Previous Article | Next Article 
Journal of Bacteriology, July 1999, p. 4118-4124, Vol. 181, No. 13
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The pvc Gene Cluster of
Pseudomonas aeruginosa: Role in Synthesis of the Pyoverdine
Chromophore and Regulation by PtxR and PvdS
Alain
Stintzi,1,2
Zaiga
Johnson,3
Martin
Stonehouse,3
Urs
Ochsner,3
Jean-Marie
Meyer,2
Michael L.
Vasil,3 and
Keith
Poole1,*
Department of Microbiology and Immunology,
Queen's University, Kingston, Ontario, Canada K7L
3N61; Laboratoire de Microbiologie et de
Génétique, Unité de Recherche Associée au
Centre National de la Recherche Scientifique No. 1481, Université
Louis-Pasteur, 67000 Strasbourg, France2; and
Department of Microbiology, University of Colorado Health
Sciences Center, Denver, Colorado 802623
Received 8 March 1999/Accepted 28 April 1999
 |
ABSTRACT |
A putative operon of four genes implicated in the synthesis of the
chromophore moiety of the Pseudomonas aeruginosa
siderophore pyoverdine, dubbed pvcABCD (where
pvc stands for pyoverdine chromophore), was cloned and
sequenced. Mutational inactivation of the pvc genes abrogated pyoverdine biosynthesis, consistent with their involvement in
the biosynthesis of this siderophore. pvcABCD expression
was negatively regulated by iron and positively regulated by both PvdS,
the alternate sigma factor required for pyoverdine biosynthesis, and
PtxR, a LysR family activator previously implicated in exotoxin A regulation.
| |
TEXT |
Although iron is an essential
nutrient for most bacteria, the low solubility and, thus,
bioavailability of this element in nature complicates bacterial iron
acquisition (32). Many bacteria deal with this problem by
synthesizing high-affinity iron-chelating molecules, termed
siderophores (31), which function coordinately with cell
surface receptors specific for the iron-siderophore complexes (30,
31) to transport iron into the cell. Pathogenic organisms also
encounter an iron-limited environment in the host (41), and
siderophore-mediated mechanisms of iron acquisition are important
contributors to in vivo growth and, thus, pathogenesis of many
disease-causing bacteria (e.g., see references 7 and 16).
Pseudomonas aeruginosa is an opportunistic human pathogen
which produces two known siderophores, pyoverdine (9) and
pyochelin (8). Production of pyoverdine in vivo has been
documented (17), consistent with a demonstrated role for
this siderophore in promoting in vivo growth and pathogenesis
(27). This mixed hydroxymate-catecholate siderophore is
characterized by a conserved hydroxyquinoline chromophore bound to an
amino acid tail of variable length and composition (6).
Synthesis of the chromophore is hypothesized to involve a condensation
of D-tyrosine and L-2,4-diaminobutyric acid
(DAB) (6), while synthesis of the peptide moiety apparently
involves a nonribosomal mechanism (23).
Genes for the synthesis of pyoverdine have been mapped to three regions
of the P. aeruginosa PAO chromosome, at 23, 47 (20), and 66 to 70 (44) min on the recalibrated
PAO map. A 103-kb fragment of chromosomal DNA originating from the
47-min region has been cloned. Referred to as the pvd region
(48), this DNA carries several genes shown to be involved in
pyoverdine biosynthesis. DNA originating from the 66- to 70-min region
of the PAO chromosome has also been cloned. Responsible for the
synthesis of a chromophore-like molecule dubbed pseudoverdine, a
gene(s) in this region is required for pyoverdine biosynthesis
(44), presumably for the chromophore moiety.
Pyoverdine synthesis is dependent upon an alternate sigma factor, PvdS,
required for gene expression from a variety of pvd promoters
(10, 28). PvdS is negatively regulated by Fur (10, 28,
34), a repressor protein which mediates the iron-regulated expression of a number of genes, providing a likely explanation for the
iron-regulated production of pyoverdine in P. aeruginosa.
In the present report we describe the sequencing of the pseudoverdine
gene cluster and the identification and regulation of an operon of four
genes (pvcABCD) required for pyoverdine (chromophore) production.
Methods.
Bacterial strains and plasmids used in this study are
listed in Table 1. Luria-Bertani (LB)
(Difco), brain heart infusion (BHI) (BDH) and the iron-deficient
King's B (KB) (22) or succinate minimal (24)
media have been described previously. Strains cultivated for the
purpose of extracting RNA for use in RNase protection assays were grown
in low-iron Trypticase soy broth dialysate with (iron replete) or
without (iron deficient) FeCl3 supplementation (39 µM)
(3). Minimal medium was supplemented with amino acids (1 mM)
and adenosine (2 mM) as required. The following antibiotics were
included in the growth media as required at the indicated concentrations: ampicillin, 100 µg/ml; kanamycin, 100 µg/ml;
carbenicillin, 400 µg/ml; streptomycin, 500 µg/ml; chloramphenicol,
50 µg/ml (for Escherichia coli and P. aeruginosa K1081), 200 µg/ml (for P. aeruginosa
ML5087), or 600 µg/ml (for P. aeruginosa PAO1); gentamicin, 75 µg/ml; Irgasan DP-300 (Ciba-Geigy), 50 µg/ml; and HgCl2, 50 µg/ml.
Chromosomal DNA was prepared by using a modification of the Blin and
Stafford procedure as described in reference
40.
Large-scale
plasmid DNA was prepared with a Plasmid Midi kit (Qiagen,
Inc.,
Chatsworth, Calif.). Standard methods were used for the
preparation
of small-scale plasmid DNA, enzyme digestions, ligations,
agarose
gel electrophoresis (
40), and transformation of
E. coli (
40)
and
P. aeruginosa
(
4). DNA fragments were purified from agarose
gels with a
Prep-a-gene kit (Bio-Rad Labs, Mississauga, Canada).
