Previous Article | Next Article ![]()
Journal of Bacteriology, June 1999, p. 3777-3783, Vol. 181, No. 12
Laboratory of Microbiology, Department of
Biomolecular Sciences, Wageningen Agricultural University, NL-6703
CT Wageningen, The Netherlands,1 and
Institut für Allgemeine Mikrobiologie der
Christian-Albrechts-Universität zu Kiel, D-24118 Kiel,
Germany2
Received 12 February 1999/Accepted 19 April 1999
The genetic organization, expression, and regulation of the
celB locus of the hyperthermophilic archaeon
Pyrococcus furiosus were analyzed. This locus includes the
celB gene, which codes for an intracellular
The clustering of archaeal genes
into operons as well as the size of the archaeal genome
resembles the organization of the bacterial chromosome (1,
41, 47). However, the process of gene expression is quite
different in the domains Bacteria and Archaea.
Unlike that of bacteria, the transcription initiation machinery of
archaea is very similar to that of eucarya (1, 2, 15, 26,
39). The archaeal RNA polymerase is structurally related to the
RNA polymerases II of members of the domain Eucarya (26). In addition, archaeal transcription requires two
eucaryal-like transcription factors, i.e., the TATA-binding
protein (TBP) and transcription factor IIB (TFIIB; the archaeal
homolog is called TFB) (11, 15, 16, 18, 45). The binding
site of TBP in many archaeal promoters, like that of the eucaryal RNA
polymerase II promoters, is a TATA box located approximately 25 to 30 nucleotides upstream of the transcription initiation site (14, 30,
31).
In contrast to the growing understanding of the basic machinery of
transcription initiation in archaea, our understanding of the
mechanisms of the regulation of this process is slight (2).
The few studies that have addressed control of archaeal transcription
have been limited to describing modulations of gene expression. Such
effects have been reported for several hyperthermophilic crenarchaeotes
and their viruses (47), as well as for some methanogens (5, 6, 28, 29). The molecular analysis of transcription regulation in hyperthermophilic euryarchaeota is limited to a report of
two metabolic enzymes of Pyrococcus furiosus that appear to
be upregulated at the transcriptional level by the Here we present a molecular analysis of transcription regulation in
P. furiosus, which is able to grow on a wide range of substrates, such as proteins and carbohydrates (9, 13).
Because of this apparent flexible metabolism, it was anticipated that the hydrolytic enzymes involved in polymer utilization are
subjected to some form of regulation. In this study, we have analyzed
the regulation of enzymes that are involved in the growth of
P. furiosus on Sequence analysis of the celB locus of P. furiosus.
To complete the nucleotide sequence of the P. furiosus celB locus (44), we sequenced the pyrococcal
DNA in pLUW500 covering the 3.5-kb PstI-BamHI
fragment, including the adhA, adhB, and lamA genes (Fig. 1).
Nucleotide sequencing was carried out on a model 373A automated DNA
sequencer (Applied Biosystems) with a Prism Ready Reaction DyeDeoxy
Terminator cycle sequencing kit or on a LiCor 4000L sequencer with a
Thermo Sequenase fluorescence-labelled-primer cycle sequencing kit with
7-deaza-dGTP (Amersham) and infrared-labelled oligonucleotides
(MWG-Biotech).
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Transcriptional Regulation in the Hyperthermophilic Archaeon
Pyrococcus furiosus: Coordinated Expression of Divergently
Oriented Genes in Response to
-Linked Glucose Polymers
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-glucosidase, and a divergently orientated gene cluster,
adhA-adhB-lamA, which codes for two alcohol dehydrogenases and an extracellular
-1,3-endoglucanase that is transcribed as a
polycistronic messenger (the lamA operon). During growth of P. furiosus on either the
-1,4-linked glucose dimer
cellobiose or the
-1,3-linked glucose polymer laminarin,
the activities of both
-glucosidase and endoglucanase were increased
at least fivefold compared with levels during growth on maltose or
pyruvate. Northern blot analysis revealed an enhanced transcription of
both the celB gene and the lamA operon in the
presence of these glucose-containing substrates. The in vivo and in
vitro transcription initiation sites of both the celB gene
and the lamA operon were identified 25 nucleotides
downstream of conserved TATA box motifs. A number of repeating
sequences have been recognized in the celB-adhA intergenic region, some of which might be part of a transcriptional
regulator-binding site.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-linked glucose
disaccharide maltose (32). Recently, more detailed analyses of transcriptional activators from Haloferax spp. and
Methanobacterium thermoautotrophicum, which are involved in
synthesis of the gas vesicle and the molybdenum-containing
formylmethanofuran dehydrogenase, respectively, have been reported
(17, 23).
