Previous Article | Next Article 
Journal of Bacteriology, July 1999, p. 4071-4075, Vol. 181, No. 13
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Cloning and Expression of cadD, a New
Cadmium Resistance Gene of Staphylococcus aureus
Scott S.
Crupper,1
Veronica
Worrell,2
George C.
Stewart,3 and
John
J.
Iandolo2,*
Division of Biological Sciences, Emporia
State University, Emporia, Kansas 668011;
Department of Microbiology and Immunology, University of
Oklahoma Health Sciences Center, Oklahoma City, Oklahoma
731902; and Department of Diagnostic
Medicine/Pathobiology, College of Veterinary Medicine, Kansas State
University, Manhattan, Kansas 665063
 |
ABSTRACT |
A cadmium resistance gene, designated cadD, has been
identified in and cloned from the Staphylococcus aureus
plasmid pRW001. The gene is part of a two-component operon which
contains the resistance gene cadD and an inactive
regulatory gene, cadX*. A high degree of sequence
similarity was observed between cadD and the
cadB-like gene from S. lugdunensis, but no
significant similarity was found with either cadA or
cadB from the S. aureus plasmids pI258 and
pII147. The positive regulatory gene cadX* is identical to
cadX from pLUG10 over a stretch of 78 codons beginning at
the N terminus, but it is truncated at this point and inactive.
Sequence analysis showed that the cadmium resistance operon resides on a 3,972-bp element that is flanked by direct repeats of
IS257. The expression of cadD in S. aureus and Bacillus subtilis resulted in low-level
resistance to cadmium; in contrast, cadA and
cadB from S. aureus induced higher level
resistance. However, when the truncated version of
cadX contained in pRW001 is complemented in
trans with cadX from plasmid pLUG10,
resistance increased approximately 10-fold suggesting that the
cadmium resistance operons from pRW001 and pLUG10 are
evolutionarily related. Moreover, the truncated version of
cadX contained in pRW001 is nonfunctional and may have been
generated by deletion during recombination to acquire the cadmium
resistance element.
 |
INTRODUCTION |
The cadA and
cadB operons represent the two known mechanisms of
plasmid-mediated cadmium resistance in Staphylococcus aureus (20, 22, 23, 26). The former is better characterized and is
associated with plasmid pI258 (13). A 3.5-kb operon located on this plasmid contains two genes, cadA and
cadC. cadA codes for a 727-amino acid (aa)
protein that shows sequence similarity to the P class of ATPases
(13, 18, 19). Cadmium enters S. aureus
through an Mn2+-specific active transport system (27,
28) and accumulates to toxic levels. The cadmium resistance
determinant (CadA) affords protection by functioning as an
energy-dependent cadmium efflux ATPase (21, 23). The CadC
protein is smaller, consisting of 122 aa, and serves as a transcription
regulator of the cadmium operon (5). Both CadA and CadC gene
products are required for resistance to cadmium and CadC can be
provided either in cis or in trans (5,
29).
cadB is a less-defined mechanism of cadmium resistance and
resides on an incompatibility group II plasmid, pII147 (14,
24). The mechanism of resistance afforded by cadB
differs significantly from that for cadA. The operon
contains two genes, designated cadB and cadX, the
latter showing strong sequence similarity to the cadC
protein (23). Even though the Mn2+-specific
transport system is active, S. aureus cells containing pII147 do not accumulate cadmium intracellularly. It has been suggested
that CadB does not promote cation efflux but may afford protection to
the cell by binding cadmium in the membrane (14).
Recently Chaouni et al. (4) reported a third cadmium
resistance element that was contained on plasmid pLUG10 from
S. lugdunensis. It encodes two genes, a
cadB-like cadmium resistance gene and a regulatory
locus, cadX, that in concert result in high-level resistance
to cadmium. CadX, like CadC, is a positive regulator of resistance,
shares 40% of sequence of CadC, and increases resistance fourfold.
The S. aureus phage group II plasmid pRW001 (15),
which contains the genes for exfoliative toxin B (16) and
the bacteriocin BacR1 (17), also encodes resistance to
cadmium (8). In this report, we show that the cadmium
resistance determinant from pRW001 (cadD) is similar to the
cadB-like operon from pLUG10 reported by Chaouni et al.
