Previous Article | Next Article ![]()
Journal of Bacteriology, June 1999, p. 3494-3504, Vol. 181, No. 11
Department of Molecular, Cellular and
Developmental Biology, Yale University, New Haven, Connecticut
06520-8103
Received 10 November 1998/Accepted 22 March 1999
VanA and VanB form an oxygenative demethylase that converts
vanillate to protocatechuate in microorganisms. Ferulate, an abundant phytochemical, had been shown to be metabolized through a vanillate intermediate in several Pseudomonas isolates, and
biochemical evidence had indicated that vanillate also is an
intermediate in ferulate catabolism by Acinetobacter.
Genetic evidence supporting this conclusion was obtained by
characterization of mutant Acinetobacter strains blocked in
catabolism of both ferulate and vanillate. Cloned Acinetobacter
vanA and vanB were shown to be members of a
chromosomal segment remote from a supraoperonic cluster containing other genes required for completion of the catabolism of ferulate and
its structural analogs, caffeate and coumarate, through
protocatechuate. The nucleotide sequence of DNA containing
vanA and vanB demonstrated the presence of
genes that, on the basis of nucleotide sequence similarity, appeared to
be associated with transport of aromatic compounds, metabolism of such
compounds, or iron scavenging. Spontaneous deletion of 100 kb of DNA
containing this segment does not impede the growth of cells with simple
carbon sources other than vanillate or ferulate. Additional spontaneous
mutations blocking vanA and vanB expression
were shown to be mediated by IS1236, including insertion of
the newly discovered composite transposon Tn5613. On the
whole, vanA and vanB appear to be located
within a nonessential genetic region that exhibits considerable genetic
malleability in Acinetobacter. The overall organization of
genes neighboring Acinetobacter vanA and vanB,
including a putative transcriptional regulatory gene that is
convergently transcribed and overlaps vanB, is conserved in
Pseudomonas aeruginosa but has undergone radical
rearrangement in other Pseudomonas species.
Vanillate demethylase is a member of
a superfamily of reductive dioxygenases with a broad range of
activities (47). The enzymes are of interest because they
provide model systems for analysis of electron transfer and because
they demonstrate the consequences of modular rearrangement of catalytic
domains during enzyme evolution (22).
Recent attention has focused upon vanillate as an intermediate in
ferulate catabolism by Pseudomonas species (Fig.
1). Nucleotide sequencing of
Pseudomonas strain ATCC 19151 genes encoding vanillate demethylase revealed open reading frames designated vanA and
vanB; these genes exhibited the high G+C content
characteristic of the genus (5). Examination of DNA cloned
from Pseudomonas sp. strain HR199 revealed vanA
and vanB genes on an EcoRI restriction fragment that also contained an open reading frame encoding vanillin
dehydrogenase; the latter open reading frame was in the same operon as
an open reading frame encoding a protein with amino acid sequence
similarity to enoyl coenzyme A (enoyl-CoA) hydratase (57).
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Genetic Analysis of a Chromosomal Region Containing
vanA and vanB, Genes Required for Conversion of
Either Ferulate or Vanillate to Protocatechuate in
Acinetobacter

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (25K):
[in a new window]
FIG. 1.
Vanillate and many other plant products are metabolized
through protocatechuate. The pob, qui, and
pca genes are clustered in the Acinetobacter
chromosome. The open box indicates protocatechuate, and the shaded box
indicates carboxymuconate, which is produced by the action of
protocatechuate 3,4-dioxygenase on protocatechuate. Arrows indicate
metabolic reactions and are accompanied by the designations of genes
encoding the enzymes that catalyze the reactions. Metabolic
accumulation of carboxymuconate in strain ADP230, defective in
pcaB, prevents the growth of cells in the presence of
substrates that can be metabolized to carboxymuconate.
Mutations blocking ferulate catabolism in Pseudomonas putida WCS358 allowed cloning from the organism of two restriction fragments containing DNA necessary for the metabolic pathway (62). The presence of vanA and vanB in one of the clones confirmed the role of these genes in ferulate catabolism. The other clone contained open reading frames for vanillin dehydrogenase and enoyl-CoA hydratase. Analysis of enzymes associated with ferulate metabolism in Pseudomonas fluorescens bv. VAN103 (48) demonstrated an enoyl-CoA hydratase that also acted as a lyase cleaving the hydrated derivative of ferulyl-CoA into vanillin and acetyl-CoA (23). Thus, in at least some Pseudomonas species, ferulate metabolism appears to proceed by thioester formation, hydration, and cleavage, giving rise to vanillin, which is oxidized to vanillate.
Acinetobacter and fluorescent Pseudomonas species
are the predominant representatives of the "Pseudomonas"
group within the
subdivision of the proteobacteria as classified by
the National Center for Biotechnology Information. Genetic comparison
of pathways for aromatic catabolism in the two taxa has revealed some
similarities and marked differences. In general, isofunctional enzymes
from the two taxa have amino acid sequence identity of roughly 50%. Differences are evident at the DNA level in that the
Pseudomonas genes characteristically have a G+C content
above 58% (32) whereas the Acinetobacter
genes, with a few notable exceptions, have a G+C content below 46%
(42). Numerous rearrangements accompanied the divergence of
the respective genes, yet transposition did not always lead to their
scattering in the chromosome of their hosts. Apparent selection for
grouping of genes with related physiological function is evident in the
Acinetobacter pca-qui-pob supraoperonic cluster (Fig. 1) in
a chromosomal segment containing more than 20 kb of DNA (11, 12,
16, 17, 26, 42). Recent investigations have demonstrated tight
linkage to pobA of a gene encoding a CoA-ligase required for
catabolism of ferulate and its structural analogs, caffeate and
coumarate (61). An objective of the present study was to
determine if vanA and vanB were linked to the
pca-qui-pob gene cluster.
Earlier investigations demonstrated that vanillate and protocatechuate (Fig. 1) are formed during the metabolism of ferulate by Acinetobacter calcoaceticus DSM586 (10). The conclusion that the vanillate pathway was the sole mechanism for ferulate utilization in Acinetobacter would be supported by the demonstration that mutations blocking vanillate demethylase prevented growth on ferulate. An organism well suited for such genetic analysis is Acinetobacter strain ADP1. This organism, formerly assigned to the species A. calcoaceticus but now recognized to be a representative of a separate taxon within Acinetobacter (3, 4, 15), is highly competent for natural transformation (36, 37). Furthermore, the physiological properties of this strain allow the design of a strategy for selection of mutants blocked in ferulate metabolism (Fig. 1).