-linked glucose polymers.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (12K):
[in a new window]
FIG. 1.
Genetic organization of the celB locus. The
locations and orientations of the genes (open and solid arrows) are
indicated. Relevant restriction sites used for cloning and in vitro
transcription analysis are shown, as are putative transcription
termination signals
(
).
Growth and induction conditions. P. furiosus DSM3638 was cultured at 98°C in synthetic seawater as previously described (20) with pyruvate (40 mM), cellobiose (10 mM), maltose (10 mM), or laminarin (2 g/liter) as the growth substrate. Cells were grown for several generations on these substrates to allow adaptation before any analysis was performed. Growth of P. furiosus was monitored by spectrophotometrically analyzing increases in optical density (OD) and by determining hydrogen production with a Packard gas chromatograph. Under these conditions late exponential growth phase corresponds with an OD at 450 nm (OD450) of 0.8 to 0.9. For the induction with cellobiose, cells were grown on pyruvate to an OD450 of 0.7 to 0.8 and supplemented with cellobiose (10 mM). Samples were taken before and after induction and immediately cooled on ice prior to further processing.
Preparation of cell extracts and enzyme activities.
Cells
grown to late exponential growth phase were harvested by
centrifugation, washed with fresh medium, and subsequently resuspended
in citrate buffer as described previously (44). Following
sonication to disrupt the cells, the cell debris was pelleted and the
resulting supernatant was used as the cell extract for activity
measurements and immunological analysis. The
-glucosidase activity
was determined by hydrolysis of
-D-glucopyranoside-p-nitrophenyl (Boehringer
Mannheim GmbH, Mannheim, Germany) (20). Protein concentration was measured with Bradford reagents (Bio-Rad
Laboratories), with bovine serum albumin as the standard.
PAGE and Western blotting. Electrophoretic analysis of protein samples was performed by sodium dodecyl sulfate-11% polyacrylamide gel electrophoresis (SDS-PAGE) (25). Protein samples for SDS-PAGE were prepared by heating them for 5 min at 100°C in an equal volume of sample buffer (0.1 M Tris-HCl, 5% SDS, 0.9% 2-mercaptoethanol, 20% glycerol [pH 6.8]). Proteins separated by SDS-PAGE were transferred to a nitrocellulose membrane by semidry blotting (Bio-Rad Laboratories). Immunological detection was performed as previously described with antiserum raised against the AdhA and LamA proteins purified from Escherichia coli (13).
Isolation of total mRNA, Northern blot analysis, and primer
extension.
Cells were harvested by centrifugation, and RNA was
isolated with guanidinium isothyiocyanate and
-mercaptoethanol as
previously described (44). For Northern blot analysis, 15 µg of RNA was separated on a formaldehyde-1% agarose gel. Following
gel electrophoresis the RNA was transferred by capillary blotting to a
Hybond-N+ membrane (34). Gene-specific probes
were obtained after appropriate digestion of DNA from plasmid pLUW500
or pLUW501 (44), purified with GeneClean (Bio 101, La Jolla,
Calif.), and labelled by nick translation (34). During the
hybridizations Southern blots were included to verify the specificities
of the probes. Primer extension experiments on the isolated or
synthesized RNA templates were done as previously described
(16). The following oligonucleotides were used for the
indicated templates: 5'-CCA AGA ATA TCC AAA CAT GAA G-3' (for
celB) and 5'-GGC AAT CTT CTC TAA CCT ATC AAC-3' (for
adhA).
Cell-free transcription system of P. furiosus. Cell-free transcription reactions with partially purified transcription factors and highly purified RNA polymerase (Superdex fraction) were essentially carried out as previously described (16). Cell-free transcription assays of celB and adhA were performed at 70°C at an optimal potassium chloride concentration of 300 mM (rather than 250 mM for transcription of gdh [16]).
Nucleotide sequence accession number. The nucleotide sequence of the celB locus (Fig. 1) has been submitted to the GenBank and EMBL data banks and given the accession no. AF013169.
| |
RESULTS |
|---|
|
|
|---|
Genetic organization of the celB gene and the
lamA operon.
Analysis of the upstream flanking
region of the previously isolated P. furiosus
-glucosidase-encoding celB gene (44) revealed a cluster of three genes. This gene cluster, hereinafter called the
lamA operon (see below), encodes two alcohol
dehydrogenases (the short-chain AdhA and the iron-dependent AdhB), as
well as a
-1,3-endoglucanase (LamA, member of family 16 of the
glycosyl hydrolases) (Fig. 1). The functional expression of these three enzymes in E. coli and their subsequent purification and
characterization have been described elsewhere (13, 43).
