algD promoter are conserved in P. aeruginosa and P. syringae (5, 31, 44), the algD promoter in P. syringae is stimulated by exposure to copper ions (44) and does not require a functional copy of AlgR1 for transcriptional activation. Recently, Yu et al. (64) provided the first genetic evidence for the role of alginate in the virulence and epiphytic fitness of P. syringae. Consequently, the differential regulation of algD expression in P. syringae and CF isolates of P. aeruginosa and the marked divergence in their algD promoter regions probably reflect their adaptation to plant and human hosts, respectively.

It remains possible that some unknown regulatory protein binds to PsalgD and that this regulator recognizes different signals (such as copper) and activates the algD promoter in P. syringae. Perhaps this putative DNA binding protein was recruited during the evolutionary divergence of P. aeruginosa and P. syringae to accommodate a different signal and perhaps another activator. The algD::uidA transcriptional fusion described in the present investigation could be used to screen for mutants lacking the unknown activator. Such experiments are under way and will probably reveal additional differences in the regulation of alginate biosynthesis in human and phytopathogenic bacteria.


    ACKNOWLEDGMENTS

M.F. and A.P.V. contributed equally to this paper, and both should be regarded as first authors.

M.F. acknowledges financial support from the Egyptian government for his dissertation research. C.B. acknowledges support from the Oklahoma Agricultural Experiment Station and Public Health Service grant AI 43311-01 from the National Institutes of Health. A.M.C. acknowledges support by NIH grant AI 16790-18.

We thank V. Rangaswamy and F. Alarcón-Chaidez for help with graphics and sequence analysis and V. Kapatral for providing pAD1039.