Such a selection procedure was first used to survey the properties of spontaneous mutants blocked in pcaH and pcaG, structural genes for protocatechuate 3,4-dioxygenase. Among 94 independently selected strains, 4 contained a newly discovered insertion sequence, IS1236, within pcaH (25). Similar selection for strains blocked in p-hydroxybenzoate metabolism (Fig. 1) yielded strains with defects in either pobA, the structural gene for p-hydroxybenzoate hydroxylase, or pobR, which encodes the transcriptional activator of pobA (11, 13). Spontaneous mutations blocking pobR are caused predominantly by insertion of IS1236 at different locations throughout the gene (24).
In this report we describe the isolation of spontaneous vanA and vanB mutants and demonstrate that the genes for vanillate demethylase are essential for the growth of Acinetobacter with ferulate. A significant fraction of the vanA and vanB mutations were caused by IS1236, which also was shown to contribute to the structure of a newly discovered composite transposon, Tn5613, which can inactivate the van genes. Unlike other known genes associated with protocatechuate metabolism, vanA and vanB occupy a location separate from the pca-qui-pob cluster in the Acinetobacter chromosome.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains and plasmids.
Properties of bacterial
strains used in this investigation are summarized in Table
1, and relevant properties of plasmids are presented in Fig. 2.
Escherichia coli cultures were grown at 37°C in
Luria-Bertani (LB) medium (60). Acinetobacter
cultures were grown at 37°C in basal medium supplemented with carbon
sources as indicated in the text.
|
|
Isolation of mutant strains. Selection for loss of van functions was imposed by demanding growth of strain ADP230, a mutant that accumulates the toxic intermediate carboxymuconate when exposed to vanillate, on plates containing succinate as a growth substrate and either vanillate or ferulate as a source of the toxic metabolite (Fig. 1). After genetic restoration of the ability to metabolize carboxymuconate, natural transformation was used to map the mutations blocking vanillate metabolism (24, 30, 42).
Mutagenesis with mini-Tn10 (34) was achieved by mixing 4 × 107 E. coli SM10
pir(pLOFKm)
cells and 107 Acinetobacter strain ADP230 cells
on LB plates containing 50 µM
isopropyl-
-D-thiogalactopyranoside (IPTG). After 8 h of incubation, the cells were transferred from these plates and
spread on plates containing 10 mM succinate, 2 mM vanillate, and 25 mg
of kanamycin per ml. Colonies emerging on this medium were screened for
resistance to 2 mM ferulate. During maintenance in the absence of
kanamycin, the cell line derived from ADP672 lost resistance to the
antibiotic, giving rise to ADP673 (Table 1).
Colonies containing spontaneous mutants were selected by spreading
about 108 ADP230 cells on plates containing 3 mM ferulate
and 10 mM succinate. After single-colony isolation on the same medium,
mutant strains were screened for their ability to grow on plates
containing 10 mM succinate and 2 mM vanillate. The properties of
strains that grew on this medium are summarized in Table 1.
Natural transformation. Recipient Acinetobacter cells were grown in a shaker overnight in 5-ml cultures with 10 mM succinate, and succinate was added to an additional concentration of 10 mM the next morning. After 30 min of incubation, 200 µl of the culture was mixed with either cell lysate or plasmid DNA on a plate of selective medium. For transformation prior to selection, 200 µl of the overnight culture was added to a tube containing 5 ml of 10 mM succinate and incubated for 3 h, after which the cells were plated on selective medium.
Manipulation of DNA. Chromosomal DNA and cell lysate were prepared as previously described (25). Plasmid DNA was isolated with the Wizard Miniprep kit from Promega. Standard techniques of molecular biology were used in plasmid and gene manipulations (60).
Screening by replica plating for E. coli clones
containing the Acinetobacter vanillate demethylase
DNA.
Chromosomal DNA from wild-type Acinetobacter ADP1
was digested with EcoRI (New England Biolabs), and the
resulting fragments were ligated to pBSK (previously linearized with
EcoRI). The ligated material was introduced into E. coli DH5
by transformation, and the transformants were plated
onto LB agar plates containing ampicillin, 5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
and IPTG. The resulting E. coli colonies were screened for
the presence of vanillate demethylase genes by assessment of the
ability of plated replicas to transform the mutant ADP675 so that
recombinants grew with 2 mM vanillic acid as the sole carbon source
(2).
DNA sequencing and sequence analysis. Sequencing of double-stranded plasmid DNA or PCR templates was performed in an ABI 373 automated sequencer (Perkin-Elmer ABI) with T3, T7, m13 universal, and reverse primers and synthetic oligonucleotides. Subclones, nested deletions, and PCR fragments were made to complete the 14-kb sequence of the insert in pZR135. PCR fragments were used to sequence mutant genes. Homology searches were performed with the gapped BLAST database search program (1), and sequence analysis was performed with DNAMAN (Lynnon Biosoft).
Designed deletions. Knockout mutations for open reading frames encoding the SalA-like protein and the PcaU-like protein were created by replacing the internal SphI fragment of pZR140 with DNA encoding chloramphenicol resistance in pCAT19 (21). The insert from the resulting plasmid, pZR188 (Fig. 2), was introduced into wild-type Acinetobacter strain ADP1 by transformation followed by selection for chloramphenicol resistance. The resulting mutant, strain ADP1070, was tested for its ability to grow with ferulate, vanillate, or salicylate. To construct a plasmid for recovery of DNA by gap repair (28), the lacZ::Knr cassette from pKOK6 (41) was inserted into the NcoI site of vanB in pZR143. Digestion with XbaI, using one site from the pZR143 polylinker, then yielded a fragment which was ligated into the broad-host-range vector pRK415. Digestion of this plasmid with ClaI released DNA containing all of vanB, and the remaining linearized plasmid was used to recover chromosomal DNA containing vanB647.
p-Toluidine test for metabolic accumulation of protocatechuate. The color test developed by Parke (55) to screen for protocatechuate accumulation was used to detect formation of the compound from vanillate in E. coli cells containing different recombinant plasmids.
PCR amplifications. PCR amplifications were performed with 30 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 3 min. Special conditions were also used with the amplification of ADP647, ADP657, and ADP645 with primers Seq1 to Seq6: the extension time was 5 min, and the annealing temperature was 45°C.
PCR primers. PCR primers of special importance in efforts to characterize van mutants were located in open reading frames as follows: Seq1, 5' GTAACTCGGAGAGACTGTACGTC 3', regulatory protein (Fig. 2); VanB22, 5' GACGTACAGTCTCTCCGAGTTAC 3', regulatory protein (Fig. 2); Seq3, 5' GGGAAGTGTTCAGTCAGGTTGCC 3', vanB (positions 1772 to 1749); VanB11, 5' CGCCTATTCTCTCCATGGC 3', vanB (positions 1655 to 1673); VanB21, 5' CGTCAATATGTGAGCCTGCG 3', beginning of vanB (positions 1423 to 1403); VanA2, 5' CAGGCGTAACTACAATCGACAAC 3', end of vanA (positions 979 to 1003); Seq5, 5' CAGCCCACCGCCATAACTCCACTCT 3', vanA (positions 631 to 606); Seq6, 5' CAATAAGTGATAAGGAGTCG 3', upstream of vanA (positions 192 to 214); IS1, 5' GGCCATTTCTTGGATCTCC 3', 5' end of IS1236 (positions 60 to 78); IS2, 5' CGGCTGGTTAAGCCCAGAAGC 3', 3' end of IS1236 (positions 154 to 1174).