(4). The determinant is localized to a 3.5-kb DNA fragment
that has transposon-like characteristics. The element is flanked by
direct repeats of IS257 and also encodes a transposase gene
immediately 3' of the leftward copy of IS257. The
cadD gene is located at the other (3') end of the element
and is immediately upstream of a truncated version of cadX
from pLUG10.
 |
MATERIALS AND METHODS |
Bacterial strains and media.
S. aureus RN4220 and
Bacillus subtilis 168 were propagated at 37°C in tryptic
soy broth (TSB). S. aureus RN4220 harboring plasmids pI258,
pII147, pRW001, and/or pLUG314 was grown at 37°C in TSB containing
cadmium sulfate (10 µg/ml). Escherichia coli DH5
was
grown on LB agar and broth (8).
pLUG314, the generous gift from Francois Vandenesch (Lyon, France),
contains the cadB-cadX operon from S. lugdenensis
(4). The cadB gene has been inactivated by an
internal deletion, but cadX is still expressed. The plasmid
confers chloramphenicol resistance in S. aureus and was
propagated in TSB containing 10 µg of the antibiotic per ml. It was
transformed by electroporation (9) into S. aureus
RN4220 and RN4220(pRW001). The presence of the plasmid in both strains
was verified by agarose gel electrophoresis.
Cloning of cadmium resistance from pRW001.
DNA fragments
obtained from a partial Sau3A digest of pRW001 were cloned
into the BamHI site of the shuttle plasmid pLI50 (11). The preparations were electroporated (9)
into S. aureus RN4220, and clones that conferred cadmium
resistance were identified (data not shown). A representative that
contained a 2.8-kb plasmid insert, designated pCI108 (Fig.
1A), was chosen for further study. A
2.1-kb HindIII fragment from pCI108 containing the DNA
sequence encoding cadD and an adjacent smaller open reading
frame (ORF) was subcloned into the shuttle plasmid pLI50 to generate
pCI110. In addition, a 2.4-kb EcoRI-SalI fragment
containing the same genes was cloned in pLI50 to make pCI111 (Fig. 1A).
All of these constructs were electrotransformed into S. aureus RN4220.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Cloning strategy used to generate plasmids used in
this work. Each subclone is shown on the pLI50 backbone; their
construction is described in the text. pCI109 contains the 1.05-kb PCR
fragment containing the cadD gene cloned into the
HindIII site of pLI50. (B) Diagram of the
transposon-like element that contains the cadmium resistance
determinants. IS257 inverted repeats are indicated by
arrowheads; genes locations are indicated in boxed areas.
|
|
Subcloning of cadD.
The primers
5'GAAGATAATAAAAAATAGACGACGC3' (247 bp upstream of the
putative translation start site) and 5'CTTCTTTAATCAAAGATAATATGA3' (154 bp downstream of the CadD ORF) were used to amplify the
cadD gene from pCI108 by PCR. The amplification was
accomplished with 30 cycles of 94°C for 1 min, 55°C for 1 min, and
72°C for 1 min. The resulting 1,046-bp DNA fragment was cloned into
the T/A cloning vector pT7Blue (Novagen). This fragment was
subsequently cloned into the HindIII site of pLI50 to
yield pCI109 (Fig. 1A). DNA sequencing of both strands confirmed the
presence and correct sequence of the 205-aa ORF that we designated
cadD.
DNA sequencing and analysis.
A Sau3A partial
digest of pRW001 was size fractionated, and DNA in the 2-kb size range
was recovered from the gel and cloned into the BamHI site of
pBluescript. Random clones were sequenced in each direction, using the
universal priming sites flanking the inserts. DNA was sequenced with a
dideoxy termination kit (Applied Biosystems, Foster City, Calif.),
using an Applied Biosystems model 373A automated DNA sequencer.
Oligonucleotide primers used in DNA sequencing and PCR were purchased
from Integrated DNA Technologies, Coralville, Iowa.
Approximately 400 bp of sequence was obtained from each end of 360 clones containing inserts. Overlapping regions of DNA were
assembled by
using Sequencher 3.1 (Gene Codes Inc., Ann Arbor,
Mich.). These
sequences were used to provide additional sequence
surrounding the
cadD operon contained on pCI110. Hydropathy analysis
of
putative protein products was carried out by the method of
Kyte and
Doolittle (
10), using a window of seven residues. Molecular
modeling was carried out with routines from the BCM Search Launcher
(
25) at the Baylor College of
Medicine.
Determination of inhibitory dose.