Downstream of the lamA operon is the birA
gene (Fig. 1), the predicted translation product of which is homologous
to the biotin ligase of BirA from Bacillus subtilis
(46). Downstream of the birA gene, on the opposite strand, a (partial) gene has been identified (pgk')
(Fig. 1), the product of which has a high degree of similarity with 2-phosphoglycerate kinase from methanogenic archaea (4, 27) (Fig. 1).
Coregulation of CelB, AdhA, and LamA.
Cells of P. furiosus grown on cellobiose (glucose-
-1,4-glucose) as the sole
carbon and energy source were found to contain high levels of activity
of intracellular, cellobiose-hydrolyzing
-glucosidase (CelB; 12 to
18 U/mg), confirming previous results (20). In contrast, in
pyrococcal cells grown on pyruvate, 10-fold-lower CelB activity was
detected (1.5 to 2.1 U/mg). The same P. furiosus cultures were used to detect the products of the lamA
operon. Low but significant activities of the alcohol
dehydrogenase AdhA and the endoglucanase LamA could be detected in cell
extracts and in the medium of a cellobiose culture, respectively.
Because no accurate activity measurements could be performed, the
presence of AdhA and LamA was analyzed by immunological detection with specific antisera as well. Western blotting clearly indicated that the
production of AdhA and LamA was stimulated when pyrococcal cells were
grown on cellobiose or laminarin, unlike when cells were grown on
maltose (glucose-
-1,4-glucose) or pyruvate (Fig. 2). These results indicate that
P. furiosus enzymes encoded by the lamA
operon and the celB gene are coregulated in response to the
-linked sugars cellobiose and laminarin.
|
-D-thiogalactopyranoside (IPTG).
Regulation of expression of the celB gene.
The
effect of the
-linked glucose polymers on celB gene
expression was studied in more detail in an experiment in which
cellobiose was added to a P. furiosus culture growing
on pyruvate at different stages of the growth curve. Specific
-glucosidase activity was found to increase most rapidly when
cellobiose was added in the mid-exponential phase. After addition of
cellobiose, the specific
-glucosidase activity rapidly increased
within 1 h from the background level up to 9 U/mg (Fig.
3A).
|
Regulation of transcription of the lamA operon in P. furiosus. The presence of CelB, AdhA, and LamA in P. furiosus cells grown on different substrates suggested a coregulation of the celB gene and the lamA operon. To analyze whether the transcription of the lamA operon is indeed induced by cellobiose, we performed Northern blot analysis with total RNA extracted from P. furiosus cells grown on pyruvate, cellobiose, or maltose. Northern blot hybridization with a probe specific for the adhA transcript resulted in a hybridizing band with RNA extracted from cells grown on cellobiose but not with RNA from cells grown on maltose or pyruvate (Fig. 4). Subsequent washing of the filter and rehybridization with a probe specific for adhB or lamA resulted in the same hybridization pattern as with the adhA-specific probe (Fig. 4). The hybridization signals were similar for all probes (2.5 to 3.0 kb), indicating that the gene cluster adhA-adhB-lamA is transcribed as a polycistronic messenger; the calculated size of the lamA operon, from the adhA transcription start site (see below) to the lamA stop codon, is 2,803 bp (Fig. 1). Although the same RNA was used, the transcript of the lamA operon appeared less abundant and less discrete than the transcript of the celB gene, probably due to instability of the longer lamA messenger (see also below). A probe specific for the birA gene revealed a hybridizing band of approximately 0.7 kb on the Northern blot (not shown). It is concluded that transcription of the lamA operon appears to be terminated downstream of lamA, probably at the aforementioned thymidine-rich region.
|
Transcription initiation. In addition to the previously determined in vivo transcription start site of celB (44), the transcription initiation site of the adjacent lamA operon was identified by primer extension on total RNA extracted from cellobiose-grown P. furiosus. The transcription start site of the lamA transcript could be identified 10 nucleotides upstream of the adhA translation start site (ATG) (Fig. 5A). At a distance of 25 nucleotides, the transcription start site was preceded by a hexanucleotide sequence that resembles the archaeal TATA box sequence: ATTATA (Fig. 6) (3, 7, 40).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
A molecular analysis of the substrate-dependent transcriptional
regulation of four genes that constitute the celB locus in the hyperthermophilic archaeon Pyrococcus furiosus is
presented. In an in vitro experiment, we recently demonstrated that two
glycosyl hydrolases, the celB-encoded
-glucosidase and
the lamA-encoded
-1,3-endoglucanase LamA, degrade the
laminarin polysaccharide completely to glucose in a synergistic manner
(13). The physiological model is that extracellular LamA is
involved in the partial hydrolysis of laminarin to oligomers, which are
imported via an unknown transporter and subsequently degraded to
glucose by intracellular CelB.
