Previous Article | Next Article 
Journal of Bacteriology, August 1999, p. 4476-4484, Vol. 181, No. 15
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Role of TolR N-Terminal, Central, and C-Terminal
Domains in Dimerization and Interaction with TolA and TolQ
Laure
Journet,
Alain
Rigal,
Claude
Lazdunski, and
Hélène
Bénédetti*
Laboratoire d'Ingénierie des
Systèmes Macromoléculaires, Institut de Biologie
Structurale et Microbiologie, Centre National de la Recherche
Scientifique, 13402 Marseille Cedex 20, France
Received 1 March 1999/Accepted 18 May 1999
 |
ABSTRACT |
The Tol-PAL system of Escherichia coli is a
multiprotein system involved in maintaining the cell envelope integrity
and is necessary for the import of some colicins and phage DNA into the bacterium. It is organized into two complexes, one near the outer membrane between TolB and PAL and one in the cytoplasmic membrane between TolA, TolQ, and TolR. In the cytoplasmic membrane, all of the
Tol proteins have been shown to interact with each other. Cross-linking
experiments have shown that the TolA transmembrane domain interacts
with TolQ and TolR. Suppressor mutant analyses have localized the
TolQ-TolA interaction to the first transmembrane domain of TolQ and
have shown that the third transmembrane domain of TolQ interacts with
the transmembrane domain of TolR. To get insights on the composition of
the cytoplasmic membrane complex and its possible contacts with the
outer membrane complex, we focused our attention on TolR. Cross-linking
and immunoprecipitation experiments allowed the identification of Tol
proteins interacting with TolR. The interactions of TolR with TolA and
TolQ were confirmed, TolR was shown to dimerize, and the resulting
dimer was shown to interact with TolQ. Deletion mutants of TolR were
constructed, and they allowed us to determine the TolR domains involved
in each interaction. The TolR transmembrane domain was shown to be involved in the TolA-TolR and TolQ-TolR interactions, while TolR central and C-terminal domains appeared to be involved in TolR dimerization. The role of the TolR C-terminal domain in the TolA-TolR interaction and its association with the membranes was also
demonstrated. Furthermore, phenotypic studies clearly showed that the
three TolR domains (N terminal, central, and C terminal) and the level of TolR production are important for colicin A import and for the
maintenance of cell envelope integrity.
 |
INTRODUCTION |
The Tol-PAL system of
Escherichia coli is composed of six proteins localized in
the cell envelope (TolQ, TolR, TolA, TolB, PAL, and Orf2) and one
cytoplasmic protein, Orf1. These proteins are encoded by clustered
genes organized in two operons (54). One operon encodes
Orf1, TolQ, TolR, and TolA proteins, which, except Orf1, are localized
in the inner membrane. The other operon encodes TolB and Orf2, two
periplasmic proteins, and PAL, a lipoprotein of the outer membrane (for
reviews, see references 2 and
37). A series of experiments, including
cross-linking with formaldehyde, coimmunoprecipitations, and suppressor
mutant analysis, have shown that the Tol-PAL complex is organized into
two complexes: one in the inner membrane between TolA, TolQ, and TolR
and one associated with the outer membrane between TolB, PAL, Orf2, and
two proteins of the outer membrane, Lpp and OmpA. In the inner membrane
complex, the three Tol proteins appear to interact with each other via their transmembrane domains. The TolA transmembrane domain interacts with the first transmembrane domain of TolQ (18, 22) and
with TolR (18), while the third transmembrane domain of TolQ
interacts with the transmembrane domain of TolR (39). The
C-terminal domain of TolR also seems to play a role in the TolQ-TolR
interaction, and the first and third transmembrane domains of TolQ seem
to be in close contact (39). At the level of the outer
membrane, TolB interacts with PAL (5) but also with Lpp and
OmpA (14). PAL also interacts with OmpA (14).
There is no direct evidence of interactions between the inner membrane
and outer membrane complexes; however, the localization of Tol proteins
in contact sites between the inner and outer membranes (25)
supports this hypothesis. The Tol-PAL system appears to be conserved in
many gram-negative bacteria, including Haemophilus
influenzae (17), Brucella abortus
(52), Pseudomonas putida (46), and
Pseudomonas aeruginosa (41), suggesting that its
physiological role is important. Furthermore, tol-pal
mutants have been shown to be hypersensitive to drugs and detergents
(16), to release periplasmic proteins (20), and
to form vesicules (3). Although the diversity of these
phenotypes supports a role for the Tol-PAL system in maintaining cell
envelope integrity, it does not allow us to precisely define its
physiological function. Recently, the finding that TolA and TolB
interact with porins in vitro and in the presence of sodium dodecyl
sulfate (SDS) has suggested that the Tol-PAL system might play a role
in porin biogenesis or in porin activity (19, 45). On the
other hand, the existence of an interaction network among TolB, PAL,
OmpA, Lpp, and peptidoglycan favors a structural role of the Tol-PAL
system in anchoring the inner and outer membranes to peptidoglycan
(14). Tol proteins have been parasitized to permit group A
colicins (A, E, and K) and single-stranded phage DNA (M13, fd, and f1)