Southern
hybridizations were carried out as described previously
(
40), with a digoxigenin labelling kit (Boehringer,
Mannheim,
Germany) to process the
hybridizations.
A region of pPYP180 responsible for pseudoverdine and necessary for
pyoverdine synthesis was sequenced following the generation
of a number
of subclones (in pUC19) from which nested deletions
were constructed by
using a double-stranded nested deletion kit
(Pharmacia Biotech).
Plasmid DNA for sequencing was purified as
described previously
(
1) and sequenced by Cortec DNA Services
Laboratory Inc.,
using the M13 universal forward primer. The sequence
overlapping the
boundaries of the various subclones was obtained
by using defined
oligonucleotide primers and plasmid pPYP177 DNA
as the template.
Sequence analysis was carried out with the PCGENE
software package
(Intelligentics Inc., Mountain View, Calif.).
The
ptxR gene
was cloned as a 990-bp promoterless gene which was
generated by PCR
using Deep Vent DNA polymerase (New England Biolabs)
and the primers
5'-
TCTAGACCCGTCCGGACCCACTTC-3' (
XbaI site
underlined)
and
5'-
AAGCTTGCCCAGCCTCATTCGCTCTG-3'
(
HindIII site underlined).
Following cloning
into pCR-blunt (Invitrogen Corporation, Carlsbad,
Calif.), the fragment
was directionally cloned as an
XbaI-
HindIII
fragment into pVLT31 to yield
pPTX990.
Two approaches were taken to generate
ptxR derivatives of
P. aeruginosa. Initially, the 1.4-kb
BamHI-
BglII DNA fragment of
pPYP177 was cloned
into the
BamHI site of pMAL-c2 (Pharmacia)
in the same
orientation as the
lac promoter of this vector. The
recombinant vector was introduced into and subsequently prepared
from
E. coli GM2163 before being digested with
ClaI
and
NruI to
release a 0.4-kb fragment from the
ptxR coding region. Following
purification of the vector
free of this 0.4-kb fragment, the
ClaI
5' end was blunt
ended with Klenow fragment and the plasmid was
recircularized with T4
DNA ligase. The
ptxR coding region with
the deletion was
excised from the plasmid on a 1-kb
BamHI-
HindIII
DNA fragment and cloned into
plasmid pK18
mobsacB. The resultant
vector, pAS16, was then
introduced into
E. coli S17-1 and mobilized
into
P. aeruginosa ML5087 via conjugation as described previously
(
37). Recipients carrying pAS16 in the chromosome were
selected
on LB agar containing kanamycin (100 µg/ml) and tetracycline
(10
µg/ml). Kanamycin-resistant colonies appearing after 24 h of
growth
at 37°C were streaked onto LB agar containing sucrose (10%,
wt/vol)
(
42). Sucrose-resistant colonies carrying the
ptxR region with
the deletion (e.g., K1081) were identified
following amplification
of the
ptxR gene by using
Taq polymerase and primers ptxR3
(5'-CAGGACTTCGTCAAGTGGCA-3')
and ptxR4
(5'-AGCTCTTCGAGAAC-GGCCTG-3'). Reaction mixtures were
formulated as described previously (
38) and subjected to 1 min
at 94°C followed by 30 cycles of 40 s at 94°C, 50 s
at 50°C, and
3 min at 72°C before finishing with 10 min at 72°C.
A
ptxR deletion
mutant of PAO1 was subsequently generated
following the tagging
of a 0.8-kb deletion in this gene with a
gentamicin resistance
cartridge. Briefly, the 5' and 3' flanking
regions of
ptxR were
amplified with the primer pair ptx247H
(5'-AGGAAGCTTGTCCAATACTTGAG-3',
harboring a
HindIII site) and ptx594X
(5'-AGGTCTAGATGATTCAATCGCTCC-3',
harboring an
XbaI site) or ptx1389K (5'-CCCGGTACCCCTCGGCGCGCTAC-3',
harboring a
KpnI site) and ptx1866E
(5'-GCGGAATTCCTGGCAACCCAGTTGC-3',
harboring an
EcoRI site), respectively. PCR was performed on chromosomal
PAO1 DNA with
Taq polymerase and 30 cycles of 1 min at
94°C, 1
min at 55°C, and 40 s at 72°C. The PCR fragments
were cloned into
pCRII-2.1 (Invitrogen) and sequenced by using M13
primers and
Sequenase (Amersham Life Science). The flanking regions
were directionally
transferred as 348-bp
HindIII-
XbaI and 478-bp
KpnI-
EcoRI fragments
into pUC-Gm which had
been previously obtained by placing a 1.7-kb
Gm
r cartridge
(
34) in the
SmaI site of the pUC18 polylinker
(
33).
The resulting plasmid,
pUC
ptxR::Gm, was linearized with
EcoRI
and ligated to
EcoRI-cut pSUP203
(
43), yielding pSUP
ptxR::Gm.
This
vector was then mobilized into
P. aeruginosa
PAO1 via triparental
mating (
50), with
E. coli HB101(pRK2013) as the helper strain.
Gm
r
transconjugants were isolated on BHI agar containing gentamicin
and Irgasan DP-300 (for counterselection). Individual colonies
were patched onto BHI agar containing tetracycline to screen for
loss
of the pSUP203 plasmid-borne tetracycline resistance gene,
and
candidate PAO1
ptxR::Gm mutants (Gm
r
Tc
s) were screened for the deletion by Southern blot
analysis (data
not
shown).