Plasmids pC110 and pC111
were electroporated into S. aureus RN4220 and transformed
into B. subtilis 168 trpC2 (2, 9). Cadmium resistance levels were determined after overnight growth at
37°C in TSB containing increasing amounts of cadmium sulfate. The
maximum inhibitory concentration (MIC) was considered to be the
concentration of cadmium sulfate which prevented the appearance of
turbidity in the culture after overnight incubation at 37°C. Since
CadD from pRW001 represents a third plasmid-encoded cadmium resistance
mechanism found in S. aureus, a comparison of the resistance levels encoded by the three systems was carried out in S. aureus RN4220. Constructs containing pI258 (CadA), pII147 (CadB),
or pRW001 were generated, and growth was assayed at increasing cadmium concentrations. Similar experiments were also performed to determine the MIC of S. aureus 4220(pRW001)(pLUG314).
Nucleotide sequence accession number.
The element (3,972 bases) containing the cadD operon was deposited in GenBank
and assigned accession no. AF134905.
 |
RESULTS AND DISCUSSION |
Cloning and analysis of the cadmium resistance genes.
The
cadmium resistance element was cloned on a 2.8-kb Sau3A
fragment of plasmid pRW001 (Fig. 1, pCI108). A 2.1-kb
HindIII fragment subcloned from the original insert
(Fig. 1, pCI110) was sequenced at the Kansas State University
sequencing facility. Analysis of the sequence revealed the presence of
two adjacent ORFs, the first consisting of 209 codons and the second
consisting of 78 codons.
BLAST search analysis (
1,
6) showed that the cadmium
resistance determinants of pRW001 are related to the
cadB-like
determinants of pLUG10 (
4). Both
plasmids contain operons composed
of a cadmium resistance element and a
regulatory gene required
for full resistance. The predicted CadD
protein and the CadB-like
protein (
4) share 84% of
sequence, but only if the first methionine
codon (Fig.
2, upper sequence) at base 236 is chosen
as the translation
start site. Using this start codon, we find that the
first three
residues of CadD and the CadB-like protein from pLUG10
match,
but a significant divergence occurs between residues 4 and 14.
The sequence divergence does not appear to represent a frameshift
mutation. This DNA fragment was sequenced from eight independently
isolated clones, and in each case the data were identical and
unambiguous.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Alignment of the CadD protein from pRW001 with the
CadB-like protein from pLUG10 (top); (B) alignment of CadX with the
putative CadX*. Identical residues are boxed.
|
|
There does not appear to be a consensus ribosome binding site upstream
of this start site of either
cadD or
cadB of
Chaouni
et al. (
4). Novick (
12) has shown that
staphylococcal ribosome
binding sites vary from the canonical conserved
sequence, but
all contain purine-rich sites. With this in mind,
translation
may actually begin at the AUG codon 12 bases further
downstream
(CadD amino acid residue 5) which is preceded by a candidate
ribosome
binding site at bases 237 to 241 (TGAGG). Therefore, the
probable
translation start site of
cadD is
uncertain.
The CadB-like homologs are identical in size and share 84% of
sequence, while the CadX homologs share 86% of sequence beginning
over
a 78-aa run at the N terminus (Fig.
2).
However, the
cadX gene from pRW001 (
cadX*) is
truncated and contains only 78 codons,
compared to 115 for
cadX from pLUG10. DNA sequencing of the
cadX gene
that was PCR amplified directly from pRW001 yielded the same
nucleotide
sequence as the
cadX gene cloned from pRW001 (data
not
shown). Thus, this smaller ORF is also not the result of a
cloning or
sequencing
artifact.
Hydropathy analysis of CadD revealed a substantial hydrophobic
character, suggesting that it may function as an integral membrane
protein. It is typical of prokaryotic membrane lipoproteins and
contains a membrane lipoprotein lipid attachment site at residues
112 to 124. There are five prominent hydrophobic regions following
the
signal peptide region. Molecular modeling (
25) has predicted
these five transmembrane domains inserted in the membrane with
the N
terminus of the protein oriented toward the outside and
the C terminus
internal (Fig.
3). This arrangement would
place
cysteine residues located at positions 94 and 124 that could
presumably
interact with Cd
2+ (
13) oriented
toward the cytosolic domain. Cadmium could then
be bound at the
membrane as described by Perry and Silver (
14).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
CadD membrane insertion model predicted from hydropathy
analysis of transmembrane domains. The amino and carboxy termini are
marked.
|
|
Cadmium resistance levels.