to be transported through the outer membrane (2, 16).
Another system, composed of TonB, ExbB, and ExbD, is involved in the
import of group B colicins (B, D, I, and M) and phage DNA (T1 and
80) (2, 15). Its physiological role consists of the
active transport of iron siderophores and vitamin B12
across the outer membrane (for a review, see reference
32). The TonB system is thought to couple the proton
motive force of the inner membrane to these transport processes
(8, 44) by gating the siderophores and vitamin
B12 receptors located in the outer membrane (31,
47). This gating may be induced by TonB, which interacts with
siderophores and vitamin B12 receptors. ExbB and ExbD are
homologous to TolQ and TolR, respectively, and share some functional
reactivity (9, 10, 34). TonB and TolA transmembrane domains
also exhibit some homology, while the remaining parts of both proteins
have an extended conformation in the periplasm but no sequence
homology. Like the Tol proteins of the inner membrane, the proteins of
the TonB system interact with each other. TonB interacts with ExbB and
ExbD via its transmembrane domain (30, 33, 36, 50), and ExbB
and ExbD interact with each other (11, 33). TonB has been
shown to oscillate between a high-affinity association with the outer
membrane (probably via interactions with the receptors) and a
high-affinity association with the inner membrane (probably via
interactions with ExbB and -D) (40). This cycling might be
the key to the mechanism of energy transduction, allowing the gating of
the receptors and the pumping of the ligand in the periplasm. Recently,
Higgs et al. (26) have shown that ExbB and ExbD form trimers
in the inner membrane, suggesting that these proteins might form a
heterohexamer, which would have implications for the mechanism of
energy transduction.
Since the transmembrane domains of the inner membrane Tol proteins are
homologous to those of the proteins of the TonB system, the
organizations of the two systems in the inner membrane might be
similar. We also wondered if we could demonstrate an interaction linking the inner membrane Tol complex to the outer
membrane-associated Tol complex. Therefore, we focused our
attention on TolR to answer these questions. Cross-linking and
immunoprecipitation experiments were performed, and cross-linked
complexes containing TolR were identified. The regions of TolR involved
in the formation of these complexes were also determined.
(Some of these results were first presented at the Colicins and Other
Bacteriocins European Molecular Biology Organization workshop
(University of East Anglia) in April 1998.)
 |
MATERIALS AND METHODS |
Strains and media.
The strains used are listed in Table
1. They were grown at 37°C on
Luria-Bertani agar plates, in liquid Luria-Bertani medium (42), or in M9 minimal medium (42) containing all
amino acids except Cys and Met for specific radiolabelling experiments.
The plasmids were maintained with ampicillin (100 µg · ml
1), tetracycline (12.5 µg · ml
1), kanamycin (50 µg · ml
1), or
chloramphenicol (30 µg · ml
1).
Plasmids.
All the plasmids used are listed in Table 1.
pBPAII was constructed as pBP (5), except that the PCR
fragment encoding PAL, which was amplified from total cells and
digested by AseI and BsaI, was introduced into
the pOQRAB plasmid opened with the same sites.
The DNA fragments encoding the different TolR derivatives were
amplified from the pBPAII plasmid by PCR. For each TolR derivative,
the
oligonucleotides used were designed so as to place restriction
sites
upstream and downstream of the amplified fragment in order
to allow the
in-frame fusions of the resulting fragments in the
different vectors.
Oligonucleotides TolR1 (5'GCCATGGAATTCGAGGTCGATCTGCCAGAC3')
and TolR2 (5'CTTAAGCTTGATAGGCTGCGTCAT3') allowed us to
obtain
a DNA fragment encoding domains II and III of TolR and flanked
on the 5' side by the
NcoI and
EcoRI sites and on
the 3' side
by the
HindIII and
AflII sites.
This fragment was digested with
NcoI/
HindIII
and was ligated between the same sites in pET-22
b(+) to create
pETRII-III. To obtain pINRII-III, the same fragment
was digested by
EcoRI/
HindIII and ligated in the same
sites of
pIN-III-
ompA-2 (
23). Oligonucleotides
TolR3 (5'TGCTGCAGGCGCCAGAGCGCGT3')
and TolR4
(5'TGCTGCAGGCTTAGATAGGCTGCGT3') allowed the amplification
of
a fragment encoding the entire TolR (except its start codon)
and placed
a
PstI site upstream and downstream of the coding sequence.
After digestion with
PstI, the fragment was ligated into the
pART3
plasmid (
18) opened with the same site to create the
pARTR plasmid.
The pARTR207 plasmid was constructed along the same
lines, but
the matrix used for amplification was the pOQ925R207A
plasmid
instead of pBPAII. The DNA fragment encoding TolRI-II was
amplified
with oligonucleotides TolR3 and TolR5.1
(5'CACTGCAGAAGCTTTTAGTAAGGCACATCTTT3').
TolR5.1 introduced a
stop codon after residue 117 and the
HindIII
and
PstI sites 3' of the coding sequence. pARTRI-II was obtained
by ligating this fragment digested with
PstI into the pART3
plasmid
opened with the same site. The DNA fragment encoding TolRII was
amplified by using oligonucleotides TolR1 and TolR5.1. The fragment
obtained was then digested with
EcoRI/
HindIII and ligated into
pIN-III-
ompA-2 opened with the same sites to create pINRII.
Other
fragments encoding TolRII and TolRII