In this study, we analyzed substrate-dependent fluctuations of CelB and
LamA activities. Pyrococcal cultures grown on pyruvate or maltose have
background levels of CelB activity, and LamA is not detectable by
Western blot analysis. In contrast, at least fivefold-higher activities
of CelB and higher amounts of LamA were detected in cultures grown on
cellobiose or laminarin than in cultures grown on maltose, pyruvate, or
peptides (Fig. 2 and 3). Induction studies showed a rapid increase of
CelB activity levels upon addition of the
-linked glucose polymer
cellobiose or laminarin to a culture grown on pyruvate (Fig. 3).
Northern blot analysis revealed that the observed control occurs at the transcriptional level. Activation of celB transcription,
within 10 min, resulted in the observed rapid induction response of
CelB activity (Fig. 3B). It is concluded that the celB gene
is transcribed as a monocistronic mRNA, probably indicating the
functionality of a typical T(C)-rich archaeal termination sequence
immediately downstream of its coding region
(CCATTTCATTTTTTCTTTGTTTTTT [44]). Likewise,
the lamA transcript could be detected only in total RNA
extracted from cells grown on cellobiose or laminarin, indicating coregulation of the divergently orientated transcripts. The effector is
probably a
-linked glucose disaccharide (cellobiose or
laminaribiose) or some unknown derivative (see below).
Analysis of the activity as well as immunological detection indicates
coregulation of AdhA and CelB or LamA (Fig. 2). Moreover, Northern blot
analysis showed that the lamA operon is transcribed as a polycistronic mRNA (Fig. 4). Unlike with LamA and CelB, however, it is less obvious to imagine a physiological link between the additional gene products, the short-chain alcohol dehydrogenase AdhA
and the iron-dependent alcohol dehydrogenase AdhB, and laminarin or
cellobiose metabolism. A putative function may be the reduction of
aldehydes to alcohol, as an electron sink during sugar fermentation; however, only traces of alcohols (ethanol) are detectable among the
fermentation products after cultivation of P. furiosus
on maltose and cellobiose (19a, 21). Alternatively, the
dehydrogenases may be involved in the oxidative or reductive conversion
of saccharides to glucose, which is most likely required for the
processing via the
-glucosidase and, subsequently, the glycolytic
enzymes. In an experiment with a range of primary and secondary
alcohols (ethanol to decanol), the purified AdhA oxidized 2-pentanol or
2-hexanol with the highest activity (40 U/mg) (42); sugars
such as cellobiose were oxidized but at lower rates (2 to 3 U/mg)
(44a). Hence, these preliminary analyses do not rule out the
possibility that oxidized or reduced polyols (saccharides) are the
physiological substrates for AdhA. However, the physiological
implications of the two dehydrogenases being coexpressed with the
glycosyl hydrolases will probably remain unclear until the actual
physiological substrate(s) for the LamA-CelB system is elucidated.
In vitro initiation of transcription of the celB gene and the lamA operon occurred at the same sites as those identified in vivo (Fig. 5A and B) (44). The efficiencies of transcription initiation of the celB and lamA transcripts in the cell-free system were significantly lower than that of the P. furiosus gdh gene (Fig. 5C) (16). This suggests suboptimal conditions of the in vitro experiment which may have been caused by, for example, the secondary structure of the intergenic promoter region, which contains a number of repeats (see below and Fig. 6). One possibility is that these lower efficiencies of transcription initiation reflect the in vivo situation, implying the requirement of a transcription activator to counteract the putative obstruction; alternatively, it cannot be ruled out that the impeded efficiency is due to an artifact of the described in vitro transcription experiment with these particular DNA fragments.