The riboprobes used for the RNase protection assays were generated
following PCR amplification of selected regions of the
genes of
interest and cloning of the PCR fragments into the pCRII
vector
(Invitrogen). RNA probes were then generated from these
cloned
fragments by runoff transcription from the T7 promoter
by using a
Riboprobe kit (Promega), and the RNase protection assay
was carried out
as described previously (
3). Autoradiographs
of the dried
gels were scanned and imported into Adobe Photoshop
(version 4.0), and
quantitative analysis was performed by using
NIH Image software
(version 1.55). The
pvcAB probe (bp 1567 to
2015), covers
350 bp of
pvcA, the
pvcA-pvcB intergenic region,
and 30 bp of
pvcB. The
pvcBC probe (bp 2640 to
3104) covers 180
bp of
pvcB, the
pvcB-pvcC
intergenic region, and 132 bp of
pvcC.
Finally, the
pvcCD probe (bp 3991 to 4367) covers 379 bp of
pvcC and 125 bp of
pvcD.
Identification and nucleotide sequence of the pvc
pyoverdine biosynthetic gene cluster.
The cloning of a 10.8-kb
ClaI-SacI DNA fragment of the 66- to 70-min
region of the P. aeruginosa PAO1 chromosome (in pPYP180), which carries a gene(s) involved in pyoverdine biosynthesis, was previously described (44). This DNA fragment promoted the
production of a pyoverdine chromophore-related fluorescent compound,
termed pseudoverdine, in pyoverdine-deficient strains of P. aeruginosa, suggesting a role in the biosynthesis of the
chromophore portion of the pyoverdine molecule (44). Almost
6 kb of the insert DNA present in pPYP180 was sequenced (deposited with
the GenBank databases under accession no. AF002222), revealing a set of
four open reading frames, designated pvcA, pvcB,
pvcC, and pvcD (where pvc stands for
pyoverdine chromophore), which comprise a putative operon. A fifth open
reading frame was identified downstream of and in the opposite
orientation to the pvcABCD genes (Fig.
1) and was subsequently identified as the
ptxR gene described by Hamood et al. (18). This
LysR family regulator is implicated in exotoxin A production
(18). Deletion of a 500-bp BglII fragment, now
known to encompass the 3' end of pvcC and the 5' end of
pvcD (Fig. 1), completely abrogated pyoverdine production
(44), confirming the involvement of the pvcABCD
operon in pyoverdine biosynthesis.
View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Physical map of the pvcABCD-ptxR region of
the P. aeruginosa PAO1 chromosome (A) and plasmid pPYP180
(B). Restriction mapping to the right of ptxR revealed
differences between pPYP180 and the chromosome, indicating that some
DNA rearrangement had occurred during the cloning of the pvc
locus.
|
|
The
pvcA gene encodes a putative protein (37,019 Da) similar
to the Dit1 protein of
Saccharomyces cerevisiae (Table
2) (
5).
Dit1 catalyzes the
formation of an uncharacterized tyrosine-containing
precursor for a
spore wall-specific dityrosine-containing macromolecule
(
5).
As such, PvcD may function in the condensation of tyrosine
and DAB, a
proposed step in pyoverdine biosynthesis (
6,
21).
The second
gene,
pvcB (876 bp), encodes a putative protein (33,165
Da)
exhibiting the greatest similarity to the TfdA proteins (oxygenases)
of
Alcaligenes eutrophus (
Ralstonia eutropha) JMP134
(
46) and
Burkholderia sp. strain RASC
(
47) (Table
2). The third gene,
pvcC (1,500 bp)
encodes a predicted product (55,812 Da) which
shows substantial
similarity to the
Klebsiella pneumoniae HpaA
and the
E. coli HpaB proteins (hydroxylases) (Table
2). It is
tempting to suggest, then, that PvcB and PvcC play roles in the
two
proposed hydroxylation steps of pyoverdine chromophore biosynthesis
(
6). Finally, the
pvcD gene (644 bp) encodes a
putative product
(23,076 Da) which exhibits similarity to proteins of
the cytochrome
c family (Table
2). The implied involvement
of a
c cytochrome
in pyoverdine production in
P. aeruginosa is reminiscent of an
earlier observation that a
cytochrome
c4 mutant of
Azotobacter vinelandii lost its capacity to produce azotobactin
(
45), a
pyoverdine-like siderophore. The recently described
cytochrome
c biogenesis protein CytA of
Pseudomonas
fluorescens ATCC 17400
also plays a role, hitherto unknown, in
pyoverdine production
in this organism (
15). Intriguingly, a
number of multicomponent
aromatic amino acid hydroxylases of mammalian
origin utilize components
of electron transport to carry out the
hydroxylation reaction
(
19), and PvcD may, therefore, assist
PvcBC-mediated hydroxylation.
Regulation of pvcABCD expression.
Pyoverdine
production is iron regulated, increasing inversely with the
concentration of external iron (25). To determine whether
pvcABCD expression was iron regulated, RNase protection assays using riboprobes derived from the pvc genes were
performed. By using a pvcAB riboprobe an mRNA fragment of
the expected size was protected in cells cultured under iron-limiting
conditions (Fig. 2). Expression of
pvc increased with time of growth in iron-limited medium,
showing a maximum at 10 h, at which time it was eightfold higher
in iron-limited cells than in iron-replete cells (Fig. 2). Similarly,
RNase protection assays with the pvcBC and pvcCD probes demonstrated that iron-limited cells expressed ca. 8- to 10-fold-higher levels of pvc mRNA than did their
iron-replete counterparts after 10 h of growth (Fig. 2). Assays
carried out with a riboprobe for a gene whose expression is known not
to be iron regulated, omlA (35) (see the legend
to Fig. 2) confirmed that differences seen with or without iron were
not attributable to variations in total RNA used in the assays above.
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 2.
