Previous Article | Next Article 
Journal of Bacteriology, June 1999, p. 3852-3856, Vol. 181, No. 12
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Mutational Analysis of the Streptococcus
pneumoniae Bimodular Class A Penicillin-Binding
Proteins
Johanna
Paik,1
Iza
Kern,1,
Rudi
Lurz,1 and
Regine
Hakenbeck2,*
Department of Microbiology, University of
Kaiserslautern, D-67663 Kaiserslautern,2 and
Max-Planck Institut für Molekulare Genetik, D-14185
Berlin,1 Germany
Received 15 January 1999/Accepted 17 March 1999
 |
ABSTRACT |
One group of penicillin target enzymes, the class A
high-molecular-weight penicillin-binding proteins
(PBPs), are bimodular enzymes. In addition to a central
penicillin-binding-transpeptidase domain, they contain an
N-terminal putative glycosyltransferase domain. Mutations in the
genes for each of the three Streptococcus pneumoniae class A PBPs, PBP1a, PBP1b, and PBP2a, were
isolated by insertion duplication mutagenesis within the
glycosyltransferase domain, documenting that their function is not
essential for cellular growth in the laboratory. PBP1b PBP2a and PBP1a
PBP1b double mutants could also be isolated, and both showed
defects in positioning of the septum. Attempts to
obtain a PBP2a PBP1a double mutant failed. All mutants with a
disrupted pbp2a gene showed higher sensitivity to
moenomycin, an antibiotic known to inhibit PBP-associated glycosyltransferase activity, indicating that PBP2a is the
primary target for glycosyltransferase inhibitors in S. pneumoniae.
 |
TEXT |
Penicillin-binding proteins
(PBPs), membrane-associated proteins that catalyze late steps in
murein biosynthesis, are the classic targets for
-lactam
antibiotics. They are multidomain proteins, and according to their
domain structure, function, and relatedness in peptide sequence, they
are classified as multimodular high-molecular-weight PBPs of classes A
and B and monofunctional low-molecular-weight PBPs (9). A
common feature is a penicillin-binding domain responsible for the
enzymatically catalyzed interaction with
-lactam antibiotics that
involves a covalent acyl-enzyme intermediate via an active-site serine
residue. The critical penicillin-sensitive reaction is a
transpeptidation reaction cross-linking the muropeptide side chains of
different glycan strands. Class A PBPs, the only PBPs which have been
shown to be bifunctional enzymes in vitro, possess an N-terminal
glycosyltransferase domain and catalyze transpeptidation as well as
glycosyltransferase reaction in vitro (19). We have used the
term glycosyltransferase throughout this paper in order to avoid
confusion with the transglycosylases as glycan-degrading enzymes as
suggested previously by Di Berardino et al. (7). The
function of the N-terminal domain of class B PBPs is unknown
(1).
Attempts to isolate deletion mutant class B PBPs, such as
Escherichia coli PBP2 and PBP3 and Streptococcus
pneumoniae PBP2x and PBP2b, failed (3, 14). In
contrast, deletion constructs of the class A PBPs E. coli
PBP1a and -1b have been obtained, but double mutants could not be
obtained, indicating that the cell requires the function of at least
one of these PBPs (23). The third class A PBP, PBP1c, in
E. coli has not been investigated genetically, since its
existence was revealed essentially via genome analysis. There are three
class A PBPs in S. pneumoniae: PBP1a, PBP1b, and PBP2a
(13), and each is a member of a different subgroup of
gram-positive PBPs (9). So far, only PBP1a mutants have been
isolated (12, 14). In order to explore the roles of these
proteins in S. pneumoniae and especially their N-terminal domain in more detail, we constructed mutant versions of each of the
three PBP genes and investigated whether double PBP mutants could also
be isolated.
PBP1a, PBP1b, and PBP2a single mutants.
Mutations in each of
the three class A PBP genes were obtained via insertion duplication
mutagenesis of the laboratory strain R6 (2), using an
internal gene fragment cloned into a vector that cannot replicate in
S. pneumoniae but that carries an antibiotic resistance
marker selectable upon integration into the chromosome by homologous
recombination. Two different constructs were made in order to be able
to obtain double mutants, using plasmid pJDC9 with an erythromycin
resistance gene (6) and pUC19C, a derivative of pUC19 (New
England Biolabs) with the cat gene from pC194 (4) cloned into the HincII site. The internal fragments were
designed such that the peptide being transcribed after successful
recombination of the plasmid into the chromosomal gene terminated
within the glycosyltransferase domain (Fig.