Nucleotide sequence accession numbers. The nucleotide sequence of the 14-kb EcoRI fragment containing Acinetobacter vanA and vanB appears in the GenBank nucleotide sequence database under accession no. AF009672. The GenBank accession number for the complete Tn5613 nucleotide sequence is AF091240, and the GenBank accession number for the 2.7-kb nucleotide sequence of the partial open reading frame carried as an insert in pZR153 is AF011339.
| |
RESULTS |
|---|
|
|
|---|
Isolation of mutants unable to metabolize either ferulate or
vanillate to protocatechuate.
To test the possibility that
vanillate is an intermediate in the catabolism of ferulate by
Acinetobacter, strains were selected on the basis of
their inability to convert ferulate to carboxymuconate, a toxic
intermediate that accumulates and prevents growth in strains containing
the pca
BDK1 deletion (Fig. 1), and then were screened for
potential blocks in their conversion of vanillate to protocatechuate. After exposure to mini-Tn10, ADP230 derivatives that had
acquired the transposon were selected by demanding growth in the
presence of kanamycin, and colonies that exhibited kanamycin resistance were screened for growth with succinate in the presence of ferulate. Further screening of ferulate-resistant isolates revealed two strains,
ADP672 and ADP674, that grew with succinate in the presence of either
ferulate or vanillate but failed to grow with succinate in the presence
of protocatechuate (Table 1). Replacement of the pca
BDK1
deletion in these strains produced the respective transformants ADP673
and ADP675, which grew in the presence of protocatechuate and, as would
be expected for strains blocked in vanillate demethylase, failed to
grow in the presence of either ferulate or vanillate (Table 1).
BDK1
in the spontaneous mutants gave rise to strains that grew at the
expense of protocatechuate and not at the expense of either vanillate
or ferulate (Table 1).
Cloning of DNA fragments containing genes for vanillate
demethylase.
Screening of E. coli colonies carrying a
library of EcoRI fragments of Acinetobacter DNA
revealed four strains, each of which contained a different recombinant
plasmid that transformed Acinetobacter strain ADP675 so that
it grew on vanillate. Two of the plasmids (pZR135 and pZR136) contained
14-kb inserts in opposite orientations with respect to the plasmid
promoter. The other two plasmids (pZR151 and pZR156) contained inserts
of 3.3 and 5.5 kb, respectively. As judged by the
p-toluidine color test (55), E. coli
DH5
(pZR135) produced a substantial amount of protocatechuate
from vanillate, whereas E. coli DH5
(pZR136), containing
the 14-kb EcoRI insert in reverse orientation with respect
to the plasmid lac promoter, formed a slight amount of
protocatechuate and E. coli strains containing pZR151 or
pZR156 did not form discernible amounts of protocatechuate.
Subcloning and characterization of mutant strains by gene replacement. Plasmid pZR135 and the five HindIII subclones derived from it (Fig. 2) were tested for their ability to restore wild-type function to the 10 mutant strains blocked in the conversion of vanillate to protocatechuate. The plasmids did not produce a wild-type phenotype when used as donors in transformation for strains ADP643 or ADP655; these strains did yield wild-type recombinants when treated with DNA from the parental strain ADP1. These mutant strains and strain ADP651 did not yield wild-type recombinants when used as the donor in transformation of the other strains blocked in vanillate catabolism. It thus appears that strains ADP643 and ADP655 have undergone deletions extending beyond the limits of the insert in pZR135; the deletion in strain ADP651 eliminates alleles for which van mutations were obtained but falls within the confines of the pZR135 insert. The remaining van mutants exhibited the ability to be transformed to the wild type by pZR135 and by either of two HindIII subclones, pZR138 or pZR137 (Fig. 2). This evidence suggested that the HindIII restriction site between the chromosomal fragments inserted in pZR138 and pZR137 (Fig. 2) lies within the genes required for vanillate catabolism.
Most of the mutant strains that were transformed by one of the HindIII subclones appear to have mutations at separate loci as evidenced by growth of wild-type recombinants after crosses between pairs of the strains. Exceptions to this pattern indicated that some independent mutations may have occurred at identical or nearby loci, and subsequent sequencing of the mutant DNA proved that this was the case. Anomalous results were obtained with strain ADP675, which subsequently was shown to have acquired two separate mutations in the van region.Nucleotide sequences of different Acinetobacter EcoRI restriction fragments that transform a van-deficient strain so that it grows with vanillate. Three different EcoRI chromosomal fragments conferred upon strain ADP675 the ability to grow with vanillate. The 5.5-kb insert of pZR156 contained an internal EcoRI site. Sequence analysis of the ends of the pZR156 insert revealed DNA corresponding to benK and benD. The location of restriction sites within the insert confirmed that the cloned genes encoded proteins required for the oxygenative metabolism of benzoate and corresponded to the insert of the previously described plasmids pIB1351 and pIB1352 (49, 50), together with an EcoRI fragment internal to benD. The 3.3-kb insert of pZR151 also contained an internal EcoRI site; a 2.7-kb EcoRI subclone in pZR153 remained able to confer upon ADP675 the ability to grow on vanillate. Sequencing of the 2,755-bp insert in pZR153 revealed that it consisted entirely of a large partial open reading frame beginning with sequences encoding tandem repeats of approximately 100 amino acids, similar to the fibronectin type III repeats in bacterial cellulases (29, 45, 46).