The cadD
determinant confers a modest level of cadmium resistance. Cadmium
sulfate at greater than 10 µg/ml completely inhibited the
growth of S. aureus(pLI50), whereas measurable growth
was detected at up to 40 µg/ml for S. aureus(pCI110) (Fig.
4A). The determinant also conferred
cadmium resistance when present in B. subtilis, and although
B. subtilis(pCI110) (Fig. 4B) was more resistant to cadmium
than B. subtilis(pLI50), the overall level was markedly
lower than in S. aureus. Low-level resistance similar to
that of pCI110 was also obtained (data not shown) when pCI109 (PCR-amplified fragment containing only cadD) was tested for
its ability to confer cadmium resistance in S. aureus and
B. subtilis.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4.
Cadmium resistance in S. aureus and B. subtilis containing pCI110. Overnight
cultures were used to inoculate fresh in TSB containing variable
amounts of cadmium sulfate to an initial A550 of
0.005. After growth of the cultures for 16 h at 37°C with
shaking, the A550 of each culture was
determined. Each data point is the mean of three experiments from
duplicate cultures. (A) S. aureus(pCI110) ( ) and
S. aureus (pLI50) ( ); (B) B. subtilis(pCI110) ( ) and B. subtilis(pLI50) ( );
(C) cadmium resistance in S. aureus containing either
pI258 ( ), pII147 ( ), or pRW001 ( ). Overnight cultures were
used to inoculate TSB containing variable amounts of cadmium sulfate to
an initial A550 of 0.005. After growth for
16 h at 37°C with shaking, the A550 of
the culture was determined. Each data point is the mean of three
experiments measured in duplicate.
|
|
The degree of cadmium resistance conferred by
cadD differs
markedly from that resulting from the other characterized cadmium
resistance determinants. As shown in Fig.
4C, the growth of
S. aureus pRW001 steadily decreased at CdSO
4 levels over
6 µg/ml,
finally plateauing at about 20 µg/ml. However, 40 µg of
CdSO
4 per ml had no effect on the growth of
S. aureus containing either
pI258 or pII147. These strains also grew
at cadmium sulfate concentrations
as high as 500 µg/ml (data not
shown).
The MIC of cadmium sulfate for
S. aureus(pCI110) was 40 µg/ml, compared to approximately 10 µg/ml for
B. subtilis(pCI110).
The increased tolerance to cadmium of cells
containing either
the
cadA or
cadB determinant
cannot be attributed to plasmid copy
differences since all three
resistance elements are contained
on plasmids present in only a
few copies per cell (
12). Further
support for this
conclusion is provided by the observation that
pCI110 and pCI111, which
are present in higher copy numbers than
pRW001, were unable to confer
resistance to cadmium at concentrations
similar to those of pI258 and
pII147. Alternatively, since each
organism possesses unique membrane
properties, membrane insertion
and conformation or an accessory protein
present only in
S. aureus membranes may be
required for maximal
resistance.
Another possible factor contributing to the notable difference in
cadmium resistance conferred by the
cadB-like and the
cadD operons is the presence in
cadD of a
truncated version of the
positive regulatory gene
cadX. The
gene from pRW001 contains only
the first 78 of 115 codons of the
authentic gene. We hypothesized
that because it is truncated at the
C-terminal end of a predicted
helix-turn-helix DNA binding motif, it is
probably nonfunctional.
To test this hypothesis, we
electrotransformed
S. aureus(pRW001)
with plasmid
pLUG314, which contains a functional
cadX and assessed
levels of resistance of the resulting construct. High-level resistance
was afforded by transcomplementation of
cadX* by the
cadX gene
from pLUG10. This resulted in an approximately
10-fold increase
in resistance level. The MIC of the transformant
clones containing
both plasmids was >150 µg/ml, or 195 µM, roughly
equivalent to
that conferred by pI258 or pII147. On the other hand,
with pRW001
alone, which contains a defective copy of CadX, only
low-level
resistance (MIC of ca. 20 µg/ml [26 µM]) was observed.
Neither
the recipient strain alone nor the recipient containing pLUG314
showed any resistance to CdSO
4. Thus, CadX appears to be
necessary
for expression of full cadmium resistance from
pRW001.