Both of the promoters of the celB gene and the
lamA operon contain a TATA box sequence
(ATTATA) that closely resembles the P. furiosus consensus [(T/A)TTATA] (41), and both TATA
boxes are located 25 nucleotides upstream of the promoters'
transcription initiation sites (Fig. 6). These promoter elements,
equivalent to the eucaryal TATA box, have been shown to interact with
the TBP and are involved in directing transcription (15,
33). Based on DNase I footprinting experiments with the
P. furiosus gdh promoter, it has recently been
demonstrated that TBP results in a footprint between positions
20 and
34, centered around the TATA box. In addition, TFB bound
cooperatively to TBP generates an extended footprinting pattern ranging
from positions
19 to
42 (15). The sequences surrounding
the TATA box of both the celB gene and the lamA
operon showed a relatively high degree of conservation (Fig.
6), possibly indicating a role in modulating transcription efficiency.
The AT-rich celB-adhA intergenic region was further analyzed for potential cis-acting elements. Interestingly, we found a palindromic sequence (GTTTAAAC) located exactly in between the two TATA elements. Moreover, four inverted repeats of at least 5 residues were detected (Fig. 6). Inverted repeat 4 (TTGAGXXXXCTCAA) has a striking similarity (indicated in bold) to the consensus binding site for the FNR (fumarate nitrate regulation) family of bacterial transcription regulators (TTGATXXXXATCAA) (37). The location of this putative binding site (54 bp from the adhA and 86 bp from the celB transcription initiation sites) is in agreement with that found for transcription regulators in bacterial systems (12). As with the E. coli lac operon, potential inducers of the anticipated transcription regulator might be either a substrate (or a derivative of the substrate), namely, cellobiose, laminaribiose, or a reporter molecule such as cAMP. In the last case, the regulator might resemble CRP (cAMP receptor protein), a regulator that is structurally related to FNR (consensus binding site, GTTGAXXXXXXTCAAC [37]). However, no archaeal FNR or CRP homologs have yet been reported. Hence, the significance of the identified repeats with respect to transcriptional regulation remains to be established.
The fast-growing sequence databases contain a large number of genes that code for archaeal homologs of bacterial transcription regulators (4, 10, 22, 24, 35, 36). In addition, a number of palindromic binding sites of transcriptional repressors have been reported to be functional in halophilic and methanogenic archaea, although the corresponding repressors have not yet been identified (19, 38). To the best of our knowledge, the actions of only three archaeal transcription regulators have recently been characterized in considerable detail: (i) the transcription activation of gas vesicle synthesis in Haloferax spp. by a eucaryal-like leucine-zipper-type regulator (23), (ii) the molybdenum-activated expression of formylmethanofuran dehydrogenase in M. thermoautotrophicum (17), and (iii) the negative autoregulation by a homolog of the bacterial leucine-responsive regulatory protein (Lrp) in P. furiosus (2a). Future studies will aim at elucidating the molecular details of the transcriptional regulation described herein, specifically, the actual nucleotide sequence of the regulator's binding site and the identification of this transcriptional regulator.
| |
ACKNOWLEDGMENTS |
|---|
Part of this work was supported by contracts BIOT-CT93-0274 and BIOT-CT96-0488 of the European Union.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Laboratory of Microbiology, Wageningen Agricultural University, Hesselink van Suchtelenweg 4, 6703 CT Wageningen, The Netherlands. Phone: 31 317 483100. Fax: 31 317 483829. E-mail: john.vanderoost{at}algemeen.micr.wau.nl.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Baumann, P., S. A. Qureshi, and S. P. Jackson. 1995. Transcription: new insights from studies on Archaea. Trends Genet. 11:279-283[Medline]. |
| 2. | Bell, S. D., and S. P. Jackson. 1998. Transcription and translation in Archaea: a mosaic of eukaryal and bacterial features. Trends Microbiol. 6:222-228[Medline]. |
| 2a. | Brinkman, A. B., I. Dahlke, J. E. Tuininga, T. Lammers, V. Dumay, E. de Heus, J. H. G. Lebbink, M. Thomm, W. M. de Vos, and J. van der Oost. Submitted for publication. |
| 3. | Brown, J. W., C. J. Daniels, and J. N. Reeve. 1989. Gene structure, organization, and expression in archaebacteria. Crit. Rev. Microbiol. 16:287-338[Medline]. |
| 4. | Bult, C. J., O. White, G. J. Olsen, L. X. Zhou, R. D. Fleischmann, G. G. Sutton, J. A. Blake, L. M. FitzGerald, R. A. Clayton, J. D. Gocayne, A. R. Kerlavage, B. A. Dougherty, J. F. Tomb, M. D. Adams, C. I. Reich, R. Overbeek, E. F. Kirkness, K. G. Weinstock, J. M. Merrick, A. Glodek, J. L. Scott, N. S. M. Geoghagen, J. F. Weidman, J. L. Fuhrmann, D. Nguyen, T. R. Utterback, J. M. Kelley, J. D. Peterson, P. W. Sadow, M. C. Hanna, M. D. Cotton, K. M. Roberts, M. A. Hurst, B. P. Kaine, M. Borodovsky, H. P. Klenk, C. M. Fraser, H. O. Smith, C. R. Woese, and J. C. Venter. 1996. Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii. Science 273:1058-1073[Abstract]. |
| 5. |
Cohen-Kupiec, R.,
C. Blank, and J. A. Leigh.
1997.
