Previous Article | Next Article 
Journal of Bacteriology, June 1999, p. 3830-3832, Vol. 181, No. 12
Centre de Bioingenierie Gilbert Durand,
UMR-CNRS 5504, LA INRA, Institut National des Sciences
Appliquées, 31077 Toulouse, France,1
and Institut für Mikrobiologie,
Heinrich-Heine-Universität, D-40225 Düsseldorf,
Germany2
Received 23 November 1998/Accepted 13 April 1999
The trehalose content in Saccharomyces cerevisiae can
be significantly manipulated by including trehalose at an appropriate level in the growth medium. Its uptake is largely dependent on the
expression of AGT1, which encodes an Most work on trehalose metabolism in
yeast concerns factors governing its endogenous level (6, 14,
15). Trehalose synthase is a multimeric protein composed of four
subunits encoded by TPS1, TPS2, TSL1,
and TPS3 (2, 18), of which only Tps1p catalyzing the formation of trehalose-6-phosphate from UDP-Glc and
glucose-6-phosphate is essential for growth on rapidly fermentable
carbon sources like glucose and fructose (8, 22). The
molecular mechanism underlying this defect is not yet understood
(21). The deletion of TPS1 in principle results
in the loss of trehalose accumulation. However, the existence of
another functional pathway for trehalose synthesis in yeast has been
postulated, based on data showing that trehalose accumulation is
somehow related to maltose metabolism or constitutive maltose gene
expression (5, 15) and on one report of a putative
ADP-Glc-dependent trehalose synthase activity (17). However,
most demonstrations in wild-type and tps1 mutant strains
have employed an enriched medium such as yeast extract-peptone (YEP),
and our analysis of yeast extract from various commercial sources
(Difco and BIOKAR Diagnostic) by using ionic exchange chromatography
with pulsed amperometric detection (4) shows it to contain
ca. 1.5% trehalose by weight, which would result in a yield of 150 µg of free trehalose per ml of YEP medium. Since Saccharomyces
cerevisiae is known to show both a high- and a low-affinity trehalose uptake (13, 19, 20), we speculated that the
trehalose accumulation of tps1 mutant cells might be related
to uptake from the medium, perhaps involving AGT1, a
maltose-controlled gene encoding a transporter with broad specificity
for Yeast mutant strains used in this work were derived from the
prototrophic CEN.PK113-7D strain (the kind gift of K.-D. Entian and P. Kötter, Frankfurt, Germany), which possesses a
MAL2-8c dominant mutation. Culturing was carried
out at 30°C in YEP medium (10 g of yeast extract and 10 g of
Bacto Peptone per liter) or in mineral medium (MIN) prepared according
to the method described in reference 23 and buffered
at pH 5.8 by the addition of 10 g of succinic acid and 6 g of
NaOH per liter. The carbon source was added to the media at a final
concentration of 10 g · liter Amplifications were carried out with Expand high-fidelity polymerase
(Boehringer, Mannheim, Germany) according to standard procedures, and
the amplified fragments (5 µg) were used for gene disruption as
described in reference 9. For the deletion of ATH1, a 4.4-kb fragment bearing the full gene was amplified
by using a pair of primers (ATH1-250
[5'-CGTATCACGACAAACCAACAGCC-3] and ATH1-500
[5'-CAAACCCTACTGACGAGAGAAG]) and genomic DNA from CEN.PK113-7D as a template. The PCR fragment cloned into the pGEM-T vector (Promega) was digested with EcoRV-HpaI,
which was replaced by a 1.5-kb EcoRV-SmaI
kanMX4 fragment from pFAkanMX4 (24). This
construct was cut with ScaII and SpeI, and the
3.45-kb fragment was gel purified and used for transformation
(7). For the deletion of NTH1, a 1.2-kb
StuI-SnaBI of plasmid pTZ18RNTH1 (12)
was replaced by a 1.4-kb EcoRV-SmaI
kanMX module from pFAKanMX4 to yield p In agreement with the idea that the trehalose content can be
manipulated by including trehalose in the growth medium, Fig. 1A shows that although there was a barely
detectable level of trehalose in a wild-type strain (with a
MALc mutation) cultivated on galactose-MIN, this
level was significantly increased when the medium also contained
0.15 g of trehalose · liter
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
AGT1, Encoding an
-Glucoside Transporter Involved
in Uptake and Intracellular Accumulation of Trehalose in
Saccharomyces cerevisiae
ABSTRACT
Top
Abstract
Text
References
-glucoside
transporter. The trehalose found in a tps1 mutant of
trehalose synthase may therefore largely reflect its uptake from the
enriched medium that was employed.