The complete 14,358-bp nucleotide sequence of the pZR135 insert revealed 12 open reading frames and two large DNA segments (one of 1,781 bp and one of 811 bp) with no obvious coding functions (Fig. 2). The open reading frames are of general interest because they are components of a 100-kb DNA fragment that has been selected in wild-type Acinetobacter yet is frequently lost during maintenance of the organism in the laboratory (27). Of immediate significance to this investigation were the two open reading frames encoding proteins with amino acid sequences closely resembling those determined for VanA and VanB, proteins that form vanillate demethylase in Pseudomonas species (5, 57, 62). The possibility that the Acinetobacter open reading frames assigned vanA and vanB function was enhanced by the fact that DNA from either pZR137 or pZR138 (Fig. 2) replaced mutations in these genes and, as described below, was confirmed by sequencing of mutant genes. The locations of Acinetobacter vanA and vanB are indicated in Fig. 2. Also indicated is an apparent regulatory gene, tentatively designated vanR, that converges upon vanB; the convergently transcribed genes overlap by 21 bp. To identify regions that might be associated with transcriptional termination, the 14-kb sequence of the EcoRI fragment was scanned for inverted repetitions containing complementary sequences exceeding 10 bp. The strongest free energy of association, 10.1 kcal/mol, was exhibited by an 11-bp palindrome separated by 7 bp. The palindrome begins 13 bp downstream from the translational terminus of vanB and is followed by the sequence TTTTTT. This potential terminator of the vanA and vanB transcript is of particular interest because it lies well within the convergently transcribed vanR. The longest palindromic pair proved to be 14 bp long and separated by 401 bp. This inverted repetition and an additional inverted repetition of 12 bp are within the 811-bp vanK-vanA intergenic region; all of the repeated sequences contain the internal palindromic sequence TGGATCCA. Further examination showed that GGATCC, the BamHI restriction site, occurs five times in the 811-bp vanK-vanA intergenic region and only three times in 70,000 bp of known nucleotide sequence from Acinetobacter strain ADP1. A close match to GGATCC is exhibited by the termini of IS1236, which are TGATCC and GGATCA. It is possible that palindromes containing the sequence GGATCC served as a class of preferred targets for IS1236 integration. Among open reading frames that resemble Acinetobacter vanA is the partial open reading frame at one end of the pZR135 insert. Over 171 aligned residues, the protein encoded by this open reading frame has identity of 33% to Acinetobacter VanA, less than the sequence identity of 72% for Acinetobacter VanA and its closest known homolog, VanA from Pseudomonas sp. strain HR199 (57). Two neighboring open reading frames in pZR135 closely resemble open reading frames with known functions in aromatic catabolism. One of these, designated the gene for a SalA-like protein in Fig. 2, encodes a protein with amino acid sequence identity of 30% to the known P. putida salicylate monooxygenase (68). The other open reading frame, whose product is designated PcaU-like protein in Fig. 2, encodes a product that resembles Rhodococcus opacus PcaR (30% sequence identity [18]) and Acinetobacter PcaU (27% sequence identity), the transcriptional activator of genes for protocatechuate catabolism (26). The ferredoxin-like protein (Fig. 2) most closely resembles (33% amino acid identity over 100 residues) a Pseudomonas protein, NagAb, believed to be part of the electron transport chain for both salicylate 5-hydroxylase, which converts salicylate to gentisate, and naphthalene dioxygenase (20). The functions of the salA-like and pcaU-like genes were explored by introduction of a deletion mutation removing 410 bp from the transcriptional terminus of the 813-bp pcaU-like gene and 886 bp from the beginning of the salA-like gene. Strains containing this mutation were unimpaired in their catabolism of salicylate, vanillate, and protocatechuate as judged by growth on plates; therefore, the altered genes appear to be associated with other functions. Two genes that may form a transcriptional unit in pZR135 appear to be associated with transport. One of these, designated the gene for VanK in Fig. 2, encodes a product with amino acid sequence with 31% identity to Acinetobacter PcaK, a member of a family of proteins known to transport p-hydroxybenzoate and protocatechuate in bacteria (7, 31, 35, 42, 52, 63). The other transport related open reading frame, indicated as a gene with outer membrane protein (OMP)-like function in Fig. 2, encodes a product with 32% sequence identity to its closest known homolog, P. putida PhaK, which is required for growth of the organism on phenylacetate (53). The putative Acinetobacter porin also exhibits close sequence similarity to four gene products assigned OMP functions in Pseudomonas aeruginosa (65, 67); comparison of the products of the Acinetobacter OMP-like gene with the Pseudomonas genes revealed amino acid sequence identities ranging between 25 and 31%. Upstream of the regulatory gene that overlaps with vanB (Fig. 2) is an ORF encoding a protein with up to 27% identity to several members of the 2-oxoglutarate-dependent oxygenase family in a variety of plants. Because two members are multifunctional gibberellin oxidases that can convert the aldehyde of this plant hormone to its acid (43), this raises the possibility that the Acinetobacter enzyme catalyzes the conversion of vanillin to vanillate. In Pseudomonas sp. strain HR199, this function is performed by an NAD-dependent dehydrogenase and its gene is near vanAB on the chromosome (57). Transcribed divergently from this oxygenase gene, cloned in pZR135 and separated by over 1,700 bp of DNA without any obvious coding potential, is an ORF for a protein with up to 31% identity (48 of 152 aligned residues) to various yeast hypothetical acetyltransferases. This protein is less closely related to an N-acetyltransferase that provides resistance to the antibiotic streptothricin in diverse bacteria. Lastly, on the end of the pZR135 insert and transcribed in the opposite direction to the putative acetyltransferase gene is the end of a gene encoding a protein with 23 to 33% identity to the corresponding segment of various iron-scavenging outer membrane receptors including the E. coli FhuA ferrichrome receptor, the P. aeruginosa FptA iron-pyochelin receptor, and the Vibrio anguillarum FatA iron-anguibactin receptor. Ligands for the last two receptors are structurally related (9, 56, 64) to other pathogenic bacterial siderophores including yersiniabactin (56) from various Yersinia species and acinetobactin (14, 64) from Acinetobacter baumanii.Nucleotide sequences of vanA and vanB genes
containing spontaneous mutations.
The primers Seq1 and Seq6 were
used to amplify the chromosomal DNA containing vanA and
vanB from the Acinetobacter chromosome, and
internal primers (Seq2, Seq3, and Seq5) were used to sequence mutations
in these genes. As expected, the PCR did not yield amplified fragments with the deletion mutations
vanAB643,
vanAB651, and
vanAB655. Sequencing
revealed that
vanA653 is a 13-bp deletion removing 7 bp
of directly repeated nucleotide sequence (Fig.
3), suggesting that the mutation was
directed in part by hybridization between slipped DNA strands (Fig.
4).
|
|
Nucleotide sequences of vanA and vanB genes containing mutations caused by mini-Tn10. Mini-Tn10 proved to be unstable in the two mutants that emerged after selection for the kanamycin resistance marker carried by this transposon. The marker was lost in the cell line that gave rise to the kanamycin-sensitive strain ADP673, which did not grow with vanillate. Mapping of vanA673 in this strain suggested that it was extremely close to the 13-bp deletion van653 (Fig. 3), raising the possibility that the DNA strand slippage giving rise to this mutation influences the behavior of the transposon at the same location (Fig. 4). As indicated in Fig. 3, the departed mini-Tn10 left behind a 50-bp signature sequence of nearly precise excision (58), and this sequence is flanked by 9-bp direct repeats (40) of chromosomal nucleotide sequence (Fig. 3).