Transcriptional regulation in Archaea: in vivo demonstration of a repressor binding site in a methanogen.
Proc. Natl. Acad. Sci. USA
94:1316-1320 |
| 6. |
Cohen-Kupiec, R.,
C. J. Marx, and J. A. Leigh.
1999.
Function and regulation of glnA in the methanogenic archaeon Methanococcus maripaludis.
J. Bacteriol.
181:256-261 |
| 7. | Dalgaard, J. Z., and R. A. Garrett. 1993. Archaeal hyperthermophile genes, p. 535-563. In M. Kates, D. J. Kusher, and A. T. Matheson (ed.), The biochemistry of Archaea (Archaebacteria). Elsevier, Amsterdam, The Netherlands. |
| 8. | Eggen, R. I. L., A. C. M. Geerling, K. Waldkoetter, G. Antranikian, and W. M. De Vos. 1993. The glutamate dehydrogenase-encoding gene of the hyperthermophilic archaeon Pyrococcus furiosus: Sequence, transcription and analysis of the deduced amino acid sequence. Gene 132:143-148[Medline]. |
| 9. | Fiala, G., and K. O. Stetter. 1986. Pyrococcus furiosus sp. nov. represents a novel genus of marine heterotrophic archaebacteria growing optimally at 100°C. Arch. Microbiol. 161:168-175. |
| 10. | Fitz-Gibbon, S., A. J. Choi, J. H. Miller, K. O. Stetter, M. I. Simon, R. Swanson, and U. J. Kim. 1997. A fosmid-based genomic map and identification of 474 genes of the hyperthermophilic archaeon Pyrobaculum aerophilum. Extremophiles 1:36-51. [Medline] |
| 11. |
Frey, G.,
M. Thomm,
B. Brudigam,
H. P. Gohl, and W. Hausner.
1990.
An archaebacterial cell-free transcription system. The expression of tRNA genes from Methanococcus vannielii is mediated by transcription factor.
Nucleic Acids Res.
18:1361-1367 |
| 12. | Gralla, J. D., and J. Collado-Vides. 1996. Organization and function of transcription regulatory elements, p. 1232-1262. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C. |
| 13. |
Gueguen, Y.,
W. G. B. Voorhorst,
J. van der Oost, and W. M. de Vos.
1997.
Molecular and biochemical characterization of an endo-beta-1,3-glucanase of the hyperthermophilic archaeon Pyrococcus furiosus.
J. Biol. Chem.
272:31258-31264 |
| 14. | Hausner, W., G. Frey, and M. Thomm. 1991. Control regions of an archaeal gene: a TATA box and an initiator element promote cell-free transcription of the tRNA-Val gene of Methanococcus vannielii. J. Mol. Biol. 222:495-508[Medline]. |
| 15. |
Hausner, W.,
J. Wettach,
C. Hethke, and M. Thomm.
1996.
Two transcription factors related with the eucaryal transcription factors TATA-binding protein and transcription factor IIB direct promoter recognition by an archaeal RNA polymerase.
J. Biol. Chem.
271:30144-30148 |
| 16. |
Hethke, C.,
A. C. M. Geerling,
W. Hausner,
W. M. de Vos, and M. Thomm.
1996.
A cell-free transcription system for the hyperthermophilic archaeon Pyrococcus furiosus.
Nucleic Acids Res.
24:2369-2376 |
| 17. | Hochheimer, A., R. Hedderich, and R. K. Thauer. 1999. The DNA binding protein Tfx from Methanobacterium thermoautotrophicum: structure, DNA binding properties and transcriptional regulation. Mol. Microbiol. 31:641-650[Medline]. |
| 18. |
Hüdepohl, U.,
W. D. Reiter, and W. Zillig.
1990.
In vitro transcription of two rRNA genes of the archaebacterium Sulfolobus sp. B 12 indicates a factor requirement for specific initiation.
Proc. Natl. Acad. Sci. USA
87:5851-5855 |
| 19. |
Ken, R., and N. R. Hackett.
1991.