RNase protection analysis of pvcABCD
expression in wild-type strain PAO1. RNA samples were extracted from
cells grown continuously for 6, 10, or 12 h in medium that was
either iron deficient ( ) or iron replete (+), and protection against
RNase digestion was afforded by the pvcAB, pvcBC,
or pvcCD probes assessed as described in Materials and
Methods. Undigested 32P-labelled probes (P) are also shown.
32P-labelled RNA standards are shown to the left of each
gel. The gels shown in this figure were exposed for 16 h. The
relative intensities (in parentheses) of the major band in each lane
were determined by using NIH Image software (version 1.55). Riboprobing
with omlA (not iron regulated) yielded protected fragments
with relative intensities of 155 (6 h, iron deficient), 155 (6 h, iron
replete), 175 (10 h, iron deficient), 173 (10 h, iron replete), 175 (12 h, iron deficient), and 190 (12 h, iron replete).
|
|
Although all probes used provided evidence of iron regulation of
pvcABCD expression, the levels of
pvc mRNA
protected declined
as the riboprobes used moved from the 5' end to the
3' end of
the operon. Indeed, levels protected by the
pvcBC
and
pvcCD probes
were only 60 and 20%, respectively, of
that protected by the
pvcAB probe (Fig.
2), indicating that
the
pvcCD genes were underrepresented
in the
pvc
mRNA population. Intriguingly, a sequence capable of
forming a
stem-loop structure was identified
(CGCCGGCCGGTGCGCGCCACGGCCGGCG;
G =
30.4 kcal) within the 51-bp intergenic
region between
pvcB and
pvcC. Given the absence
of an obvious promoter sequence in
this region, this likely has an
attenuating effect on expression
of the
pvcC and
pvcD genes from a promoter upstream of
pvcA.
Consistent
with this, the insertion of suicide vector pSUP202 sequences
between
wild-type copies of
pvcB and
pvcC in the
chromosome of
P. aeruginosa ML5087 (during an unsuccessful
attempt at constructing a
pvcB mutant) abrogated pyoverdine
biosynthesis, despite the fact that
the complete
pvcABCD
genes were present in this strain (data not
shown). The separation of
pvcCD from
pvcAB by pSUP202 sequences
likely
leads to a lack of
pvcCD expression, owing to the uncoupling
of the latter from the promoter upstream of
pvcA. Finally,
the
riboprobes used in this study invariably spanned portions of two
adjacent genes, and the fact that fragments of the expected size
were
protected in each case supports the contention that these
genes are
encoded on the same (i.e., polycistronic)
message.
Given the proximity of the
ptxR gene to the
pvcABCD operon it seemed possible that PtxR plays a role in
the expression of
pvcABCD and, thus, pyoverdine. Consistent
with this, a mutant
carrying a
ptxR deletion (K1081) was
examined for pyoverdine production.
K1081 lacked visible pyoverdine
(based on the pigmentation and
fluorescence of spent culture
supernatants). The involvement of
ptxR in
pvc
expression was confirmed by the RNase protection assay
with the
pvcAB probe. As seen in Fig.
3, the
ptxR deletion in
strain
PAO1 completely abrogated
pvc expression, with no
pvc mRNA
detected under iron-limited or iron-replete
conditions. Similar
results were observed when the
pvcCD
probe was used (data not
shown). Again, control experiments using
omlA as the riboprobe
confirmed that the decline in
pvc expression was not due to a
decrease in RNA (see the
legend to Fig.
3). Finally, constitutive
ptxR expression
from a multicopy plasmid (pPTX990) promoted high-level
pvc
expression, irrespective of iron availability in the growth
medium
(Fig.
4). Thus, PtxR activates
pvc gene expression, and
iron regulation of this putative
operon is not mediated at the
level of the
pvcABCD genes.
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3.
RNase protection analysis of pvcABCD gene
expression in the PAO1 parental strain (PAO1 WT) and PAO1 strains which
carry deletion mutations in the ptxR (PAO1
ptxR) or pvdS (PAO1 pvdS) genes.
RNA samples were extracted from cells grown continuously for 6, 10, or
12 h in medium that was either iron deficient () or iron replete
(+), and protection against RNase digestion was afforded by the
pvcAB probe assessed as described in Materials and Methods.
Undigested (P) and RNase treated (Probe only + RNase)
32P-labelled probes are also shown. The positions of
32P-labelled RNA standards (Std.) are shown to the left of
each gel. The gels shown in this figure were exposed for 16 h. The
relative intensity of the major band in each lane (in parentheses) was
determined by using NIH Image software (version 1.55). As no
pvcAB-protected fragment (400 to 500 bp range) was
observable in the PAO ptxR lanes, relative intensities
were not assessed. Riboprobing of total RNA from PAO1
ptxR with omlA (not iron regulated) yielded
protected fragments with relative intensities of 155 (6 h, iron
deficient), 158 (6 h, iron replete), 170 (10 h, iron deficient), 136 (10 h, iron replete), 176 (12 h, iron deficient), and 184 (12 h, iron
replete). Riboprobing of total RNA from PAO1 pvdS with
omlA yielded protected fragments with relative intensities
of 189 (6 h, iron deficient), 192 (6 h, iron replete), 174 (10 h, iron
deficient), 143 (10 h, iron replete), 175 (12 h, iron deficient), and
176 (12 h, iron replete).
|
|
View larger version (63K):
[in this window]
[in a new window]
|
FIG. 4.
RNase protection analysis of pvcABCD gene
expression in the PAO1 ptxR and PAO1 pvdS
strains harboring vectors pVLT31 and pVLT31::ptxR
(pPTX990). RNA samples were extracted from cells grown continuously for
6 or 10 h in medium that was either iron deficient () or iron
replete (+), and protection against RNase digestion was afforded by the
pvcCD probe assessed as described in Materials and Methods.
Results for the plasmid-free PAO1 wild-type strain are also shown.