Multiple mutations emerged in strain ADP675 after its treatment with mini-Tn10 followed by selection for resistance to the intracellular accumulation of
-carboxymuconate. The mutant strain retained its resistance to kanamycin. The gene conferring this trait
was recovered from an EcoRI library from the mutant strain and proved to be in a DNA fragment containing a portion of the van genes. One end of this EcoRI restriction
fragment corresponded to the site within a portion of the putative
vanA-like gene in pZR135 (Fig. 2), and the other
EcoRI site was within Tn5613. Sequence analysis
demonstrated that the kanamycin resistance determinant was not in
vanA or vanB. Evidence for its temporary
insertion was revealed by vanA675, which contains the 50 bp
sequence corresponding to nearly precise excision flanked by 9-bp
chromosomal repeats (40, 58). Strain ADP675 also contained
the portion of Tn5613 extending to its internal
EcoRI site in vanB675 (Fig. 3). This was
demonstrated by sequencing from Tn5613 into DNA upstream
from vanB (Fig. 3). PCR primers downstream from
vanB675 did not yield an amplified product with chromosomal
DNA from ADP675, and so it seemed likely that a portion of this DNA was
deleted downstream from the site of Tn5613 insertion in the
mutant strain.
| |
DISCUSSION |
|---|
|
|
|---|
vanA and vanB, essential for metabolism of both ferulate and vanillate, are separated from the pca-qui-pob gene cluster in the Acinetobacter chromosome. At the outset of this investigation, it was not clear whether vanillate was an obligatory intermediate in the utilization of ferulate by Acinetobacter. Essential participation of vanillate as a catabolite is demonstrated by the fact that spontaneous Acinetobacter mutations blocking vanA and vanB prevent growth with ferulate, and this growth property is restored by exposure of the mutant cells to DNA containing the wild-type genes. Such a conclusion could not be drawn on the basis of sequence evidence alone. The 14-kb DNA fragment containing vanA and vanB also contains an open reading frame resembling vanA in sequence but apparently not involved in growth with vanillate. Also within this DNA fragment is a gene that, on the basis of sequence similarity, appears to encode salicylate hydroxylase. However, inactivation of this open reading frame does not prevent growth with salicylate, and so the function of this gene awaits elucidation.
The precise locations of vanA and vanB are unknown, but the genes appear to be lacking in organisms that have undergone the spontaneous deletion eliminating a 100-kb DNA fragment from the Acinetobacter ADP1 chromosome (27). Such strains grow with protocatechuate but not with vanillate and do not reveal DNA fragments corresponding to portions of vanA or vanB on PCR with primers that do produce such fragments after amplification of wild-type chromosomal DNA. The 100-kb deletion was fortuitously discovered during mapping of the Acinetobacter chromosome and occurs in a region that appears to contain multiple copies of IS1236 (24, 27), perhaps reflecting in part the presence of Tn5613. If the van genes do lie within the deleted region, then preferential localized transposition of Tn5613 may explain why this transposon was not detected previously among spontaneous mutations in pob or pca genes. The discovery of Tn5613 adds a new genetic marker that may facilitate the typing of Acinetobacter strains and rapid identification of the strains most likely to be associated with hospital infection (3, 4, 15). The identity of Tn5613 as a transposon associated primarily with Acinetobacter and not with Pseudomonas is affirmed by the G+C content of 39% for the transposon as a whole and 36% for the internal open reading frame. The 100 kb of spontaneously deleted DNA and by implication the van region are distant from the 20-kb pca-qui-pob gene cluster in the Acinetobacter chromosome (27). This makes vanA and vanB the only genes associated with the metabolic activities summarized in Fig. 1 that are separate from the cluster. It is possible that the locations of vanA and vanB are related to their evident instability. Loss of the genes would cause ferulate to be converted to vanillate, while coumarate and caffeate, which are related to ferulate in both structure and nutritional source, would be metabolized completely through protocatechuate. Thus, the existence of spontaneous van-deficient strains in natural Acinetobacter populations might allow the production of vanillate from ferulate as a chemical signal between plants and bacteria.Spontaneous mutations caused by Tn5613. Insertions of IS1236 at different positions in Acinetobacter pobR cause most of the spontaneous mutations in this gene and are accompanied by a target site duplication of 3 bp (24). Insertion of IS1236 into pcaH is accompanied by less precise duplications, and such insertions appear to cause only about 10% of the spontaneous mutations in pcaH and pcaG (25). In this study, the newly discovered transposon Tn5613, which includes two copies of IS1236, was found to be a significant contributor to spontaneous mutation in vanA and vanB and to have generated a 3-bp duplication upon insertion in vanB647 (Fig. 3). The mutations vanA645 and vanB657 appear to be more complex but include at least one copy of IS1236 as well as a 3-bp target site duplication. Insertion of a different transposon in these two strains, composed of IS1236 elements including one from Tn5613, is consistent with the inability to PCR amplify across the mutation together with the inability to detect by PCR an intact Tn5613 element.
Contrasting arrangement in the Pseudomonas chromosome of genes flanking vanAB. The overlap of the 3' ends of vanB and the convergently transcribed putative regulatory gene vanR, an arrangement not found previously in ADP1 for genes involved in aromatic catabolism, prompted an analysis of DNA including vanA and vanB in other organisms. DNA for a VanR homolog, a regulatory protein in the GntR family (33), was identified in two pseudomonads, but, unexpectedly, in P. putida WCS358 (62) it was convergently transcribed from vanB, as in ADP1, whereas in Pseudomonas sp. strain HR199 (57) it was divergently transcribed from vanA (Fig. 5). Due either to mutation or sequence data ambiguity, a frameshift is required in both Pseudomonas sequences to maximize the amino acid alignment with their putative ADP1 homolog. Furthermore, the P. putida WCS358 locus corresponding to vanK in ADP1 appears to be occupied by a gene for the periplasmic ATP-binding protein component of an ABC-type transport system (Fig. 5). The VanK amino acid sequence identifies it as a member of the major facilitator superfamily of transport proteins, structurally distinct from ATP-binding cassette transporters (54); therefore, significantly different classes of protein appear to have been called upon during evolution of the transport capacity associated with the vanAB region in different soil bacteria. Based on preliminary sequence information from the Pseudomonas Genome Project, P. aeruginosa PAO1 has a vanAB region similar in organization to that of Acinetobacter sp. strain ADP1 (Fig. 5). The presence of this unusual gene organization in the two genera cannot be attributed to recent horizontal transfer between Pseudomonas and Acinetobacter, because the respective genes each possess the distinctive G+C contents characteristic of their host chromosome.
|
Chromosomal linkage of van genes to a putative iron-scavenging receptor gene. During mapping of the Acinetobacter chromosome, strain ADP1 lost the ability to grow on vanillate, apparently due to the spontaneous deletion of 100 kb of chromosomal DNA including the van region. The detection of several copies of IS1236 in the chromosomal fragment encompassing the deletion in the parental strain (27) and the spontaneous van mutants with insertions of Tn5613, including vanB675 with a flanking deletion, is consistent with the spontaneous deletion being mediated in ADP1, directly or indirectly, by transposable elements. Given the linkage of vanA and vanB to a putative siderophore receptor gene (Fig. 2), the malleability of this region may be analogous to that described for DNA containing genes for iron metabolism in other bacteria (19). In the plague bacterium Yersinia pestis, for instance, genes for iron acquisition are located within a pathogenicity island in a 102-kb unstable region of the chromosome that is prone to spontaneous deletion apparently by recombination between flanking IS elements (6, 19).