1). This domain is defined by six
conserved motifs (13). A seventh conserved motif (GxxxxTxxQ [x is any amino acid]) is homologous to motif 4 in class B PBPs, which according to the structure of PBP2x in S. pneumoniae
represents the link between the two domains, and the derivatives
obtained after mutagenesis terminated well before this motif
(21).

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 1.
S. pneumoniae class A PBPs and mutant PBPs
used in this study. The structures of PBP1a, PBP1b, and PBP2a are shown
schematically, and their length (in amino acid residues) is indicated
on the right. The small black box indicates the putative
membrane-spanning domain. The conserved motif at the putative
transition between the N-terminal glycosyltransferase domain (hatched
area) and the penicillin-binding-transpeptidase domain, as well as the
active-site serine, are indicated by black triangles. The length of the
potentially produced peptide after insertion-duplication mutagenesis is
represented by the black bar.
|
|
Internal gene fragments were obtained by PCR performed essentially as
described previously (15) in a 100-µl volume using 2.5 U of Taq polymerase (Perkin-Elmer, Norwalk,
Conn.). The oligonucleotides used for amplification of different genes
were as follows: for pbp1a, C10CAACGATTCTGCGCCTAATC30
and G357AGGGAATTGCTTTGCAGATT337; for
pbp1b, C326CTATTCGGACGGGACGG343 and
G492GTCGCACGAATCACCGCC474; and for pbp2a,
G56TGAACTAGAGGACTCTG73 and
C660GCATCTTCTACACCCC644. The numbers indicate the position
in the genes according to their published sequence (11).
After purification of the DNA fragments with the Bio 101 Geneclean II
kit (Dianova, Hamburg, Germany), they were first cloned into
the PCR II vector by using E. coli INV
F' (TA
cloning kit; Invitrogen, Leek, The Netherlands) prior to cloning
into the EcoRI site of pJDC9 and pUC19C.
Purified plasmid DNA was used as donor DNA in transformation
experiments with competent
S. pneumoniae R6 as acceptor.
Pneumococci
were grown in C medium throughout (
16).
Transformation experiments
were performed essentially by the published
procedure (
17) by
30 min of incubation in the presence of
DNA at 30°C followed by
a 2-h phenotypic expression period at 37°C
and growth in agar
plates under selective conditions (1 µg of
erythromycin per ml
or 2 µg of chloramphenicol per ml). Transformants
were readily
obtained in all cases, and disruption of the respective
PBP gene
could be confirmed by PCR analysis and Southern hybridization
(not shown). Since the transformants should not contain a
penicillin-binding
domain in the mutated PBP, they could also be
verified by analysis
of their PBP profiles (Fig.
2). PBPs in cell lysates were
labeled
with [
3H]benzylpenicillin (2 µCi per
sample; Amersham Buchler, Braunschweig,
Germany) as
described and detected by fluorography after sodium
dodecyl
sulfate (SDS)-polyacrylamide gel electrophoresis (
13).
In
order to obtain clear separation between PBP1a and PBP1b,
SDS-polyacrylamide
gels with 10% acrylamide (acrylamide-bisacrylamide
[30:0.8]) were
used, and for clear separation of PBP2x, -2a, and -2b,
7.5% acrylamide
(acrylamide-bisacrylamide [30:1.1]) was used
(
11) (Fig.
2A and
B).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 2.
Profiles of single and double PBP mutants. PBPs were
visualized on fluorograms after labeling of cell lysates with
[3H]propionylampicillin. The disrupted PBP(s) of the
mutants or of the parent strain (R6) is indicated above the lanes.
1a* refers to transformants isolated after the attempt to disrupt
pbp2a in a pbp1a mutant. Gels with 10%
acrylamide (acrylamide-bisacrylamide [30:0.8]) (A and C) or 7.5%
acrylamide (acrylamide-bisacrylamide [30:1.1]) (B) were used. The
positions of PBPs are indicated to the left of the fluorograms.
|
|
Construction of double mutants.
Double mutants were
constructed from pUC19C-derived single mutants, and chromosomal DNA
from the pJDC9 derivatives was used in subsequent transformations to
introduce the second PBP mutation. Under standard transformation
conditions, several hundred transformants, pbp1a pbp1b
mutants or pbp1b pbp2a mutants, were obtained, corresponding to a transformation efficiency of 4 × 10
5 to 5 × 10
5, and all showed the expected PBP profiles (Fig.