Sequence analysis of
cadX shows that it is a member of a
regulatory family characterized by
cadC,
arsR,
and
smtB. The ArsR
and SmtB repressor proteins bind DNA via
a helix-turn-helix motif
and dissociate from it in the presence of
metal ions. They have
been hypothesized to interact with cations,
resulting in a conformational
change that prohibits binding to DNA
(
3). This in turn results
in increased transcription of the
associated resistance
elements.
This explanation, however, is inappropriate for CadC and CadX, which
exert positive regulatory effects (
4,
5). Therefore,
a
conformational change that prevents interaction with DNA would
not
upregulate transcription. In fact, in the absence of CadC
or CadX, only
low-level resistance is present. However, activation
of
cadD
and
cadB by other mechanisms such as a metal-dependent
interaction of CadX with the genes cannot be ruled
out.
Last, we also considered the possibility that
cadD encodes
another heavy metal resistance and functions in a limited fashion
for
cadmium resistance. However,
cadD on pRW001 alone or
upregulated
by CadX on pLUG314 was unable to confer resistance to
sodium arsenate,
sodium arsenite, lead nitrate, mercuric nitrate, and
zinc chloride
when tested at several concentrations (data not
shown).
Origin of the cadmium resistance determinants.
In some strains
of S. aureus containing plasmids encoding the gene for
exfoliative toxin B, cadmium resistance is conferred by a small plasmid
of about 4 kb (15). However, pRW001 contains the
determinants for cadmium resistance in the absence of small plasmids.
Considering the similarity of CadD and CadX to counterparts in pLUG10
and the complementation of cadX* in trans by
cadX, we suggest that the two operons are closely related.
Acquisition of the cadmium element in pRW001 probably occurred by
recombination. If this event was imprecise, it could be responsible for
truncation of CadX* to an inactive form. To examine this further, we
sequenced regions of pRW001 upstream and downstream of the 2.1-kb
HindIII clone. Examination of the sequence showed that
the CadD operon appears to reside on a 3,972-bp DNA fragment that is
bounded by direct repeats of IS257 (Fig. 1B). The
3'-terminal IS257 element abuts the end of the
cadX* gene, and it is likely that the truncated portion of
cadX was lost during assembly of this element. The question
of transposability is still open. We have not yet been able to
demonstrate that it is capable of movement and illegitimate recombination. These experiments are under way and will be reported in
a later communication.
 |
ACKNOWLEDGMENTS |
This work was supported by grants AI-17474 and AI43568 from the
National Institute of Allergy and Infectious Diseases.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, University of Oklahoma Health Science
Center, Oklahoma City, OK 73190. Phone: (405) 271-2133. Fax:
405-271-3117. E-mail: John-Iandolo{at}ouhsc.edu.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 2.
|
Anagnostopoulos, C., and J. Spizizen.
1961.
Requirements for transformation in Bacillus subtilis.
J. Bacteriol.
81:741-746[Free Full Text].
|
| 3.
|
Bairoch, A.
1993.
A possible mechanism for metal-ion induced DNA-protein dissociation in a family of prokaryotic transcriptional regulators.
Nucleic Acids Res.
21:2515-2515[Free Full Text].
|
| 4.
|
Chaouni, L. B.-A.,
J. Etienne,
T. Greenland, and F. Vandenesch.
1996.
Nucleic acid sequence and affiliation of pLUG10 of a novel cadmium resistance plasmid from Staphylococcus lugdenensis.
Plasmid
36:1-8[Medline].
|
| 5.
|
Endo, G., and S. Silver.
1995.
CadC, the transcriptional regulatory protein of the cadmium resistance system of Staphylococcus aureus plasmid pI258.
J. Bacteriol.
177:4437-4441[Abstract/Free Full Text].
|
| 6.
|
Gish, W., and D. J. States.
1993.
Identification of protein coding regions by database similarity search.
Nat. Genet.
3:266-272[Medline].
|
| 7.
|
Iandolo, J. J.
1989.
Genetic analysis of extracellular toxins of Staphylococcus aureus.
Annu. Rev. Microbiol.
43:375-402[Medline].
|
| 8.
|
Jackson, M. P., and J. J. Iandolo.
1985.
Cloning and expression of the exfoliative toxin B gene from Staphylococcus aureus.
J. Bacteriol.
166:574-580.
|
| 9.
|
Kraemer, G. H., and J. J. Iandolo.
1990.
High-frequency transformation of Staphylococcus aureus by electroporation.
Curr. Microbiol.
21:373-376.
|
| 10.
|
Kyte, J., and R. F. Doolittle.