TEXT
Top
Abstract
Text
References
-glucosides, including trehalose (10).
1, and auxotrophic
requirements, when required, were added at 100 mg · liter1. The deletion of TPS1 and
AGT1 was performed according to the PCR and short homolog
fragment procedure of Wach et al. (24) by using the pUG6
plasmid bearing the loxP-kanMX4-loxP module (9)
for TPS1 and pUG6lacZ bearing lacZ-kanMX4
(3) for AGT1. The oligonucleotides used to
construct the deletion cassette were as follows: d-TPS1
(5'-ATGACTACGGATAA CGCTAAGGCGCAACTGACCTCGTCTTCAGCTGAAGC TTCGTACGC-3'), containing the sequence from nucleotide +1 (A of the start codon) to
+40 of the TPS1 open reading frame (ORF), and f-TPS1
(5'-TCAGTTTTTGGTGGCAGA GGAGCTTGTTGAGCTGATGATGCATAGGCCACTAG TGGATCTG-3'),
containing the complementary sequence from nucleotide +1445
to +1488 of the TPS1 ORF, and S1-LAGT1
(5'-ATGAAAAATATCATTTCATTGGTAAGCAA GAAGAAGGCTGCCTCAAAATTCGTACGCTGCAGGT CGAC-3'), containing the sequence from nucleotide +1 (A of the start codon) to +48 of the AGT1 ORF, and
S2-AGT1 (5'-TAATTCTCGCTGTTTTATGCTTGAGGACTGACT GATACTCTCATCAGCGCATAGGCCACTAGTGGATC TG-3'),
containing the complementary sequence from nucleotide +1783 to +1830 of
the AGT1 ORF.
ATH1. This plasmid
was cut with PvuII-AlfII, and the 3.6-kb fragment
was used for transformation. Gene disruption was verified either by PCR
(24) or by Southern blotting. The agt1
tps1 and nth1 ath1 double
mutants were obtained by the crossing of haploid mutant strains. The
correct agt1 tps1 mutant was characterized by its inability to grow on YEP-dextrose and its ability to turn dark
blue on maltose due to the expression of AGT1-lacZ. The
correct nth1 ath1 mutant was obtained from
a typical tetrad as the only one lacking both acid and neutral
trehalase activity. The level of intracellular trehalose was determined
by the procedure described previously (16).
1 (Fig. 1B), but
this accumulation was prevented by the deletion of AGT1
(Fig. 1C). Table 1 shows that the maximal
content of trehalose during the growth of a wild-type strain on
YEP-galactose was about 10% of the dry mass and that this level
dropped to 3.2% in the tps1 isogenic strain. By contrast,
in galactose-MIN, the content of the disaccharide in the wild-type
strain reached ca. 1% and was not detectable in the tps1
mutant. Both strains, however, were able to accumulate about 2%
trehalose when the medium was initially supplemented with 0.15 g
of trehalose · liter1.
View larger version (24K):
[in a new window]
FIG. 1.
Patterns of extracellular and intracellular trehalose
levels during growth of wild-type CEN.PK113-7D (A and B) and RWY13
( agt1 [C]) on galactose-MIN without (A) or with
0.15 g of trehalose · liter1 (B and C). Shown
are the optical densities at 660 nm (
), the level of glucose
in the medium (
), the level of extracellular trehalose (
),
and the level of intracellular trehalose (
).
TABLE 1.
Levels of trehalose in wild-type and isogenic mutant
strains with AGT1, TPS1, NTH1, or
ATH1 deleted during growth on different media
The use of varying exogenous trehalose concentrations shows that with 1 g · liter1 (ca. 3 mM), a 9% intracellular
concentration of trehalose can be attained even in galactose-MIN.
For a cell sap of 2.4 ml per g of cell dry mass (1, 11),
this content corresponds to 110 mM, suggesting an active uptake of
trehalose. The accumulation of trehalose was largely abolished by the
deletion of AGT1, with a residual internal trehalose
concentration probably contributed by trehalose synthase activity, as
indicated by its loss in the agt1 tps1 double mutant.
However, at a much higher exogenous trehalose concentration (10 g
· liter1 or 30 mM), its endogenous level was on the
order of 1% in both the single (agt1) and the double
(agt1 tps1) mutants. This latter result is in agreement with
previous work showing the existence of a nonconcentrative low-level
Km uptake system for trehalose (13,
19). Since acid and neutral trehalases counteract the endogenous formation of trehalose (14), their
influence on intracellular trehalose content was investigated by
deleting the corresponding NTH1 and ATH1 genes.