Undigested (P) 32P-labelled probe and the positions of
32P-labelled RNA standards (Std.) are shown to the left of
each gel. The gels shown in this figure were exposed for 16 h.
|
|
The PvdS alternative sigma factor is required for expression of
pyoverdine biosynthetic genes of the
pvd locus (
10,
28).
To determine if PvdS was similarly required for
pvcABCD expression,
RNase protections assays were also
carried out with the
pvcAB probe and a
pvdS
deletion derivative of PAO1. As seen in Fig.
3, elimination of
pvdS reduced
pvc mRNA levels substantially (with
no effect on
omlA mRNA [see the legend to Fig.
3]),
although,
in contrast to the
ptxR mutant, some
pvc expression was still
detectable in the
pvdS
mutant and it was iron-regulated (twofold
increase in iron-limited
cells). Again, control assays run using
the
omlA riboprobe
did not show any variation related to iron
levels in the growth medium
(see the legend to Fig.
3), confirming
that this modest effect of iron
on
pvc expression was real. The
constitutively expressed
cloned
ptxR gene restored expression
of
pvcABCD
to high levels in the
pvdS deletion strain, indicating
that
PvdS does not act directly on
pvcABCD expression. This is
consistent with the absence of a putative PvdS binding site
(
39)
upstream of the
pvc genes and with the
recent demonstration that
PvdS acts on
ptxR (
49).
Thus, PtxR mediates the PvdS effect
on
pvcABCD expression.
This involvement of PvdS in
pvcABCD expression
also likely
explains the iron-regulation of
pvc expression, as
pvdS is iron-regulated by the Fur repressor (
26).
Still, the
observation that a
pvdS deletion yields
detectable, iron-regulated
pvc gene expression while a
ptxR deletion completely abrogates
pvc expression
suggests that some PtxR-mediated
pvc expression
can occur in
the absence of
pvdS and that it is still iron
regulated.
The
ptxR gene shown here to be linked to and involved in the
expression of the
pvcABCD operon and, hence, pyoverdine
production
was described previously (
18) and was shown to
play a positive
regulatory role in the expression of exotoxin A. Hamood
et al.
(
18) also indicated that the gene influenced
siderophore production,
an observation we have confirmed here. This
connection between
exotoxin A production and pyoverdine biosynthesis,
first suggested
by observations that PvdS plays a positive role in
expression
of exotoxin A (
34), is intriguing, although its
significance
is
unclear.
| |
ACKNOWLEDGMENTS |
We thank G. Seyer for technical assistance and A. N. Hamood
for providing strains and plasmids.
A.S. and J.-M.M acknowledge the financial support of the Association
Française de Lutte contre la Mucoviscidose. Work in K.P.'s
laboratory was supported by an operating grant from the Medical
Research Council of Canada. Work in M.L.V.'s laboratory was supported
by a grant (AI15940) from the National Institutes of Allergy and
Infectious Diseases. The Support of NATO in the form of a collaborative
research award to support travel between the laboratories of K.P. and
J.-M.M. is also gratefully acknowledged. A.S. is the recipient of an
EAITC (Academic Relations Division of Foreign Affairs and International
Trade Canada) fellowship. K.P. is a Natural Sciences and Engineering
Research Council University Research Fellow.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Queen's University, Kingston, Ontario,
Canada K7L 3N6. Phone: (613) 545-6677. Fax: (613) 545-6796. E-mail:
poolek{at}post.queensu.ca.
| |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1992.
Short protocols in molecular biology, 2nd ed.
John Wiley & Sons, Inc., New York, N.Y.
|
| 2.
|
Bagdasarian, M. M.,
E. Amann,
R. Lurz,
B. Rueckert, and M. Bagdasarian.
1983.
Activity of the hybrid trp-lac (tac) promoter of Escherichia coli in Pseudomonas putida. Construction of broad-host-range, controlled expression vectors.
Gene
26:273-282[Medline].
|
| 3.
|
Barton, H. A.,
Z. Johnson,
A. I. Vasil, and M. L. Vasil.
1996.
Ferric uptake regulator mutants of Pseudomonas aeruginosa with distinct alterations in the iron-dependent repression of exotoxin A and siderophores in aerobic and microaerobic environments.
Mol. Microbiol.
21:1001-1017[Medline].
|
| 4.
|
Berry, D., and A. M. Kropinski.
1986.
Effect of lipopolysaccharide mutations and temperature on plasmid transformation efficiency in Pseudomonas aeruginosa.
Can. J. Microbiol.
32:436-438[Medline].
|
| 5.
|
Briza, P.,
M. Eckerstorfer, and M. Breitenbach.
1994.
The sporulation-specific enzymes encoded by the DIT1 and DIT2 genes catalyze a two-step reaction leading to a soluble LL-dityrosine-containing precursor of the yeast spore wall.
Proc. Natl. Acad. Sci. USA
91:4524-4528[Abstract/Free Full Text].
|
| 6.
|
Budzikiewicz, H.
1993.
Secondary metabolites from fluorescent pseudomonads.
FEMS Microbiol. Rev.
104:209-228.
|
| 7.
|
Bullen, J. J.,
C. G. Ward, and S. N. Wallis.
1974.
Virulence and the role of iron in Pseudomonas aeruginosa infection.
Infect. Immun.
10:443-450[Abstract/Free Full Text].
|
| 8.
|
Cox, C. D.
1980.
Iron uptake with ferripyochelin and ferric citrate by Pseudomonas aeruginosa.
J. Bacteriol.
142:581-587[Abstract/Free Full Text].
|
| 9.
|
Cox, C. D., and P. Adams.
1985.
Siderophore activity of pyoverdin for Pseudomonas aeruginosa.
Infect. Immun.