1982.
A simple method for displaying the hydropathic character of a protein.
J. Mol. Biol.
157:105-132[Medline].
|
| 11.
|
Lee, C. Y., and J. J. Iandolo.
1986.
Integration of staphylococcal phage L54a occurs by site-specific recombination: structural analysis of the attachment sites.
Proc. Natl. Acad. Sci. USA
83:5474-5478[Abstract/Free Full Text].
|
| 12.
|
Novick, R. P.
1991.
Genetic systems in staphylococci.
Methods Enzymol.
204:587-636[Medline].
|
| 13.
|
Nucifora, G.,
L. Chu,
T. K. Mirsa, and S. Silver.
1989.
Cadmium resistance from Staphylococcus aureus plasmid pI258 cadA gene results from a cadmium efflux ATPase.
Proc. Natl. Acad. Sci. USA
86:3544-3548[Abstract/Free Full Text].
|
| 14.
|
Perry, R. D., and S. Silver.
1982.
Cadmium and manganese transport in Staphylococcus aureus membrane vesicles.
J. Bacteriol.
150:973-976[Abstract/Free Full Text].
|
| 15.
|
Rogolsky, M.,
B. B. Wiley, and L. A. Glasgow.
1976.
Phage group 2 staphylococcal strains with chromosomal and extrachromosomal genes for exfoliative toxin production.
Infect. Immun.
13:44-52[Abstract/Free Full Text].
|
| 16.
|
Rogolsky, M.
1979.
Nonenteric toxins of Staphylococcus aureus.
Microbiol. Rev.
43:320-360[Free Full Text].
|
| 17.
|
Rogolsky, M., and B. B. Wiley.
1977.
Production and properties of a staphylococcin genetically controlled by the staphylococcal plasmid for exfoliative toxin synthesis.
Infect. Immun.
15:726-732[Abstract/Free Full Text].
|
| 18.
|
Serrano, R.
1988.
Structure and function of proton translocating ATPase in plasma membranes of plants and fungi.
Biochim. Biophys. Acta
947:1-28[Medline].
|
| 19.
|
Serrano, R.
1989.
Structure and function of plasma membrane ATPase.
Annu. Rev. Plant Physiol. Plant Mol. Biol.
40:61-94.
|
| 20.
|
Silver, S., and R. A. Laddaga.
1990.
Molecular genetics of heavy metal resistance systems in Staphylococcus aureus plasmids, p. 531-549.
In
R. P. Novick (ed.), Molecular biology of the staphylococci. VCH Publications, New York, N.Y.
|
| 21.
|
Silver, S.,
G. Nucifora,
L. Chu, and T. K. Misra.
1989.
Bacterial resistance ATPases: primary pumps for exporting toxic cations and anions.
Trends Biochem. Sci.
14:76-80[Medline].
|
| 22.
|
Silver, S., and T. K. Misra.
1988.
Plasmid-mediated heavy metal resistances.
Annu. Rev. Microbiol.
42:717-743[Medline].
|
| 23.
|
Silver, S., and M. Walderhaug.
1992.
Gene regulation of plasmid- and chromosome-determined inorganic ion transport in bacteria.
Microbiol. Rev.
56:195-228[Abstract/Free Full Text].
|
| 24.
|
Smith, K., and R. P. Novick.
1972.
Genetic studies on plasmid-linked cadmium resistance in Staphylococcus aureus.
J. Bacteriol.
112:761-772[Abstract/Free Full Text].
|
| 25.
|
Smith, R. F.,
B. A. Wiese,
M. K. Wojzynski,
D. B. Davison, and K. C. Worley.
1996.
BCM Search Launcher an integrated interface to molecular biology data base search and analysis services available on the World Wide Web.
Genome Res.
6:454-462[Abstract/Free Full Text].
|
| 26.
|
Tisa, L. S., and B. P. Rosen.
1990.
Transport systems encoded by bacterial plasmids.
J. Bioenerg. Biomembr.
22:493-507[Medline].
|
| 27.
|
Tynecka, Z.,
Z. Gos, and J. Zajac.
1981.
Energy-dependent efflux of cadmium coded by a plasmid resistance determinant in Staphylococcus aureus.
J. Bacteriol.
147:313-319[Abstract/Free Full Text].
|
| 28.
|
Weiss, A. A.,
S. Silver, and T. G. Kinscherf.
1978.