2). In the pbp1b pbp2a double mutant, the PBP1a band
appeared somewhat smeared on the gel (Fig. 2B). PBP1a has an unusual
mobility on SDS-polyacrylamide gels in wild-type cells, showing a much
higher apparent molecular mass of more than 92 kDa compared to a
deduced molecular mass of 79.7 kDa. It is possible that this is due to
either modification of PBP1a or its interaction with another component
and that this property is affected in the mutants. In contrast, the
transformation efficiency dropped by >10-fold when disruption of
pbp2a was attempted in a pbp1a mutant used as
recipient. Eleven transformants were tested, but none showed a defect
in PBP2a on fluorograms (Fig. 2A and B) or contained an insert in the
pbp2a gene when investigated by PCR analysis. The
transformation was repeated another two times with the same result.
Thus, although a negative experiment is not definite proof, the data
strongly suggest that simultaneous deletion of both pbp1a
and pbp2a is lethal in S. pneumoniae.
Cellular growth of the mutants.
All single mutants and the two
types of double mutants obtained grew slower than the R6 strain, with
generation times between 43 and 49 min compared to 36 min for the R6
strain (Fig. 3). Different mutants
isolated from the same transformation experiments occasionally had
slightly different generation times, similar to the results for strains
with mutant PBP1a or PBP3 as reported previously (18, 22). They also did not reach the same cell density as the
parental strain, and they lysed earlier after reaching stationary-phase growth, suggesting that the lack of each of these enzymes causes some
defects related to cell wall biochemistry (Fig. 3). The differences in
generation time were less pronounced when the cells were grown in the
absence of erythromycin, but the early onset of stationary-phase lysis
especially in mutants with a disrupted pbp2a was still clear (data not shown).

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 3.
Growth of S. pneumoniae R6 and class A PBP
double mutants. Cells of an exponentially growing culture were diluted
in prewarmed C medium supplemented with erythromycin (1 µg/ml), and
growth was monitored by nephelometry (in nephelometry units [N]) over
time (in hours). Symbols: , S. pneumoniae R6; ,
pbp1a pbp1b mutant; , pbp1b pbp2a mutant.
|
|
Morphology.
When observed under the phase-contrast microscope,
the single mutants did not show any obvious phenotype, whereas the
double mutants appeared deformed and grew in small clumps (not shown). Cells of the double mutants were examined in more detail in the electron microscope. Exponentially growing cells were harvested by
centrifugation and prepared on carbon film by negative staining according to published procedures, using 1% sodium tungstophosphoric acid (pH 7.0) or 2% ammonium molybdate (24) and observed in an Philips CM100 electron microscope (Fig.
4). They were grown in C
medium with or without the addition of 2% choline. The addition of
choline prevents cell separation but not cell division, and morphological changes can be observed more easily under these conditions (5). In both the pbp1a pbp1b and
pbp1b pbp2a mutants, adjacent septa appeared frequently at
odd angles rather than parallel to each other as in the parent R6
strain, resulting in a corkscrew-like growth within the cell chains
(Fig. 4).



View larger version (201K):
[in this window]
[in a new window]
|
FIG. 4.
Electron microscopy of S. pneumoniae class A
PBP double mutants. Cells are shown after negative staining of
exponentially grown cultures of the parent strain S. pneumoniae R6 (A) and the pbp1a pbp1b (B) and
pbp1b pbp2a (C) double mutants. Cells were grown in C medium
with (+) or without ( ) the addition of 2% choline. Arrowheads
indicate odd division septa. Bars, 2 µm.
|
|
Antibiotic susceptibilities.