48:130-138[Abstract/Free Full Text].
|
| 10.
|
Cunliffe, H. E.,
T. R. Merriman, and I. L. Lamont.
1995.
Cloning and characterization of pvdS, a gene required for pyoverdine synthesis in Pseudomonas aeruginosa: PvdS is probably an alternate sigma factor.
J. Bacteriol.
177:2744-2750[Abstract/Free Full Text].
|
| 11.
|
de Lorenzo, V.,
L. Eltis,
B. Kessler, and K. Timmis.
1993.
Analysis of Pseudomonas gene products using lacIq/Ptrp-lac plasmids and transposons that confer conditional phenotypes.
Gene
123:17-24[Medline].
|
| 12.
|
Fellay, R.,
J. Frey, and H. Krisch.
1987.
Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of Gram-negative bacteria.
Gene
52:147-154[Medline].
|
| 13.
|
Feng, D. F.,
M. S. Johnson, and R. F. Doolittle.
1985.
Aligning amino acid sequences: comparison of commonly used methods.
J. Mol. Evol.
21:112-125.
|
| 14.
|
Figurski, D. H., and E. R. Helinski.
1979.
Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans.
Proc. Natl. Acad. Sci. USA
76:1648-1652[Abstract/Free Full Text].
|
| 15.
|
Gaballa, A.,
N. Koedam, and P. Cornelis.
1996.
A cytochrome c biogenesis gene involved in pyoverdine production in Pseudomonas fluorescens ATCC 17400.
Mol. Microbiol.
21:777-785[Medline].
|
| 16.
|
Griffiths, E.
1987.
The iron-uptake systems of pathogenic bacteria, p. 69-137.
In
J. J. Bullen, and E. Griffiths (ed.), Iron and infection. John Wiley & Sons, New York, N.Y.
|
| 17.
|
Haas, B.,
J. Kraut,
J. Marks,
S. C. Zanker, and D. Castignetti.
1991.
Siderophore presence in sputa of cystic fibrosis patients.
Infect. Immun.
59:3997-4000[Abstract/Free Full Text].
|
| 18.
|
Hamood, A. N.,
J. A. Colmer,
U. A. Ochsner, and M. L. Vasil.
1996.
Isolation and characterization of a Pseudomonas aeruginosa gene, ptxR, which positively regulates exotoxin A production.
Mol. Microbiol.
21:97-110[Medline].
|
| 19.
|
Harayama, S., and M. Kok.
1992.
Functional and evolutionary relationships among diverse oxygenases.
Annu. Rev. Microbiol.
46:565-601[Medline].
|
| 20.
|
Hohnadel, D.,
D. Haas, and J.-M. Meyer.
1986.
Mapping of mutations affecting pyoverdine production in Pseudomonas aeruginosa.
FEMS Microbiol. Lett.
36:195-199.
|
| 21.
|
Jacques, P.,
M. Ongena,
I. Gwose,
D. Seinsche,
H. Schroeder,
P. Delfosse,
P. Thonart,
K. Taraz, and H. Budzikiewicz.
1995.
Structure and characterization of isopyoverdin from Pseudomonas putida BTP1 and its relation to the biogenetic pathway leading to pyoverdins.
Z. Naturforsch. Sect. C
50:622-629.
|
| 22.
|
King, E. O.,
M. K. Ward, and D. F. Raney.
1954.
Two simple media for the demonstration of pyocyanin and fluorescein.
J. Lab. Clin. Med.
44:301-307[Medline].
|
| 23.
|
Merriman, T. R.,
M. E. Merriman, and I. L. Lamont.
1995.
Nucleotide sequence of pvdD, a pyoverdine biosynthetic gene from Pseudomonas aeruginosa: PvdD has similarity to peptide synthetases.
J. Bacteriol.
177:252-258[Abstract/Free Full Text].
|
| 24.
|
Meyer, J.-M., and M. A. Abdallah.
1978.
The fluorescent pigment of Pseudomonas fluorescens: biosynthesis, purification and physiochemical properties.
J. Gen. Microbiol.
107:319-328.
|
| 25.
|
Meyer, J.-M.,
F. Halle,
D. Hohnadel,
P. Lemanceau, and H. Ratefiarivelo.
1987.
Siderophores of Pseudomonas biological properties, p. 189-205.
In
G. Winkelmann, D. van der Helm, and J. B. Neilands (ed.), Iron transport in microbes, plants and animals. VCH Verlagsgesellschaft mbH, Weinheim, Germany.
|
| 26.
|
Meyer, J.-M.,
D. Hohnadel, and F. Halle.
1989.
Cepabactin from Pseudomonas cepacia, a new type of siderophore.
J. Gen. Microbiol.
135:1479-1487[Abstract/Free Full Text].
|
| 27.
|
Meyer, J.-M.,
A. Neely,
A. Stintzi,
C. Georges, and I. A. Holder.
1996.
Pyoverdin is essential for virulence of Pseudomonas aeruginosa.
Infect. Immun.
64:518-523[Abstract].
|
| 28.
|
Miyazaki, H.,
H. Kato,
T. Nakazawa, and M. Tsuda.
1995.
A positive regulatory gene, pvdS, for expression of pyoverdin biosynthetic genes in Pseudomonas aeruginosa PAO.
Mol. Gen. Genet.
248:17-24[Medline].
|
| 29.
|
Needleman, S. B., and C. D. Wunsch.
1970.
A general method applicable to the search for similarities in the amino acid sequence of two proteins.
J. Mol. Biol.
48:443-453[Medline].
|
| 30.
|
Neilands, J. B.
1981.
Iron absorption and transport in microorganisms.
Annu. Rev. Nutr.
1:27-46[Medline].
|
| 31.
|
Neilands, J. B.
1981.
Microbial iron compounds.
Annu. Rev. Biochem.