Cation transport alteration associated with plasmid-determined resistance to cadmium in Staphylococcus aureus.
Antimicrob. Agents Chemother.
14:856-865[Abstract/Free Full Text].
|
| 29.
|
Yoon, K. P., and S. Silver.
1991.
A second gene in the Staphylococcus aureus cadA cadmium resistance determinant of plasmid pI258.
J. Bacteriol.
173:7636-7642[Abstract/Free Full Text].
|
Journal of Bacteriology, July 1999, p. 4071-4075, Vol. 181, No. 13
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lindstrom, M., Hinderink, K., Somervuo, P., Kiviniemi, K., Nevas, M., Chen, Y., Auvinen, P., Carter, A. T., Mason, D. R., Peck, M. W., Korkeala, H.
(2009). Comparative Genomic Hybridization Analysis of Two Predominant Nordic Group I (Proteolytic) Clostridium botulinum Type B Clusters. Appl. Environ. Microbiol.
75: 2643-2651
[Abstract]
[Full Text]
-
Chen, Y.-Y. M., Feng, C. W., Chiu, C. F., Burne, R. A.
(2008). cadDX Operon of Streptococcus salivarius 57.I. Appl. Environ. Microbiol.
74: 1642-1645
[Abstract]
[Full Text]
-
Frank, K. L., del Pozo, J. L., Patel, R.
(2008). From Clinical Microbiology to Infection Pathogenesis: How Daring To Be Different Works for Staphylococcus lugdunensis. Clin. Microbiol. Rev.
21: 111-133
[Abstract]
[Full Text]
-
Tenover, F. C., McDougal, L. K., Goering, R. V., Killgore, G., Projan, S. J., Patel, J. B., Dunman, P. M.
(2006). Characterization of a Strain of Community-Associated Methicillin-Resistant Staphylococcus aureus Widely Disseminated in the United States. J. Clin. Microbiol.
44: 108-118
[Abstract]
[Full Text]
-
Naz, N., Young, H. K., Ahmed, N., Gadd, G. M.
(2005). Cadmium Accumulation and DNA Homology with Metal Resistance Genes in Sulfate-Reducing Bacteria. Appl. Environ. Microbiol.
71: 4610-4618
[Abstract]
[Full Text]
-
van Kranenburg, R., Golic, N., Bongers, R., Leer, R. J., de Vos, W. M., Siezen, R. J., Kleerebezem, M.
(2005). Functional Analysis of Three Plasmids from Lactobacillus plantarum. Appl. Environ. Microbiol.
71: 1223-1230
[Abstract]
[Full Text]
-
Kozitskaya, S., Cho, S.-H., Dietrich, K., Marre, R., Naber, K., Ziebuhr, W.
(2004). The Bacterial Insertion Sequence Element IS256 Occurs Preferentially in Nosocomial Staphylococcus epidermidis Isolates: Association with Biofilm Formation and Resistance to Aminoglycosides. Infect. Immun.
72: 1210-1215
[Abstract]
[Full Text]
-
O'Brien, F. G., Price, C., Grubb, W. B., Gustafson, J. E.
(2002). Genetic characterization of the fusidic acid and cadmium resistance determinants of Staphylococcus aureus plasmid pUB101. J Antimicrob Chemother
50: 313-321
[Abstract]
[Full Text]
-
Yamaguchi, T., Hayashi, T., Takami, H., Ohnishi, M., Murata, T., Nakayama, K., Asakawa, K., Ohara, M., Komatsuzawa, H., Sugai, M.
(2001). Complete Nucleotide Sequence of a Staphylococcus aureus Exfoliative Toxin B Plasmid and Identification of a Novel ADP-Ribosyltransferase, EDIN-C. Infect. Immun.
69: 7760-7771
[Abstract]
[Full Text]
-
Lee, S.-W., Glickmann, E., Cooksey, D. A.
(2001). Chromosomal Locus for Cadmium Resistance in Pseudomonas putida Consisting of a Cadmium-Transporting ATPase and a MerR Family Response Regulator. Appl. Environ. Microbiol.
67: 1437-1444
[Abstract]
[Full Text]
-
Simpson, A. E., Skurray, R. A., Firth, N.
(2000). An IS257-Derived Hybrid Promoter Directs Transcription of a tetA(K) Tetracycline Resistance Gene in the Staphylococcus aureus Chromosomal mec Region. J. Bacteriol.
182: 3345-3352
[Abstract]
[Full Text]