The E. coli PBP1b
contains a moenomycin-sensitive glycosyltransferase activity (25,
26). Despite the homology of the N-terminal domains of class A
PBPs, they are generally not targets for this antibiotic, and the
activity of the E. coli monodomain glycosyltransferase that
consists of just this module is also not affected by this drug
(7). We investigated the susceptibilities of S. pneumoniae single and double mutants to moenomycin by using a
narrow range of antibiotic concentrations on blood agar plates (3%
sheep blood; moenomycin concentrations used were 0.25, 0.3, 0.5, 0.75, 1, 1.25, and 1.5 µg/ml). The following MICs (in micrograms per
milliliter) were obtained for the different strains: R6, 1;
pbp1a and pbp1a pbp1b mutants, 0.75;
pbp1b mutant, 1.25; pbp2a mutant, 0.5; and pbp1b pbp2a mutant, 0.3. Thus, all mutants with a defective
pbp2a gene clearly showed a higher susceptibility to
moenomycin than the parental strain did, suggesting that this protein
functions as a moenomycin-sensitive glycosyltransferase. This was
similar to pbp1a mutants, but here the effect on moenomycin
susceptibility was less pronounced, although in vitro data suggested an
interaction between the glycosyltransferase domains of PBP1a and
moenomycin (8). No difference was found in the MICs of
-lactam antibiotics (cefotaxime, oxacillin, and penicillin G were
tested) except that a slightly higher oxacillin MIC was detected for
the pbp1a mutant and for both of the double mutants (0.07 to
0.08 µg/ml versus 0.03 µg/ml for the R6 strain). These mutants grew
poorly on agar plates, and 48 h instead of the routinely used
24 h for MIC determination was required; therefore, the
significance of the MIC changes is difficult to evaluate.
Concluding remarks.
S. pneumoniae is the first organism
for which the roles of all class A PBPs were investigated genetically.
The importance of these proteins has been deduced from studies on
penicillin-resistant strains. The fact that mutations in S. pneumoniae PBP2x and PBP2b are required for primary, low
resistance to these drugs has been used as an argument to confirm their
essential function (10, 17). Variants with a reduced
affinity to penicillins were also observed in all class A PBPs in
high-level-resistant strains, and experimental evidence that they can
function as resistance determinants was obtained for both PBP1a and
PBP2a (13, 20). This shows that inhibition of these PBPs
also cannot be tolerated by the cell, at least under certain
conditions. In fact, changes in all PBPs including the
low-molecular-weight PBP3 have been associated with resistance to
-lactams (15), documenting that the genetic background
and function of other PBPs are important parameters that define the
indispensable nature of a PBP. However, even a slightly slower growth
rate, such as that shown for all class A PBP mutants, may be a handicap
in vivo, and an early onset of stationary-phase lysis evident at least
in the double mutants will decrease the chances of surviving.
Therefore, it seems unlikely that class A PBP mutants can be found
outside the laboratory. Taken together, the results suggest that the
N-terminal glycosyltransferase domain remains an important target for
antimicrobial compounds.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, University of Kaiserslautern, Paul-Ehrlich Straße,
D-67663 Kaiserslautern, Germany. Phone: 49-631-205-2353. Fax:
49-631-205-3799. E-mail: hakenb{at}rhrk.uni-kl.de.
Present address: Institute of Biochemistry and Biophysics, Polish
Academy of Sciences, 02-106 Warsaw, Poland.
 |
REFERENCES |
| 1.
|
Adam, M.,
C. Fraipont,
N. Rhazi,
M. Nguyen-Distèche,
B. Lakaye,
J.-M. Frère,
B. Devreese,
J. Van Beeumen,
Y. van Heijenoort,
J. Van Heijenoort, and J.-M. Ghuysen.
1997.
The bimodular G57-V577 polypeptide chain of the class B penicillin-binding protein 3 of Escherichia coli catalyzes peptide bond formation from thioesters and does not catalyze glycan chain polymerization from lipid II intermediates.
J. Bacteriol.
179:6005-6009[Abstract/Free Full Text].
|
| 2.
|
Avery, O. T.,
C. M. MacLeod, and M. McCarty.
1944.
Studies on the chemical nature of the substance inducing transformation of pneumococcal types.
J. Exp. Med.
79:137-158[Abstract].
|
| 3.
|
Ayala, J. A.,
T. Garrido,
M. A. De Pedro, and M. Vicente.
1994.
Molecular biology of bacterial septation, p. 73-101.
In
J.-M. Ghuysen, and R. Hakenbeck (ed.), Bacterial cell wall. Elsevier, Amsterdam, The Netherlands.
|
| 4.
|
Ballester, S.,
J. Alonso,
P. Lopez, and M. Espinoza.
1990.
Comparative expression of the pC194 cat gene in Streptococcus pneumoniae, Bacillus subtilis, and Escherichia coli.
Gene
86:71-79[Medline].
|
| 5.
|
Briese, T., and R. Hakenbeck.
1983.
Interaction between choline and the N-acetyl-muramyl-L-alanine-amidase of Streptococcus pneumoniae, p. 173-178.