    FOOTNOTES

* Corresponding author. Mailing address: 110 Noble Research Center, Department of Entomology and Plant Pathology, Oklahoma State University, Stillwater, OK 74078-3032. Phone: (405) 744-9945. Fax: (405) 744-7373. E-mail: cbender{at}okstate.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Aarons, S. J., I. W. Sutherland, A. M. Chakrabarty, and M. P. Gallagher. 1997. A novel gene, algK, from the alginate biosynthetic cluster of Pseudomonas aeruginosa. Microbiology 143:641-652[Abstract].
2. Barta, T. M., T. G. Kinscherf, and D. K. Willis. 1992. Regulation of tabtoxin production by the lemA gene in Pseudomonas syringae. J. Bacteriol. 174:3021-3029[Abstract/Free Full Text].
3. Baynham, P. J., and D. J. Wozniak. 1996. Identification and characterization of AlgZ, an AlgT-dependent DNA-binding protein required for Pseudomonas aeruginosa algD transcription. Mol. Microbiol. 22:97-108[Medline].
4. Bender, C. L., S. A. Young, and R. E. Mitchell. 1991. Conservation of plasmid DNA sequences in coronatine-producing pathovars of Pseudomonas syringae. Appl. Environ. Microbiol. 57:993-999[Abstract/Free Full Text].
5. Berry, A., J. D. DeVault, and A. M. Chakrabarty. 1989. High osmolarity is a signal for enhanced algD transcription in mucoid and nonmucoid Pseudomonas aeruginosa strains. J. Bacteriol. 171:2312-2317[Abstract/Free Full Text].
6. Boyd, A., M. Ghosh, T. B. May, D. Shinabarger, R. Keogh, and A. M. Chakrabarty. 1993. Sequence of the algL gene of Pseudomonas aeruginosa and purification of its alginate lyase product. Gene 131:1-8[Medline].
7. Chitnis, C. E., and D. E. Ohman. 1990. Cloning of Pseudomonas aeruginosa algG, which controls alginate structure. J. Bacteriol. 172:2894-2900[Abstract/Free Full Text].
8. Chitnis, C. E., and D. E. Ohman. 1993. Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure. Mol. Microbiol. 8:583-590[Medline].
9. Chu, L., T. B. May, A. M. Chakrabarty, and T. K. Misra. 1991. Nucleotide sequence and expression of the algE gene involved in alginate biosynthesis by Pseudomonas aeruginosa. Gene 107:1-10[Medline].
10. Darzins, A., and A. M. Chakrabarty. 1984. Cloning of genes controlling alginate biosynthesis from a mucoid cystic fibrosis isolate of Pseudomonas aeruginosa. J. Bacteriol. 159:9-18[Abstract/Free Full Text].
11. Deretic, V., J. F. Gill, and A. M. Chakrabarty. 1987. Pseudomonas aeruginosa infection in cystic fibrosis: nucleotide sequence and transcriptional regulation of the algD gene. Nucleic Acids Res. 15:4567-4581[Abstract/Free Full Text].
12. Deretic, V., R. Kishit, W. M. Konyecsni, A. M. Chakrabarty, and T. K. Misra. 1989. The algR gene, which regulates mucoidy in Pseudomonas aeruginosa, belongs to a class of environmentally responsive genes. J. Bacteriol. 171:1278-1283[Abstract/Free Full Text].
13. DeVault, J. D., W. Hendrickson, J. Kato, and A. M. Chakrabarty. 1991. Environmentally regulated algD promoter is responsive to the cAMP receptor protein in Escherichia coli. Mol. Microbiol. 5:2503-2509[Medline].
14. DeVries, C. A., and D. E. Ohman. 1994. Mucoid-to-nonmucoid conversion in alginate-producing Pseudomonas aeruginosa often results from spontaneous mutations in algT, encoding a putative alternative sigma factor, and shows evidence for autoregulation. J. Bacteriol. 176:6677-6687[Abstract/Free Full Text].
15. Figurski, D., and D. R. Helinski. 1979. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 76:1648-1652[Abstract/Free Full Text].
16. Franklin, M. J., and D. E. Ohman. 1993. Identification of algF in the alginate biosynthetic gene cluster of Pseudomonas aeruginosa which is required for alginate acetylation. J. Bacteriol. 175:5057-5065[Abstract/Free Full Text].
17. Franklin, M. J., and D. E. Ohman. 1996. Identification of algI and algJ in the Pseudomonas aeruginosa alginate biosynthetic gene cluster which are required for alginate O acetylation. J. Bacteriol. 178:2186-2195[Abstract/Free Full Text].
18. Gacesa, P. 1998. Bacterial alginate biosynthesis---recent progress and future prospects. Microbiology 144:1133-1143[Medline].
19. Goldberg, J. B., W. B. Gorham, J. L. Flynn, and D. E. Ohman. 1993. A mutation in algN permits trans activation of alginate production by algT in Pseudomonas species. J. Bacteriol. 175:1303-1308[Abstract/Free Full Text].
20. Govan, J. R. W., and V. Deretic. 1996. Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol. Rev. 60:539-574[Abstract/Free Full Text].
21. Hershberger, C. D., R. W. Ye, M. R. Parsek, Z.-D. Xie, and A. M. Chakrabarty. 1995. The algT (algU) gene of Pseudomonas aeruginosa, a key regulator involved in alginate biosynthesis, encodes an alternative sigma factor (sigma E). Proc. Natl. Acad. Sci. USA 92:7941-7945[Abstract/Free Full Text].