Having siderophore genes flanked by repetitive DNA sequences can confer several advantages to a bacterium. On the one hand, this arrangement may facilitate tandem amplification of the genetic region (59), with the increased gene dosage leading to increased siderophore generation. During pathogenic interactions, this would be to the detriment of the host, but the siderophores of the fluorescent pseudomonads are associated with improved plant growth (51). On the other hand, spontaneous loss of genes can be advantageous to bacteria in certain niches (44): deletion of genes for ferrisiderophore receptors, for instance, would remove an outer membrane protein commonly used as an entry point for phage or the antibiotics of competing microorganisms (51). In Acinetobacter, a frequent additional consequence of deletion of the genetic region containing a putative iron uptake gene would be the loss of vanA and vanB. Such a loss would modify the bacteria into bioreactors capable of converting ferulate to vanillate.| |
ACKNOWLEDGMENTS |
|---|
This research was supported by grants from the Army Research Office and the National Science Foundation. A.S. was supported by a postdoctoral fellowship from the Spanish Ministerio de Educacion y Ciencia.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Molecular, Cellular and Developmental Biology, Yale University, P.O. Box 208103, New Haven, CT 06520-8103. Phone: (203) 432-3498. Fax: (203) 432-3497. E-mail: nicholas.ornston{at}yale.edu.
Publication 19 from the Biological Transformation Center in the
Yale Biospherics Institute.
Present address: Department of Biochemistry, Consejo Superior de
Investigaciones Científicas, Estacíon Experimental de
Zaidín, 18012 Granada, Spain.
§ Present address: Institut für Allg. Botanik, Abteilung Mikrobiologie, Hamburg, Germany.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Altschul, S. F.,
T. L. Madden,
A. A. Schäffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402 |
| 2. |
Averhoff, B.,
L. Gregg-Jolly,
D. Elsemore, and L. N. Ornston.
1992.
Genetic analysis of supraoperonic clustering by use of natural transformation in Acinetobacter calcoaceticus.
J. Bacteriol.
174:200-204 |
| 3. | Bouvet, P. J., and S. Jeanjean. 1995. Differentiation of Acinetobacter calcoaceticus sensu stricto from related Acinetobacter species by electrophoretic polymorphism of malate dehydrogenase, glutamate dehydrogenase and catalase. Res. Microbiol. 146:773-785[Medline]. |
| 4. |
Bouvet, P. J.,
S. Jeanjean,
J. F. Vieu, and L. Dijkshoorn.
1990.
Species, biotype, and bacteriophage type determinations compared with cell envelope protein profiles for typing Acinetobacter strains.
J. Clin. Microbiol.
28:170-176 |
| 5. |
Brunel, F., and J. Davison.
1988.
Cloning and sequencing of Pseudomonas genes encoding vanillate demethylase.
J. Bacteriol.
170:4924-4930 |
| 6. |
Buchrieser, C.,
M. Prentice, and E. Carniel.
1998.
The 102-kilobase unstable region of Yersinia pestis comprises a high-pathogenicity island linked to a pigmentation segment which undergoes internal rearrangement.
J. Bacteriol.
180:2321-2329 |
| 7. |
Collier, L. S.,
N. N. Nichols, and E. L. Neidle.
1997.
benK encodes a hydrophobic permease-like protein involved in benzoate degradation by Acinetobacter sp. strain ADP1.
J. Bacteriol.
179:5943-5946 |
| 8. |
Correll, C. C.,
C. J. Batie,
D. P. Ballou, and M. L. Ludwig.
1992.
Phthalate dioxygenase reductase: a modular structure for electron transfer from pyridine nucleotides to [2Fe-2S].
Science
258:1604-1610 |
| 9. | Crosa, J. H. 1997. Signal transduction and transcriptional and posttranscriptional control of iron-regulated genes in bacteria. Microbiol. Mol. Biol. Rev. 61:319-336[Abstract]. |
| 10. | Delneri, D., G. Degrassi, R. Rizzo, and C. V. Bruschi. 1995. Degradation of trans-ferulic and p-coumaric acid by Acinetobacter calcoaceticus DSM 586. Biochim. Biophys. Acta 1244:363-367[Medline]. |
| 11. |
DiMarco, A. A.,
B. Averhoff, and L. N. Ornston.
1993.
Identification of the transcriptional activator pobR and characterization of its role in the expression of pobA, the structural gene for p-hydroxybenzoate hydroxylase in Acinetobacter calcoaceticus.
J. Bacteriol.
175:4499-4506 |
| 12. | DiMarco, A. A., B. A. Averhoff, E. E. Kim, and L. N. Ornston. 1993. Evolutionary divergence of pobA, the structural gene encoding p-hydroxybenzoate hydroxylase in an Acinetobacter calcoaceticus strain well-suited for genetic analysis. Gene 125:25-33[Medline]. |
| 13. |
DiMarco, A. A., and L. N. Ornston.
1994.
Regulation of p-hydroxybenzoate hydroxylase synthesis by PobR bound to an operator in Acinetobacter calcoaceticus.
J. Bacteriol.
176:4277-4284 |
| 14. |
Echenique, J. R.,
H. Arienti,
M. E. Tolmasky,
R. R. Read,
R. J. Staneloni,
J. H. Crosa, and L. A. Actis.
1992.
Characterization of a high-affinity iron transport system in Acinetobacter baumannii.
J. Bacteriol.
174:7670-7679 |
| 15. | Ehrenstein, B., A. T. Bernards, L. Dijkshoorn, P. Gerner-Smidt, K. J. Towner, P. J. Bouvet, F. D. Daschner, and H. Grundmann. 1996. Acinetobacter species identification by using tRNA spacer fingerprinting. J. Clin. Microbiol. 34:2414-2420[Abstract]. |
| 16. |
Elsemore, D. A., and L. N. Ornston.
1994.
The pca-pob supraoperonic cluster of Acinetobacter calcoaceticus contains quiA, the structural gene for quinate-shikimate dehydrogenase.
J. Bacteriol.
176:7659-7666 |
| 17. |
Elsemore, D. A., and L. N. Ornston.
1995.