50:715-731[Medline].
|
| 32.
|
Neilands, J. B.,
K. Konopka,
B. Schwyn,
M. Coy,
R. T. Francis,
B. H. Paw, and A. Bagg.
1987.
Comparative biochemistry of microbial iron assimilation, p. 3-33.
In
G. Winkelmann, D. van der Helm, and J. B. Neilands (ed.), Iron transport in microbes, plants and animals. VCH Verlagsgesellschaft mbH, Weinheim, Germany.
|
| 33.
| Ochsner, U. 1999. Unpublished data.
|
| 34.
|
Ochsner, U. A.,
Z. Johnson,
I. L. Lamont,
H. E. Cunliffe, and M. L. Vasil.
1996.
Exotoxin A production in Pseudomonas aeruginosa requires the iron-regulated pvdS gene encoding an alternative sigma factor.
Mol. Microbiol.
21:1019-1028[Medline].
|
| 35.
|
Ochsner, U. A.,
A. I. Vasil,
Z. Johnson, and M. L. Vasil.
1998.
Pseudomonas aeruginosa fur overlaps with a gene encoding a novel outer membrane lipoprotein, OmlA.
J. Bacteriol.
181:1099-1109[Abstract/Free Full Text].
|
| 36.
|
Okii, M.,
S. Iyobe, and S. Mitsuhashi.
1983.
Mapping of the gene specifying aminoglycoside 3'-phosphotransferase II on the Pseudomonas aeruginosa chromosome.
J. Bacteriol.
155:643-649[Abstract/Free Full Text].
|
| 37.
|
Poole, K.,
D. E. Heinrichs, and S. Neshat.
1993.
Cloning and sequence analysis of an EnvCD homologue in Pseudomonas aeruginosa: regulation by iron and possible involvement in the secretion of the siderophore pyoverdine.
Mol. Microbiol.
10:529-544[Medline].
|
| 38.
|
Poole, K.,
Q. Zhao,
S. Neshat,
D. E. Heinrichs, and C. R. Dean.
1996.
The tonB gene of Pseudomonas aeruginosa encodes a novel TonB protein.
Microbiology
142:1449-1458[Abstract/Free Full Text].
|
| 39.
|
Rombel, I. T.,
B. J. McMorran, and I. L. Lamont.
1995.
Identification of a DNA sequence motif required for expression of iron-regulated genes in pseudomonads.
Mol. Gen. Genet.
246:519-528[Medline].
|
| 40.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 41.
|
Sawatzki, G.
1987.
The role of iron binding proteins in bacterial infection, p. 477-489.
In
G. Winkelmann, D. van der Helm, and J. B. Neilands (ed.), Iron transport in microbes, plants and animals. VCH Verlagsgesellschaft mbH, Weinheim, Germany.
|
| 42.
|
Schaefer, A.,
A. Tauch,
W. Jaeger,
J. Kalinowski,
G. Thierbach, and A. Puehler.
1994.
Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum.
Gene
145:69-73[Medline].
|
| 43.
|
Simon, R.,
U. Priefer, and A. Puehler.
1983.
A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria.
Bio/Technology
1:784-791.
|
| 44.
|
Stintzi, A.,
P. Cornelis,
D. Hohnadel,
J.-M. Meyer,
C. Dean,
K. Poole,
S. Kourambas, and V. Krishnapillai.
1996.
Novel pyoverdine biosynthesis gene(s) of Pseudomonas aeruginosa PAO.
Microbiology
142:1181-1190[Abstract/Free Full Text].
|
| 45.
| Stintzi, A., and J.-M. Meyer. 1997. Unpublished results.
|
| 46.
|
Streber, W. R.,
K. N. Timmis, and M. H. Zenk.
1987.
Analysis, cloning, and high-level expression of 2,4-dichlorophenoxyacetate monooxygenase gene tfdA of Alcaligenes eutrophus JMP134.
J. Bacteriol.
169:2950-2955[Abstract/Free Full Text].
|
| 47.
|
Suwa, Y.,
A. D. Wright,
F. Fukimori,
K. A. Nummy,
R. P. Hausinger,
W. E. Holben, and L. J. Forney.
1996.
Characterization of a chromosomally encoded 2,4-dichlorophenoxyacetic acid/ -ketoglutarate dioxygenase from Burkholderia sp. strain RASC.
Appl. Environ. Microbiol.
62:2464-2469[Abstract].
|
| 48.
|
Tsuda, M.,
H. Miyazaki, and T. Nakazawa.
1995.
Genetic and physical mapping of genes involved in pyoverdin production in Pseudomonas aeruginosa PAO.
J. Bacteriol.
177:423-431[Abstract/Free Full Text].
|
| 49.
|
Vasil, M. L.,
U. A. Ochsner,
Z. Johnson,
J. A. Colmer, and A. N. Hamood.
1998.
The Fur-regulated gene encoding the alternative sigma factor, PvdS, is required for the iron-dependent expression of the LysR-type regulator, PtxR, in Pseudomonas aeruginosa.
J. Bacteriol.
180:6784-6788[Abstract/Free Full Text].
|
| 50.
|
Zhao, Q.,
X.-Z. Li,
A. Mistry,
R. Srikumar,
L. Zhang,
O. Lomovskaya, and K. Poole.
1998.
Influence of the TonB energy-coupling protein on efflux-mediated multidrug resistance in Pseudomonas aeruginosa.
Antimicrob. Agents Chemother.
42:2225-2231[Abstract/Free Full Text].
|
Journal of Bacteriology, July 1999, p. 4118-4124, Vol. 181, No. 13
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Clarke-Pearson, M. F., Brady, S. F.
(2008). Paerucumarin, a New Metabolite Produced by the pvc Gene Cluster from Pseudomonas aeruginosa. J. Bacteriol.