Halobacterium halobium strains lysogenic from phage H contain a protein resembling coliphage repressors.
J. Bacteriol.
173:955-960 |
| 19a. | Kengen, S. W. Personal communication. |
| 20. | Kengen, S. W., E. J. Luesink, A. J. Stams, and A. J. Zehnder. 1993. Purification and characterization of an extremely thermostable beta-glucosidase from the hyperthermophilic archaeon Pyrococcus furiosus. Eur. J. Biochem. 213:305-312[Medline]. |
| 21. | Kengen, S. W. M., and A. J. M. Stams. 1994. Formation of L-alanine as a reduced end product in carbohydrate fermentation by the hyperthermophilic archaeon Pyrococcus furiosus. Arch. Microbiol. 161:168-175. |
| 22. | Klenk, H. P., R. A. Clayton, J. F. Tomb, O. White, K. E. Nelson, K. A. Ketchum, R. J. Dodson, M. Gwinn, E. K. Hickey, J. D. Peterson, D. L. Richardson, A. R. Kerlavage, D. E. Graham, N. C. Kyrpides, R. D. Fleischmann, J. Quackenbush, N. H. Lee, G. G. Sutton, S. Gill, E. F. Kirkness, B. A. Dougherty, K. McKenney, M. D. Adams, B. Loftus, S. Peterson, C. I. Reich, L. K. McNeil, J. H. Badger, A. Glodek, L. X. Zhou, R. Overbeek, J. D. Gocayne, J. F. Weidman, L. McDonald, T. Utterback, M. D. Cotton, T. Spriggs, P. Artiach, B. P. Kaine, S. M. Sykes, P. W. Sadow, K. P. d'Andrea, C. Bowman, C. Fujii, S. A. Garland, T. M. Mason, G. J. Olsen, C. M. Fraser, H. O. Smith, C. R. Woese, and J. C. Venter. 1997. The complete genome sequence of the hyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus. Nature 390:364-370[Medline]. |
| 23. | Krüger, K., T. Hermann, V. Armbruster, and F. Pfeifer. 1998. The transcriptional activator GvpE for the halobacterial gas vesicle genes resembles a basic region leucine-zipper regulatory protein. J. Mol. Biol. 279:761-771[Medline]. |
| 24. | Kyrpides, N. C., and C. A. Ouzounis. 1995. The eubacterial transcriptional activator Lrp is present in the archaeon Pyrococcus furiosus. Trends Biochem. Sci. 20:140-141[Medline]. |
| 25. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline]. |
| 26. |
Langer, D.,
J. Hain,
P. Thuriaux, and W. Zillig.
1995.
Transcription in Archaea: similarity to that in Eucarya.
Proc. Natl. Acad. Sci. USA
92:5768-5772 |
| 27. | Lehmacher, A., and R. Hensel. 1994. Cloning, sequencing and expression of the gene encoding 2-phosphoglycerate kinase from Methanothermus fervidus. Mol. Gen. Genet. 242:163-168[Medline]. |
| 28. |
Morgan, R. M.,
T. D. Pihl,
J. Nölling, and J. N. Reeve.
1997.
Hydrogen regulation of growth, growth yields, and methane gene transcription in Methanobacterium thermoautotrophicum H.
J. Bacteriol.
179:889-898 |
| 29. |
Nolling, J., and J. N. Reeve.
1997.
Growth- and substrate-dependent transcription of the formate dehydrogenase (fdhCAB) operon in Methanobacterium thermoformicicum Z-245.
J. Bacteriol.
179:899-908 |
| 30. |
Palmer, J. R., and C. J. Daniels.
1995.
In vivo definition of an archaeal promoter.
J. Bacteriol.
177:1844-1849 |
| 31. |
Reiter, W. D.,
U. Hüdepohl, and W. Zillig.
1990.
Mutational analysis of an archaebacterial promoter: essential role of a TATA box transcription efficiency and start-site selection.
Proc. Natl. Acad. Sci. USA
87:9509-9513 |
| 32. | Robinson, K. A., and H. J. Schreier. 1994. Isolation, sequence and characterization of the maltose-regulated mlrA gene from the hyperthermophilic archaeum Pyrococcus furiosus. Gene 151:173-176[Medline]. |
| 33. |
Rowlands, T.,
P. Baumann, and S. P. Jackson.
1994.
The TATA-binding protein: a general transcription factor in eukaryotes and archaebacteria.