22. Jain, S., and D. E. Ohman. 1998. Deletion of algK in mucoid Pseudomonas aeruginosa blocks alginate polymer formation and results in uronic acid secretion. J. Bacteriol. 180:634-641[Abstract/Free Full Text].
23. Jones, J. D. G., and N. Gutterson. 1987. An efficient mobilizable cosmid vector, pRK7813, and its use in a rapid method for marker exchange in Pseudomonas fluorescens strain HV37a. Gene 61:299-306[Medline].
24. Kato, J., and A. M. Chakrabarty. 1991. Purification of the regulatory protein AlgR1 and its binding in the far upstream region of the algD promoter in P. aeruginosa. Proc. Natl. Acad. Sci. USA 88:1760-1764[Abstract/Free Full Text].
25. Keane, P. J., A. Kerr, and P. B. New. 1970. Crown gall of stone fruit. II. Identification and nomenclature of Agrobacterium isolates. Aust. J. Biol. Sci. 23:585-595.
26. Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene 70:191-197[Medline].
27. Keith, L. M. W., and C. L. Bender. Unpublished results.
28. Kidambi, S. P., G. W. Sundin, D. A. Palmer, A. M. Chakrabarty, and C. L. Bender. 1995. Copper as a signal for alginate synthesis in Pseudomonas syringae pv. syringae. Appl. Environ. Microbiol. 61:2172-2179[Abstract].
29. King, E. O., M. K. Ward, and D. E. Raney. 1954. Two simple media for the demonstration of pyocyanin and fluorescein. J. Lab. Clin. Med. 44:301-307[Medline].
30. Kovach, M. E., R. W. Phillips, P. H. Elzer, R. M. Roop III, and K. M. Peterson. 1994. pBBR1MCS: a broad-host-range cloning vector. BioTechniques 16:800-802[Medline].
31. Leitáo, J. H., A. M. Fialho, and I. Sá- Correia. 1992. Effects of growth temperature on alginate synthesis and enzymes in Pseudomonas aeruginosa variants. J. Gen. Microbiol. 138:605-610[Medline].
32. Ma, S., U. Selvaraj, D. E. Ohman, R. Quarless, D. J. Hassett, and D. J. Wozniak. 1998. Phosphorylation-independent activity of the response regulators AlgB and AlgR in promoting alginate biosynthesis in mucoid Pseudomonas aeruginosa. J. Bacteriol. 180:956-968[Abstract/Free Full Text].
33. Maharaj, R., T. B. May, S.-K. Wang, and A. M. Chakrabarty. 1993. Sequence of the alg8 and alg44 genes involved in the synthesis of alginate by Pseudomonas aeruginosa. Gene 136:267-269[Medline].
34. Mathee, K., C. J. McPherson, and D. E. Ohman. 1997. Posttranslational control of the algT (algU)-encoded sigma 22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN). J. Bacteriol. 179:3711-3720[Abstract/Free Full Text].
35. May, T. B., and A. M. Chakrabarty. 1994. Isolation and assay of Pseudomonas aeruginosa alginate. Methods Enzymol. 235:295-304[Medline].
36. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
37. Mohr, C. D., and V. Deretic. 1990. Gene-scrambling mutagenesis: generation and analysis of insertional mutations in the alginate regulatory region of Pseudomonas aeruginosa. J. Bacteriol. 172:6252-6260[Abstract/Free Full Text].
38. Mohr, C. D., and V. Deretic. 1992. In vitro interactions of the histone-like protein IHF with the algD promoter, a critical site for control of mucoidy in Pseudomonas aeruginosa. Biochem. Biophys. Res. Commun. 189:837-844[Medline].
39. Mohr, C. D., J. H. J. Leveau, D. P. Krieg, N. S. Hibler, and V. Deretic. 1992. AlgR-binding sites within the algD promoter make up a set of inverted repeats separated by a large intervening segment of DNA. J. Bacteriol. 174:6624-6633[Abstract/Free Full Text].
40. Mohr, C. D., S. K. Sonsteby, and V. Deretic. 1994. The Pseudomonas aeruginosa homologs of hemC and hemD are linked to the gene encoding the regulator of mucoidy AlgR. Mol. Gen. Genet. 242:177-184[Medline].
41. Monday, S. R., and N. L. Schiller. 1996. Alginate synthesis in Pseudomonas aeruginosa: the role of AlgL (alginate lyase) and AlgX. J. Bacteriol. 178:625-632[Abstract/Free Full Text].
42. Nunez, C. E., S. Moreno, G. Soberon-Chavez, and E. G. Espin. 1998. GenBank accession no. AF077237 .
43. Peñaloza-Vázquez, A., and C. L. Bender. 1998. Characterization of CorR, a transcriptional activator which is required for biosynthesis of the phytotoxin coronatine. J. Bacteriol. 180:6252-6259[Abstract/Free Full Text].
44. Peñaloza-Vázquez, A., S. P. Kidambi, A. M. Chakrabarty, and C. L. Bender. 1997. Characterization of the alginate biosynthetic gene cluster in Pseudomonas syringae pv. syringae. J. Bacteriol. 179:4464-4472[Abstract/Free Full Text].
45. Pier, G. B. 1998. Pseudomonas aeruginosa: a key problem in cystic fibrosis. ASM News 64:339-347.
46. Rehm, B. H. A., and S. Valla. 1997. Bacterial alginates: biosynthesis and applications. Appl. Microbiol. Biotechnol. 48:281-288[Medline].
47. Roine, E., D. M. Raineri, M. Romantschuk, M. Wilson, and D. N. Nunn. 1998. Characterization of type IV pilus genes in Pseudomonas syringae pv. tomato DC3000. Mol. Plant-Microbe Interact. 11:1048-1056[Medline].
48. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
49. Schiller, N. L., S. R. Monday, C. M. Boyd, N. T. Keen, and D. E. Ohman. 1993. Characterization of the Pseudomonas aeruginosa alginate lyase gene (algL): cloning, sequencing, and expression in Escherichia coli. J. Bacteriol. 175:4780-4789[Abstract/Free Full Text].
50. Schurr, M. J., D. W. Martin, M. H. Mudd, and V. Deretic. 1994. Gene cluster controlling conversion of alginate-overproducing phenotypes in Pseudomonas aeruginosa: functional analysis in a heterologous host and role in the instability of mucoidy. J. Bacteriol. 176:3375-3382[Abstract/Free Full Text].
51. Schurr, M. J., H. Yu, J. C. Boucher, N. S. Hibler, and V. Deretic. 1995. Multiple promoters and induction by heat shock of the gene encoding the alternative sigma factor AlgU (sigma E) which controls mucoidy in cystic fibrosis isolates of Pseudomonas aeruginosa. J. Bacteriol. 177:5670-5679[Abstract/Free Full Text].
52. Schurr, M. J., H. Yu, J. M. Martinez-Salazar, J. C. Boucher, and V. Deretic. 1996. Control of AlgU, a member of the sigma E-like family of stress sigma factors, by the negative regulators MucA and MucB and Pseudomonas aeruginosa conversion to mucoidy in cystic fibrosis. J. Bacteriol. 178:4997-5004[Abstract/Free Full Text].
53. Shankar, S., R. Ye, D. Schlictman, and A. M. Chakrabarty. 1995. Exopolysaccharide alginate synthesis in Pseudomonas aeruginosa: enzymology and regulation of gene expression. Adv. Enzymol. 70:221-255.
54. Shinabarger, D., A. Berry, T. B. May, R. Rothmel, A. Fialho, and A. M. Chakrabarty. 1991. Purification and characterization of phosphomannose isomerase-guanosine diphospho-D-mannose pyrophosphorylase. J. Biol. Chem. 266:2080-2088[Abstract/Free Full Text].
55. Shinabarger, D., T. B. May, A. Boyd, M. Ghosh, and A. M. Chakrabarty. 1993. Nucleotide sequence and expression of the Pseudomonas aeruginosa algF gene controlling acetylation of alginate. Mol. Microbiol. 9:1027-1035[Medline].
56. Staskawicz, B. J., D. Dahlbeck, and N. T. Keen. 1984. Cloned avirulence gene of Pseudomonas syringae pv. glycinea determines race-specific incompatibility on Glycine max (L.) Merr. Proc. Natl. Acad. Sci. USA 81:6024-6028[Abstract/Free Full Text].
57. Sundin, G. W., and C. L. Bender. 1993. Ecological and genetic analysis of copper and streptomycin resistance in Pseudomonas syringae pv. syringae. Appl. Environ. Microbiol. 59:1018-1024[Abstract/Free Full Text].
58. Van den Eede, G., R. Deblaere, K. Goethals, M. V. Montagu, and M. Holsters. 1992. Broad host range and promoter selection vectors for bacteria that interact with plants. Mol. Plant-Microbe Interact. 5:228-234[Medline].
59. Venturi, V., M. Otten, V. Korse, B. Brouwer, J. Leong, and P. Weisbeek. 1995. Alginate regulatory and biosynthetic gene homologs in Pseudomonas putida WCS358: correlation with the siderophore regulatory gene pfrA. Gene 155:83-88[Medline].
60. Wang, S.-K., I. Sà Correia, A. Darzins, and A. M. Chakrabarty. 1987. Characterization of the Pseudomonas aeruginosa alginate (alg) gene region II. J. Gen. Microbiol. 133:2303-2314[Medline].
61. Whitchurch, C. B., R. A. Alm, and J. S. Mattick. 1996. The alginate regulator AlgR and an associated sensor FimS are required for twitching motility in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 93:9839-9843[Abstract/Free Full Text].
62. Xie, Z., C. D. Hershberger, S. Shankar, R. W. Ye, and A. M. Chakrabarty. 1996. Sigma factor-anti-sigma factor interaction in alginate synthesis: inhibition of AlgT by MucA. J. Bacteriol. 178:4990-4996[Abstract/Free Full Text].
63. Yu, H., M. Mudd, J. C. Boucher, M. J. Schurr, and V. Deretic. 1997. Identification of the algZ gene upstream of the response regulator algR and its participation in control of alginate production in Pseudomonas aeruginosa. J. Bacteriol. 179:187-193[Abstract/Free Full Text].
64. Yu, J., A. Peñaloza-Vázquez, and C. L. Bender. 1998. Role of the exopolysaccharide alginate in the pathogenicity of Pseudomonas syringae pv. syringae. Phytopathology 88:S102.
65. Zielinski, N. A., R. Maharaj, S. Roychoudhury, C. E. Danganan, W. Hendrickson, and A. M. Chakrabarty. 1992. Alginate synthesis in Pseudomonas aeruginosa: environmental regulation of the algC promoter. J. Bacteriol. 174:7680-7688[Abstract/Free Full Text].


Journal of Bacteriology, June 1999, p. 3478-3485, Vol. 181, No. 11
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fakhr, M. K.
Right arrow Articles by Bender, C. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fakhr, M. K.
Right arrow Articles by Bender, C. L.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Appl. Environ. Microbiol. Infect. Immun. Eukaryot. Cell
Mol. Cell. Biol. J. Virol. Microbiol. Mol. Biol. Rev.
ALL ASM JOURNALS