In
R. Hakenbeck, J.-V. Höltje, and H. Labischinski (ed.), The target of penicillin. Walter de Gruyter & Co., Berlin, Germany.
|
| 6.
|
Chen, J.-D., and D. A. Morrison.
1988.
Construction and properties of a new insertion vector, pJDC9, that is protected by transcriptional terminators and useful for cloning of DNA from Streptococcus pneumoniae.
Gene
64:155-164[Medline].
|
| 7.
|
Di Berardino, M.,
A. Dijkstra,
D. Stüber,
W. Keck, and M. Gubler.
1996.
The monofunctional glycosyltransferase of Escherichia coli is a member of a new class of peptidoglycan-synthesising enzymes: overexpression and determination of the glycan-polymerising activity.
FEBS Lett.
392:184-188[Medline].
|
| 8.
|
Di Guilmi, A. M.,
N. Mouz,
J. P. Andrieu,
J. Hoskins,
S. R. Jaskunas,
J. Gagnon,
O. Dideberg, and T. Vernet.
1998.
Identification, purification, and characterization of transpeptidase and glycosyltransferase domains of Streptococcus pneumoniae penicillin-binding protein 1a.
J. Bacteriol.
180:5652-5659[Abstract/Free Full Text].
|
| 9.
|
Goffin, C., and J.-M. Ghuysen.
1998.
Multimodular penicillin-binding proteins: an enigmatic family of orthologs and paralogs.
Microbiol. Mol. Biol. Rev.
62:1079-1093[Abstract/Free Full Text].
|
| 10.
|
Grebe, T., and R. Hakenbeck.
1996.
Penicillin-binding proteins 2b and 2x of Streptococcus pneumoniae are primary resistance determinants for different classes of -lactam antibiotics.
Antimicrob. Agents Chemother.
40:829-834[Abstract].
|
| 11.
|
Hakenbeck, R.,
T. Briese,
H. Ellerbrok,
G. Laible,
C. Martin,
C. Metelmann,
H.-M. Schier, and S. Tornette.
1988.
Targets of -lactams in Streptococcus pneumoniae, p. 390-399.
In
P. Actor, L. Daneo-Moore, M. L. Higgins, M. R. J. Salton, and G. D. Shockman (ed.), Antibiotic inhibition of bacterial cell surface assembly and function. American Society for Microbiology, Washington, D.C.
|
| 12.
|
Hakenbeck, R.,
H. Ellerbrok,
C. Martin,
G. Morelli,
C. Schuster,
A. Severin, and A. Tomasz.
1993.
Penicillin-binding protein 1a and 3 in Streptococcus pneumoniae: what are essential PBP's, p. 335-340.
In
M. A. De Pedro, J.-V. Höltje, and W. Löffelhardt (ed.), Bacterial growth and lysis metabolism and structure of the bacterial sacculus. Plenum Press, New York, N.Y.
|
| 13.
|
Hakenbeck, R.,
A. König,
I. Kern,
M. van der Linden,
W. Keck,
D. Billot-Klein,
R. Legrand,
B. Schoot, and L. Gutmann.
1998.
Acquisition of five high-Mr penicillin-binding protein variants during transfer of high-level -lactam resistance from Streptococcus mitis to Streptococcus pneumoniae.
J. Bacteriol.
180:1831-1840[Abstract/Free Full Text].
|
| 14.
|
Kell, C. M.,
U. K. Sharma,
C. G. Dowson,
C. Town,
T. S. Balganesh, and B. G. Spratt.
1993.
Deletion analysis of the essentiality of penicillin-binding proteins 1A, 2B and 2X of Streptococcus pneumoniae.
FEMS Microbiol. Lett.
106:171-175[Medline].
|
| 15.
|
Krauß, J., and R. Hakenbeck.
1997.
Mutations in PBP3 of a cefotaxime-resistant laboratory mutant C604 and penicillin-resistant clinical isolates of Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
41:936-942[Abstract].
|
| 16.
|
Lacks, S. A., and R. D. Hotchkiss.
1960.
A study of the genetic material determining an enzyme activity in pneumococcus.
Biochim. Biophys. Acta
39:508-517[Medline].
|
| 17.
|
Laible, G.,
R. Hakenbeck,
M. A. Sicard,
B. Joris, and J.-M. Ghuysen.
1989.