It is shown in Table 1 that the content of trehalose determined at the
end of growth on glucose-MIN increased from 0.39% in a wild-type
strain to 2% in cells lacking both trehalases. However, their absence
had much less influence on the level of intracellular trehalose as its
external concentration was increased, suggesting that yeast cells have
a limiting capacity to store a maximum of 12 to 13% trehalose. Taken
together, these results conclusively demonstrate that the accumulation
of trehalose in yeast is mediated by at least two pathways: the first
is via the endogenous UDP-Glc-linked trehalose synthase complex and the
second is the uptake of exogenous trehalose via the
high-affinity -glucoside transporter encoded by AGT1.
| |
ACKNOWLEDGMENTS |
|---|
Nathalie Dallies is acknowledged for her help in performing trehalose level determinations by high-performance liquid chromatography. We also thank the anonymous reviewer for his help in improving this paper.
This work was supported in part by the Commission of the European Union (Programme Cell Factories grant BIO.CT95.132 to J.F.). L.P. holds a fellowship from the Ministère de la Recherche et de l'Enseignement Supérieur (MENESR).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Département Génie Biochimique et Alimentaire, Institut National des Sciences Appliquées, Complexe Scientifique de Rangeuil, 31077 Toulouse Cedex 04, France. Phone: 33 5 61 55 94 92. Fax: 33 5 61 55 94 00. E-mail: fran_jm{at}insa-tlse.fr.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. |
Alexandre, H.,
L. Plourde,
C. Charpentier, and J. François.
1998.
Lack of correlation between trehalose accumulation, cell viability and intracellular acidification as induced by various stresses in Saccharomyces cerevisiae.
Microbiology
144:1103-1111 |
| 2. | Bell, W., W. Sun, S. Hohmann, S. Wera, A. Reinders, C. De Virgilio, A. Wiemken, and J. M. Thevelein. 1998. Composition and functional analysis of the Saccharomyces cerevisiae trehalose synthase complex. J. Biol. Chem. 273:3311-3319. |
| 3. |
Boles, E.,
P. de Jong-Gubbels, and J. T. Pronk.
1998.
Identification and characterization of MAE1, the Saccharomyces cerevisiae structural gene encoding mitochondrial malic enzyme.
J. Bacteriol.
180:2875-2882 |
| 4. | Dallies, N., J. François, and V. Paquet. 1997. A new method for quantitative determination of polysaccharides in the yeast cell wall. Application to the cell wall defective mutants of Saccharomyces cerevisiae. Yeast 14:1297-1306. |
| 5. | Ferreira, J. C., J. M. Thevelein, S. Hohmann, V. M. F. Paschoalin, L. C. Tugo, and A. D. Panek. 1997. Trehalose accumulation in mutants of Saccharomyces cerevisiae deleted in the UDP-dependent trehalose synthase-phosphatase complex. Biochim. Biophys. Acta 1335:40-50[Medline]. |
| 6. | François, J., M. A. Blazquez, J. Arino, and C. Gancedo. 1997. Storage carbohydrates in the yeast Saccharomyces cerevisiae, p. 285-311. In F. K. Zimmermann, and K.-D. Entian (ed.), Yeast sugar metabolism. Technomics Publishing Co., Inc., Lancaster, Pa. |
| 7. | Gietz, R. D., R. H. Schiestl, A. R. Willems, and R. A. Woods. 1995. Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11:355-360[Medline]. |
| 8. | Gonzales, M. I., R. Stucka, M. A. Blazquez, H. Feldmann, and C. Gancedo. 1992. Molecular cloning of CIF1, a yeast gene necessary for growth on glucose. Yeast 8:183-192[Medline]. |
| 9. |
Güldener, U.,
S. Heck,
T. Fiedler,
J. Beinhauer, and J. H. Hegemann.
1996.
A new efficient gene disruption cassette for repeated use in budding yeast.
Nucleic Acids Res.
13:2519-2524 |
| 10. |
Han, E.-Y.,
F. Cotty,
C. Sottas,
H. Jiang, and C. A. Michels.
1995.
Characterization of AGT1 encoding a general -glucoside transporter from Saccharomyces cerevisiae.
Mol. Microbiol.
17:1093-1107[Medline].
|
| 11. | Hottiger, T., C. De Virgilio, M. N. Hall, T. Boller, and A. Wiemken. 1994. The role of trehalose synthesis for the acquisition of thermotolerance in yeast. II. Physiological concentrations of trehalose increase the thermal stability of proteins in vivo. Eur. J. Biochem. 219:187-193[Medline]. |
| 12. |
Kopp, M.,
H. Müller, and H. Holzer.
1993.
Molecular analysis of the neutral trehalase gene from Saccharomyces cerevisiae.