Unusual ancestry of dehydratases associated with quinate catabolism in Acinetobacter calcoaceticus.
J. Bacteriol.
177:5971-5978 |
| 18. |
Eulberg, D.,
S. Lakner,
L. A. Golovleva, and M. Schlömann.
1998.
Characterization of a protocatechuate catabolic gene cluster from Rhodococcus opacus 1CP: evidence for a merged enzyme with 4-carboxymuconolactone-decarboxylating and 3-oxoadipate enol-lactone-hydrolyzing activity.
J. Bacteriol.
180:1072-1081 |
| 19. | Fetherston, J. D., P. Schuetze, and R. D. Perry. 1992. Loss of the pigmentation phenotype in Yersinia pestis is due to the spontaneous deletion of 102 kb of chromosomal DNA which is flanked by a repetitive element. Mol. Microbiol. 6:2693-2704[Medline]. |
| 20. | Fuenmayor, S. L., M. Wild, A. L. Boyes, and P. A. Williams. A gene cluster encoding steps in conversion of naphthalene to gentisate in Pseudomonas sp. strain U2. J. Bacteriol. 180:2522-2530. |
| 21. | Fuqua, W. C. 1992. An improved chloramphenicol resistance gene cassette for site-directed marker replacement mutagenesis. BioTechniques 12:223-225[Medline]. |
| 22. | Gassner, G. T., M. L. Ludwig, D. L. Gatti, C. C. Correll, and D. P. Ballou. 1995. Structure and mechanism of the iron-sulfur flavoprotein phthalate dioxygenase reductase. FASEB J. 9:1411-1418[Abstract]. |
| 23. |
Gasson, M. J.,
Y. Kitamura,
W. R. McLauchlan,
A. Narbad,
A. J. Parr,
E. L. H. Parsons,
J. Payne,
M. J. C. Rhodes, and N. J. Walton.
1998.
Metabolism of ferulic acid to vanillin. A bacterial gene of the enoyl-SCoA hydratase/isomerase superfamily encodes an enzyme for the hydration and cleavage of a hydroxycinnamic acid SCoA thioester.
J. Biol. Chem.
273:4163-4170 |
| 24. | Gerischer, U., D. A. D'Argenio, and L. N. Ornston. 1996. IS1236, a newly discovered member of the IS3 family, exhibits varied patterns of insertion into the Acinetobacter calcoaceticus chromosome. Microbiology 142:1825-1831[Abstract]. |
| 25. |
Gerischer, U., and L. N. Ornston.
1995.
Spontaneous mutations in pcaH and -G, structural genes for protocatechuate 3,4-dioxygenase in Acinetobacter calcoaceticus.
J. Bacteriol.
177:1336-1347 |
| 26. |
Gerischer, U.,
A. Segura, and L. N. Ornston.
1998.
PcaU, a transcriptional activator of genes for protocatechuate utilization in Acinetobacter.
J. Bacteriol.
180:1512-1524 |
| 27. | Gralton, E. M., A. L. Campbell, and E. L. Neidle. 1997. Directed introduction of DNA cleavage sites to produce a high-resolution genetic and physical map of the Acinetobacter sp. strain ADP1 (BD413UE) chromosome. Microbiology 143:1345-1357[Abstract]. |
| 28. |
Gregg-Jolly, L. A., and L. N. Ornston.
1990.
Recovery of DNA from the Acinetobacter calcoaceticus chromosome by gap repair.
J. Bacteriol.
172:6169-6172 |
| 29. | Hansen, C. K. 1992. Fibronectin type III-like sequences and a new domain type in prokaryotic depolymerases with insoluble substrates. FEBS Lett. 305:91-96[Medline]. |
| 30. |
Hartnett, G. B.,
B. Averhoff, and L. N. Ornston.
1990.
Selection of Acinetobacter calcoaceticus mutants deficient in the p-hydroxybenzoate hydroxylase gene (pobA), a member of a supraoperonic cluster.
J. Bacteriol.
172:6160-6161 |
| 31. |
Harwood, C. S.,
N. N. Nichols,
M. K. Kim,
J. L. Ditty, and R. E. Parales.
1994.
Identification of the pcaRKF gene cluster from Pseudomonas putida: involvement in chemotaxis, biodegradation, and transport of 4-hydroxybenzoate.
J. Bacteriol.
176:6479-6488 |
| 32. |
Harwood, C. S., and R. E. Parales.
1996.
The -ketoadipate pathway and the biology of self-identity.
Annu. Rev. Microbiol.
50:553-590[Medline].
|
| 33. | Haydon, D. J., and J. R. Guest. 1991. A new family of bacterial regulatory proteins. FEMS Microbiol Lett. 63:291-295[Medline]. |
| 34. |
Herrero, M.,
V. de Lorenzo, and K. N. Timmis.
1990.
Transposon vectors containing non-antibiotic resistance for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria.
J. Bacteriol.
172:6557-6567 |
| 35. |
Iwabuchi, T., and S. Harayama.
1997.
Biochemical and genetic characterization of 2-carboxybenzaldehyde dehydrogenase, an enzyme involved in phenanthrene degradation by Nocardioides sp. strain KP7.
J. Bacteriol.
179:6488-6494 |
| 36. |
Juni, E.
1972.
Interspecies transformation of Acinetobacter: genetic evidence for a ubiquitous genus.
J. Bacteriol.
112:917-931 |
| 37. |
Juni, E., and A. Janik.
1969.
Transformation of Acinetobacter calcoaceticus (Bacterium anitratum).
J. Bacteriol.
98:281-288 |
| 38. |
Junker, F.,
R. Kiewitz, and A. M. Cook.
1997.
Characterization of the p-toluenesulfonate operon tsaMBCD and tsaR in Comamonas testosteroni T-2.
J. Bacteriol.
179:919-927 |
| 39. | Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved broad-host-range plasmids for cloning in gram-negative bacteria. Gene 70:191-197[Medline]. |
| 40. | Kleckner, N. 1979. DNA sequence analysis of Tn10 insertions: origin and role of 9 bp flanking repetitions during Tn10 translocation. Cell 16:711-720[Medline]. |
| 41. | Kokotek, W., and W. Lotz. 1989. Construction of a lacZ-kanamycin-resistance cassette, useful for site-directed mutagenesis and as a promoter probe. Gene 84:467-471[Medline]. |
| 42. | Kowalchuk, G. A., G. B. Hartnett, A. Benson, J. E. Houghton, K. L. Ngai, and L. N. Ornston. 1994. Contrasting patterns of evolutionary divergence within the Acinetobacter calcoaceticus pca operon. Gene 146:23-30[Medline]. |
| 43. |
Lange, T.
1997.
Cloning gibberellin dioxygenase genes from pumpkin endosperm by heterologous expression of enzyme activities in Escherichia coli.