Nucleotide sequences of the pbpX genes encoding the penicillin-binding protein 2x from Streptococcus pneumoniae R6 and a cefotaxime-resistant mutant, C506.
Mol. Microbiol.
3:1337-1348[Medline].
|
| 18.
|
Martin, C.
1992.
Molekulargenetische Untersuchungen des Penicillin-bindenden Proteins (PBP) 1a von Streptococcus pneumoniae: Verwandtschaft von PBP 1a Mosaikgenen in Penicillin resistenten klinischen Stämmen. Thesis.
Freie Universität Berlin, Berlin, Germany.
|
| 19.
|
Matsuhashi, M.
1994.
Utilization of lipid-linked precursors and the formation of peptidoglycan in the process of cell growth and division: membrane enzymes involved in the final steps of peptidoglycan synthesis and the mechanism of their regulation, p. 55-71.
In
J.-M. Ghuysen, and R. Hakenbeck (ed.), Bacterial cell wall. Elsevier, Amsterdam, The Netherlands.
|
| 20.
|
Muñóz, R.,
C. G. Dowson,
M. Daniels,
T. J. Coffey,
C. Martin,
R. Hakenbeck, and B. G. Spratt.
1992.
Genetics of resistance to third-generation cephalosporins in clinical isolates of Streptococcus pneumoniae.
Mol. Microbiol.
6:2461-2465[Medline].
|
| 21.
|
Pares, S.,
N. Mouz,
Y. Pétillot,
R. Hakenbeck, and O. Dideberg.
1996.
X-ray structure of Streptococcus pneumoniae PBP2x, a primary penicillin target enzyme.
Nat. Struct. Biol.
3:284-289[Medline].
|
| 22.
|
Schuster, C.,
B. Dobrinski, and R. Hakenbeck.
1990.
Unusual septum formation in Streptococcus pneumoniae mutants with an alteration in the D,D-carboxypeptidase penicillin-binding protein 3.
J. Bacteriol.
172:6499-6505[Abstract/Free Full Text].
|
| 23.
|
Spratt, B. G., and V. Jobanputra.
1977.
Mutants of Escherichia coli which lack a component of penicillin binding protein 1a are viable.
FEMS Lett.
79:374-378[Medline].
|
| 24.
|
Steven, A. C.,
B. L. Trus,
J. V. Maizel,
M. Unser,
D. A. D. Parry, and J. S. Wall.
1988.
Molecular substructure of a viral receptor-recognition protein. The gp17 tail-fiber of bacteriophage T7.
J. Mol. Biol.
200:351-365[Medline].
|
| 25.
|
Suzuki, H.,
Y. van Heijenoort,
T. Tamura,
J. Mizoguchi,
Y. Hirota, and J. Van Heijenoort.
1980.
In vitro peptidoglycan polymerization catalysed by penicillin-binding protein 1b of Escherichia coli K 12.
FEBS Lett.
110:245-249[Medline].
|
| 26.
|
van Heijenoort, Y.,
M. Derrien, and J. Van Heijenoort.
1979.
Polymerization by transglycosylation in the biosynthesis of the peptidoglycan of Escherichia coli K 12 and its inhibition by antibiotics.
FEBS Lett.
89:141-144.
|
Journal of Bacteriology, June 1999, p. 3852-3856, Vol. 181, No. 12
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zerfass, I., Hakenbeck, R., Denapaite, D.
(2009). An Important Site in PBP2x of Penicillin-Resistant Clinical Isolates of Streptococcus pneumoniae: Mutational Analysis of Thr338. Antimicrob. Agents Chemother.
53: 1107-1115
[Abstract]
[Full Text]
-
Lanie, J. A., Ng, W.-L., Kazmierczak, K. M., Andrzejewski, T. M., Davidsen, T. M., Wayne, K. J., Tettelin, H., Glass, J. I., Winkler, M. E.
(2007). Genome Sequence of Avery's Virulent Serotype 2 Strain D39 of Streptococcus pneumoniae and Comparison with That of Unencapsulated Laboratory Strain R6. J. Bacteriol.
189: 38-51
[Abstract]
[Full Text]
-
Haenni, M., Majcherczyk, P. A., Barblan, J.-L., Moreillon, P.
(2006). Mutational Analysis of Class A and Class B Penicillin-Binding Proteins in Streptococcus gordonii. Antimicrob. Agents Chemother.
50: 4062-4069
[Abstract]
[Full Text]
-
Scheffers, D.-J., Pinho, M. G.