Science
264:1326-1329 |
| 34. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 35. | Sensen, C. W., H. P. Klenk, R. K. Singh, G. Allard, C. C. Chan, Q. Y. Liu, S. L. Penny, F. Young, M. E. Schenk, T. Gaasterland, W. F. Doolittle, M. A. Ragan, and R. L. Charlebois. 1996. Organizational characteristics and information content of an archaeal genome: 156 kb of sequence from Sulfolobus solfataricus P2. Mol. Microbiol. 22:175-191[Medline]. |
| 36. |
Smith, D. R.,
L. A. Doucette-Stamm,
C. Deloughery,
H. Lee,
J. Dubois,
T. Aldredge,
R. Bashirzadeh,
D. Blakely,
R. Cook,
K. Gilbert,
D. Harrison,
L. Hoang,
P. Keagle,
W. Lumm,
B. Pothier,
D. Qiu,
R. Spadafora,
R. Vicaire,
Y. Wang,
J. Wierzbowski,
R. Gibson,
N. Jiwani,
A. Caruso,
D. Bush,
H. Safer,
D. Patwell,
S. Prabhakar,
S. McDougall,
G. Shimer,
A. Goyal,
S. Pietrokovski,
G. M. Church,
C. J. Daniels,
J. Mao,
P. Rice,
J. Nölling, and J. N. Reeve.
1997.
Complete genome sequence of Methanobacterium thermoautotrophicum H: functional analysis and comparative genomics.
J. Bacteriol.
179:7135-7155 |
| 37. | Spiro, S., and J. R. Guest. 1990. Adaptive responses to oxygen-limitation in Escherichia coli. Trends Biochem. 16:310-314[Medline]. |
| 38. |
Stolt, P., and W. Zillig.
1992.
In vivo studies on the effects of immunity genes on early lytic transcription in the Halobacterium salinarium phage H.
Mol. Gen. Genet.
235:197-204[Medline].
|
| 39. | Thomm, M. 1996. Archaeal transcription factors and their role in transcription initiation. FEMS Microbiol. Rev. 18:159-171[Medline]. |
| 40. | Thomm, M., W. Hausner, and C. Hethke. 1994. Transcription factors and termination of transcription in Methanococcus. Syst. Appl. Microbiol. 16:648-655. |
| 41. | van der Oost, J., M. Ciaramella, M. Moracci, F. M. Pisani, M. Rossi, and W. M. de Vos. 1998. Molecular biology of hyperthermophilic Archaea. Adv. Biochem. Eng. Biotechnol. 61:87-115[Medline]. |
| 42. |
van der Oost, J.,
G. Schut,
S. W. M. Kengen,
W. R. Hagen,
M. Thomm, and W. M. de Vos.
1998.
The ferredoxin-dependent conversion of glyceraldehyde-3-phosphate in the hyperthermophilic archaeon Pyrococcus furiosus represents a novel site of glycolytic regulation.
J. Biol. Chem.
273:28149-28154 |
| 43. | Voorhorst, W. G. B. 1998. Molecular characterization of hydrolytic enzymes from hyperthermophilic Archaea. Ph.D. thesis. Wageningen Agricultural University, Wageningen, The Netherlands. |
| 44. |
Voorhorst, W. G. B.,
R. I. L. Eggen,
E. J. Luesink, and W. M. de Vos.
1995.
Characterization of the celB gene coding for beta-glucosidase from the hyperthermophilic archaeon Pyrococcus furiosus and its expression and site-directed mutation in Escherichia coli.
J. Bacteriol.
177:7105-7111 |
| 44a. | Voorhorst, W. G. B., and J. van der Oost. Unpublished data. |
| 45. |
Wettach, J.,
H. P. Gohl,
H. Tschochner, and M. Thomm.
1995.
Functional interaction of yeast and human TATA-binding proteins with an archaeal RNA polymerase and promoter.
Proc. Natl. Acad. Sci. USA
92:472-476 |
| 46. |
Wilson, K. P.,
L. M. Shewchuk,
R. G. Brennan,
A. J. Otsuka, and B. W. Matthews.
1992.
Escherichia coli biotin holoenzyme synthetase/bio repressor crystal structure delineates the biotin- and DNA-binding domains.
Proc. Natl. Acad. Sci. USA
89:9257-9261 |
| 47. | Zillig, W., P. Palm, H. P. Klenk, D. Langer, U. Hüdepohl, J. Hain, M. Lanzendorfer, and I. Holz. 1993. Transcription in Archaea, p. 367-391. In M. Kates, D. J. Kushner, and A. T. Matheson (ed.), The biochemistry of Archaea (Archaebacteria). Elsevier, Amsterdam, The Netherlands. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»