Proc. Natl. Acad. Sci. USA
94:6553-6558 |
| 44. |
Maurelli, A. T.,
R. E. Fernandez,
C. A. Bloch,
C. K. Rode, and A. Fasano.
1998.
"Black holes" and bacterial pathogenicity: a large genomic deletion that enhances the virulence of Shigella spp. and enteroinvasive Escherichia coli.
Proc. Natl. Acad. Sci. USA
95:3943-3948 |
| 45. |
Meinke, A.,
N. R. Gilkes,
D. G. Kilburn,
R. C. Miller, Jr., and R. A. Warren.
1991.
Multiple domains in endoglucanase B (CenB) from Cellulomonas fimi: functions and relatedness to domains in other polypeptides.
J. Bacteriol.
173:7126-7135 |
| 46. |
Meinke, A.,
N. R. Gilkes,
E. Kwan,
D. G. Kilburn,
R. A. Warren, and R. C. Miller, Jr.
1994.
Cellobiohydrolase A (CbhA) from the cellulolytic bacterium Cellulomonas fimi is a -1,4-exocellobiohydrolase analogous to Trichoderma reesei CBH II.
Mol. Microbiol.
12:413-422[Medline].
|
| 47. | Nakatsu, C. H., N. A. Straus, and R. C. Wyndham. 1995. The nucleotide sequence of the Tn5271 3-chlorobenzoate 3,4-dioxygenase genes (cbaAB) unites the class IA oxygenases in a single lineage. Microbiology 141:485-495[Abstract]. |
| 48. | Narbad, A., and M. J. Gasson. 1998. Metabolism of ferulic acid via vanillin using a novel CoA-dependent pathway in a newly-isolated strain of Pseudomonas fluorescens. Microbiology 144:1397-1405[Abstract]. |
| 49. |
Neidle, E. L.,
C. Hartnett,
L. N. Ornston,
A. Bairoch,
M. Rekik, and S. Harayama.
1991.
Nucleotide sequences of the Acinetobacter calcoaceticus benABC genes for benzoate 1,2-dioxygenase reveal evolutionary relationships among multicomponent oxygenases.
J. Bacteriol.
173:5385-5395 |
| 50. |
Neidle, E. L.,
M. K. Shapiro, and L. N. Ornston.
1987.
Cloning and expression in Escherichia coli of Acinetobacter calcoaceticus genes for benzoate degradation.
J. Bacteriol.
169:5496-5503 |
| 51. |
Neilands, J. B.
1995.
Siderophores: structure and function of microbial iron transport compounds.
J. Biol. Chem.
270:26723-26726 |
| 52. |
Nichols, N. N., and C. S. Harwood.
1997.
PcaK, a high-affinity permease for the aromatic compounds 4-hydroxybenzoate and protocatechuate from Pseudomonas putida.
J. Bacteriol.
179:5056-5061 |
| 53. |
Olivera, E. R.,
B. Minambres,
B. Garcia,
C. Muniz,
M. A. Moreno,
A. Ferrandez,
E. Diaz,
J. L. Garcia, and J. M. Luengo.
1998.
Molecular characterization of the phenylacetic acid catabolic pathway in Pseudomonas putida U: the phenylacetyl-CoA catabolon.
Proc. Natl. Acad. Sci. USA
95:6419-6424 |
| 54. |
Pao, S. S.,
I. T. Paulsen, and M. H. Saier, Jr.
1998.
Major facilitator superfamily.
Microbiol. Mol. Biol. Rev.
62:1-34 |
| 55. |
Parke, D.
1992.
Application of p-toluidine in chromogenic detection of catechol-protocatechuate diphenolic intermediates in catabolism of aromatic compounds.
Appl. Env. Microbiol.
58:2694-2697 |
| 56. |
Pelludat, C.,
A. Rakin,
C. A. Jacobi,
S. Schubert, and J. Heesemann.
1998.
The yersiniabactin biosynthetic gene cluster of Yersinia enterocolitica: organization and siderophore-dependent regulation.
J. Bacteriol.
180:538-546 |
| 57. |
Priefert, H.,
J. Rabenhorst, and A. Steinbuchel.
1997.
Molecular characterization of genes of Pseudomonas sp. strain HR199 involved in bioconversion of vanillin to protocatechuate.
J. Bacteriol.
179:2595-2607 |
| 58. | Ross, D. G., J. Swan, and N. Kleckner. 1979. Nearly precise excision: a new type of DNA alteration associated with the translocatable element Tn10. Cell 16:733-738[Medline]. |
| 59. | Roth, J. R., N. Benson, T. Galitski, K. Haack, J. G. Lawrence, and L. Miesel. 1996. Rearrangements of the bacterial chromosome: formation and applications, p. 2256-2276. In J. L. I. F. C. Neidhart, K. B. Low, B. Magasanik, M. Schaecter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, D.C. |
| 60. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 61. | Smith, M. A., G. Huang, D. M. Young, and L. N. Ornston. 1998. The Acinetobacter pca-qui-pob supraoperonic cluster extends to a ligase required for catabolism of coumarate, caffeate and ferulate, abstr. K-148, p. 350. In Abstracts of the 98th General Meeting of the American Society for Microbiology 1998. American Society for Microbiology, Washington, D.C. |
| 62. | Venturi, V., F. Zennaro, G. Degrassi, B. C. Okeke, and C. V. Bruschi. 1998. Genetics of ferulic acid bioconversion to protocatechuic acid in plant-growth-promoting Pseudomonas putida WCS358. Microbiology 144:965-973[Abstract]. |
| 63. |
Williams, P. A., and L. E. Shaw.
1997.
mucK, a gene in Acinetobacter calcoaceticus ADP1 (BD413), encodes the ability to grow on exogenous cis,cis-muconate as the sole carbon source.
J. Bacteriol.
179:5935-5942 |
| 64. | Yamamoto, S., N. Okujo, and Y. Sakakibara. 1994. Isolation and structure elucidation of acinetobactin, a novel siderophore from Acinetobacter baumannii. Arch. Microbiol. 162:249-254[Medline]. |
| 65. | Yamano, Y., T. Nishikawa, and Y. Komatsu. 1993. Cloning and nucleotide sequence of anaerobically induced porin protein E1 (OprE) of Pseudomonas aeruginosa PAO1. Mol. Microbiol. 8:993-1004[Medline]. |
| 66. | Yanisch-Perron, G., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119[Medline]. |
| 67. |
Yoneyama, H.,
E. Yoshihara, and T. Nakae.
1992.
Nucleotide sequence of the protein D2 gene of Pseudomonas aeruginosa.
Antimicrob. Agents Chemother.
36:1791-1793 |
| 68. | You, I. S., D. Ghosal, and I. C. Gunsalus. 1991. Nucleotide sequence analysis of the Pseudomonas putida PpG |