(2005). Bacterial Cell Wall Synthesis: New Insights from Localization Studies. Microbiol. Mol. Biol. Rev.
69: 585-607
[Abstract]
[Full Text]
-
Macheboeuf, P., Di Guilmi, A. M., Job, V., Vernet, T., Dideberg, O., Dessen, A.
(2005). Active site restructuring regulates ligand recognition in class A penicillin-binding proteins. Proc. Natl. Acad. Sci. USA
102: 577-582
[Abstract]
[Full Text]
-
Duez, C., Hallut, S., Rhazi, N., Hubert, S., Amoroso, A., Bouillenne, F., Piette, A., Coyette, J.
(2004). The ponA Gene of Enterococcus faecalis JH2-2 Codes for a Low-Affinity Class A Penicillin-Binding Protein. J. Bacteriol.
186: 4412-4416
[Abstract]
[Full Text]
-
Arbeloa, A., Segal, H., Hugonnet, J.-E., Josseaume, N., Dubost, L., Brouard, J.-P., Gutmann, L., Mengin-Lecreulx, D., Arthur, M.
(2004). Role of Class A Penicillin-Binding Proteins in PBP5-Mediated {beta}-Lactam Resistance in Enterococcus faecalis. J. Bacteriol.
186: 1221-1228
[Abstract]
[Full Text]
-
Wei, Y., Havasy, T., McPherson, D. C., Popham, D. L.
(2003). Rod Shape Determination by the Bacillus subtilis Class B Penicillin-Binding Proteins Encoded by pbpA and pbpH. J. Bacteriol.
185: 4717-4726
[Abstract]
[Full Text]
-
Di Guilmi, A. M., Dessen, A., Dideberg, O., Vernet, T.
(2003). The Glycosyltransferase Domain of Penicillin-Binding Protein 2a from Streptococcus pneumoniae Catalyzes the Polymerization of Murein Glycan Chains. J. Bacteriol.
185: 4418-4423
[Abstract]
[Full Text]
-
Butaye, P., Devriese, L. A., Haesebrouck, F.
(2003). Antimicrobial Growth Promoters Used in Animal Feed: Effects of Less Well Known Antibiotics on Gram-Positive Bacteria. Clin. Microbiol. Rev.
16: 175-188
[Abstract]
[Full Text]
-
Di Guilmi, A. M., Dessen, A., Dideberg, O., Vernet, T.
(2003). Functional Characterization of Penicillin-Binding Protein 1b from Streptococcus pneumoniae. J. Bacteriol.
185: 1650-1658
[Abstract]
[Full Text]
-
McPherson, D. C., Popham, D. L.
(2003). Peptidoglycan Synthesis in the Absence of Class A Penicillin-Binding Proteins in Bacillus subtilis. J. Bacteriol.
185: 1423-1431
[Abstract]
[Full Text]
-
van den Bogaard, A. E., Hazen, M., Hoyer, M., Oostenbach, P., Stobberingh, E. E.
(2002). Effects of Flavophospholipol on Resistance in Fecal Escherichia coli and Enterococci of Fattening P. Antimicrob. Agents Chemother.
46: 110-118
[Abstract]
[Full Text]
-
McPherson, D. C., Driks, A., Popham, D. L.
(2001). Two Class A High-Molecular-Weight Penicillin-Binding Proteins of Bacillus subtilis Play Redundant Roles in Sporulation. J. Bacteriol.
183: 6046-6053
[Abstract]
[Full Text]
-
Heijenoort, J. v.
(2001). Formation of the glycan chains in the synthesis of bacterial peptidoglycan. Glycobiology
11: 25R-36R
[Abstract]
[Full Text]
-
Zhao, G., Meier, T. I., Hoskins, J., McAllister, K. A.
(2000). Identification and Characterization of the Penicillin-Binding Protein 2a of Streptococcus pneumoniae and Its Possible Role in Resistance to beta -Lactam Antibiotics. Antimicrob. Agents Chemother.
44: 1745-1748
[Abstract]
[Full Text]
-
Hoskins, J., Matsushima, P., Mullen, D. L., Tang, J., Zhao, G., Meier, T. I., Nicas, T. I., Jaskunas, S. R.
(1999). Gene Disruption Studies of Penicillin-Binding Proteins 1a, 1b, and 2a in Streptococcus pneumoniae. J. Bacteriol.
181: 6552-6555
[Abstract]
[Full Text]