190: 6927-6930
[Abstract]
[Full Text]
-
Ettema, T. J. G., Andersson, S. G. E.
(2008). Comment on "A 3-Hydroxypropionate/4-Hydroxybutyrate Autotrophic Carbon Dioxide Assimilation Pathway in Archaea". Science
321: 342b-342b
[Abstract]
[Full Text]
-
Hindre, T., Bruggemann, H., Buchrieser, C., Hechard, Y.
(2008). Transcriptional profiling of Legionella pneumophila biofilm cells and the influence of iron on biofilm formation. Microbiology
154: 30-41
[Abstract]
[Full Text]
-
Gaines, J. M., Carty, N. L., Tiburzi, F., Davinic, M., Visca, P., Colmer-Hamood, J. A., Hamood, A. N.
(2007). Regulation of the Pseudomonas aeruginosa toxA, regA and ptxR genes by the iron-starvation sigma factor PvdS under reduced levels of oxygen. Microbiology
153: 4219-4233
[Abstract]
[Full Text]
-
Drake, E. J., Cao, J., Qu, J., Shah, M. B., Straubinger, R. M., Gulick, A. M.
(2007). The 1.8 A Crystal Structure of PA2412, an MbtH-like Protein from the Pyoverdine Cluster of Pseudomonas aeruginosa. J. Biol. Chem.
282: 20425-20434
[Abstract]
[Full Text]
-
Lamont, I. L., Martin, L. W., Sims, T., Scott, A., Wallace, M.
(2006). Characterization of a Gene Encoding an Acetylase Required for Pyoverdine Synthesis in Pseudomonas aeruginosa.. J. Bacteriol.
188: 3149-3152
[Abstract]
[Full Text]
-
Allard, K. A., Viswanathan, V. K., Cianciotto, N. P.
(2006). lbtA and lbtB Are Required for Production of the Legionella pneumophila Siderophore Legiobactin. J. Bacteriol.
188: 1351-1363
[Abstract]
[Full Text]
-
Kazmierczak, M. J., Wiedmann, M., Boor, K. J.
(2005). Alternative Sigma Factors and Their Roles in Bacterial Virulence. Microbiol. Mol. Biol. Rev.
69: 527-543
[Abstract]
[Full Text]
-
Redly, G. A., Poole, K.
(2005). FpvIR Control of fpvA Ferric Pyoverdine Receptor Gene Expression in Pseudomonas aeruginosa: Demonstration of an Interaction between FpvI and FpvR and Identification of Mutations in Each Compromising This Interaction. J. Bacteriol.
187: 5648-5657
[Abstract]
[Full Text]
-
Gisi, M. R., Xun, L.
(2003). Characterization of Chlorophenol 4-Monooxygenase (TftD) and NADH:Flavin Adenine Dinucleotide Oxidoreductase (TftC) of Burkholderia cepacia AC1100. J. Bacteriol.
185: 2786-2792
[Abstract]
[Full Text]
-
Lamont, I. L., Martin, L. W.
(2003). Identification and characterization of novel pyoverdine synthesis genes in Pseudomonas aeruginosa. Microbiology
149: 833-842
[Abstract]
[Full Text]
-
Redly, G. A., Poole, K.
(2003). Pyoverdine-Mediated Regulation of FpvA Synthesis in Pseudomonas aeruginosa: Involvement of a Probable Extracytoplasmic-Function Sigma Factor, FpvI. J. Bacteriol.
185: 1261-1265
[Abstract]
[Full Text]
-
Hunt, T. A., Peng, W.-T., Loubens, I., Storey, D. G.
(2002). The Pseudomonas aeruginosa alternative sigma factor PvdS controls exotoxin A expression and is expressed in lung infections associated with cystic fibrosis. Microbiology
148: 3183-3193
[Abstract]
[Full Text]
-
Shen, J., Meldrum, A., Poole, K.
(2002). FpvA Receptor Involvement in Pyoverdine Biosynthesis in Pseudomonas aeruginosa. J. Bacteriol.
184: 3268-3275
[Abstract]
[Full Text]
-
Wilderman, P. J., Vasil, A. I., Johnson, Z., Wilson, M. J., Cunliffe, H. E., Lamont, I. L., Vasil, M. L.
(2001). Characterization of an Endoprotease (PrpL) Encoded by a PvdS-Regulated Gene in Pseudomonas aeruginosa. Infect. Immun.
69: 5385-5394
[Abstract]
[Full Text]
-
McMorran, B. J., Kumara, H. M. C. S., Sullivan, K., Lamont, I. L.
(2001). Involvement of a transformylase enzyme in siderophore synthesis in Pseudomonas aeruginosa. Microbiology
147: 1517-1524
[Abstract]
[Full Text]
-
Wilson, M. J., McMorran, B. J., Lamont, I. L.
(2001). Analysis of Promoters Recognized by PvdS, an Extracytoplasmic-Function Sigma Factor Protein from Pseudomonas aeruginosa. J. Bacteriol.
183: 2151-2155
[Abstract]
[Full Text]
-
Delaney, S. M., Mavrodi, D. V., Bonsall, R. F., Thomashow, L. S.
(2001). phzO, a Gene for Biosynthesis of 2-Hydroxylated Phenazine Compounds in Pseudomonas aureofaciens 30-84. J. Bacteriol.
183: 318-327
[Abstract]
[Full Text]
-
Ffrench-Constant, R. H., Waterfield, N., Burland, V., Perna, N. T., Daborn, P. J., Bowen, D., Blattner, F. R.
(2000). A Genomic Sample Sequence of the Entomopathogenic Bacterium Photorhabdus luminescens W14: Potential Implications for Virulence. Appl. Environ. Microbiol.
66: 3310-3329
[Abstract]
[Full Text]
Top
Abstract
Text