J. Biol. Chem.
268:4766-4774 |
| 13. |
Kotyk, A., and D. Michaljanivova.
1979.
Uptake of trehalose by Saccharomyces cerevisiae.
J. Gen. Microbiol.
110:323-332 |
| 14. | Nwaka, S., and H. Holzer. 1998. Molecular biology of trehalose and the trehalases in the yeast Saccharomyces cerevisiae. Prog. Nucleic Acid Res. Mol. Biol. 58:197-237[Medline]. |
| 15. | Panek, A. D., and A. C. Panek. 1990. Metabolism and thermotolerance function of trehalose in Saccharomyces cerevisiae: a current perspective. J. Biotechnol. 14:229-238. |
| 16. | Parrou, J. L., and J. François. 1997. A simplified procedure for a rapid and reliable assay of both glycogen and trehalose in whole yeast cells. Anal. Biochem. 248:186-188[Medline]. |
| 17. | Paschoalin, V. M. F., J. T. Silva, and A. D. Panek. 1989. Identification of an ADPG-dependent trehalose synthase in Saccharomyces cerevisiae. Curr. Genet. 16:81-87[Medline]. |
| 18. | Reinders, A., N. Bürckert, S. Hohmann, J. M. Thevelein, T. Boller, A. Wiemken, and C. DeVirgilio. 1997. Structural analysis of the subunits of the trehalose-6-phosphate synthase/phosphatase complex in Saccharomyces cerevisiae and their function during heat shock. Mol. Microbiol. 24:687-695[Medline]. |
| 19. | Stambuk, B. U., P. S. de Araujo, A. D. Panek, and R. Serrano. 1996. Kinetics and energetics of trehalose transport in Saccharomyces cerevisiae. Eur. J. Biochem. 237:876-881[Medline]. |
| 20. | Stambuk, B. U., A. D. Panek, J. H. Crowe, L. M. Crowe, and P. S. de Araujo. 1998. Expression of high-affinity trehalose-H+ symport in Saccharomyces cerevisiae. Biochim. Biophys. Acta 1374:118-128. |
| 21. | Thevelein, J. M., and S. Hohmann. 1995. Trehalose synthase: guard to the gate of glycolysis in yeast? Trends Biochem. Sci. 20:3-10[Medline]. |
| 22. | Van Aelst, L., S. Hohmann, B. Bulaya, W. de Koning, L. Sierkstra, et al. 1993. Molecular cloning of a gene involved in glucose sensing in the yeast Saccharomyces cerevisiae. Mol. Microbiol. 8:927-943[Medline]. |
| 23. | Verduyn, C., E. Postma, A. Scheffers, and J. P. Van Dijken. 1991. Effect of benzoic acid on metabolic fluxes in yeasts: a continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast 8:501-516. |
| 24. | Wach, A., A. Brachat, R. Pöhlmann, and P. Philippsen. 1994. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10:1793-1808[Medline]. |
Journal of Bacteriology, June 1999, p. 3830-3832, Vol. 181, No. 12
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Garre, E., Matallana, E.
(2009). The three trehalases Nth1p, Nth2p and Ath1p participate in the mobilization of intracellular trehalose required for recovery from saline stress in Saccharomyces cerevisiae. Microbiology
155: 3092-3099
[Abstract] [Full Text] -
Pacheco, A., Pereira, C., Almeida, M. J., Sousa, M. J.
(2009). Small heat-shock protein Hsp12 contributes to yeast tolerance to freezing stress. Microbiology
155: 2021-2028
[Abstract] [Full Text] -
Jules, M., Beltran, G., Francois, J., Parrou, J. L.
(2008). New Insights into Trehalose Metabolism by Saccharomyces cerevisiae: NTH2 Encodes a Functional Cytosolic Trehalase, and Deletion of TPS1 Reveals Ath1p-Dependent Trehalose Mobilization. Appl. Environ. Microbiol.
74: 605-614
[Abstract] [Full Text] -
Jules, M., Guillou, V., Francois, J., Parrou, J.-L.
(2004). Two Distinct Pathways for Trehalose Assimilation in the Yeast Saccharomyces cerevisiae. Appl. Environ. Microbiol.
70: 2771-2778
[Abstract] [Full Text] -
Hohmann, S.
(2002). Osmotic Stress Signaling and Osmoadaptation in Yeasts. Microbiol. Mol. Biol. Rev.
66: 300-372
[Abstract] [Full Text] -
Miura, S., Zou, W., Ueda, M., Tanaka, A.
(2000). Screening of Genes Involved in Isooctane Tolerance in Saccharomyces cerevisiae by Using mRNA Differential Display. Appl. Environ. Microbiol.
66: 4883-4889
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»