108-117 were amplified by
using oligonucleotides TolR1 and TolR5.2
(5'CACTGCAGAAGCTTGTAAGGCACATCTTT3')
and oligonucleotides
TolR1 and TolR6 (5'GTAAGCTTAAAGACCGTTTTCGG3'),
respectively.
TolR5.2 and TolR6 introduced the
HindIII site 3'
of the
TolRII and TolRII

108-117 coding sequence, respectively.
The
fragments obtained were then digested with
NcoI/
HindIII and
ligated into pET-22 b(+)
opened with the same sites to create
pETRII and pETRII

108-117,
respectively. pINRII-IIIM was obtained
by ligating the
BamHI/
BglII fragment of pINRII-III, encoding
TolRII-III,
into the pACY177 vector opened with the same sites. A DNA
fragment
encoding domain III of TolR was obtained by using the
oligonucleotides
TolR7
(5'GCCATGGAAGTGGACGGAATTCTGATCGGTGGCGCAAA3') and
TolR2.
TolR7 allows the amplification of a fragment that encodes domain III of
TolR but also the first three residues (residues 44
to 46) and the last
nine residues (residues 108 to 117) of TolR
domain II separated by two
residues (Gly and Ile) encoded by an
EcoRI site introduced
for easier screening. TolR7 also introduces
an
NcoI site 5'
of the coding sequence. The resulting fragment
was digested by
NcoI/
HindIII and ligated into pET-22 b(+)
opened
with the same sites to create pETRIII. pBSKR and pBSKR207 were
obtained by inserting the
EcoRI/
HindIII
fragment of pARTR and
pARTR207 (encoding TolR and TolR207) into the
pBSK

plasmid opened with the same sites.
PBSK

and pART3 have compatible replication
origins, and pBSK

is a higher-copy-number plasmid than
pART3.
Antibodies.
The antiserum directed against TolR (AbTolR) was
raised in a rabbit by using purified TolRII-III-His protein. Three
injections of purified TolRII-III-His protein (300 µg) in
phosphate-buffered saline mixed with Freund's adjuvant were
given over a period of 40 days. Using defined amounts of purified
TolRII-His and TolRII-III-His, we could determine that for the same
amount of both proteins, AbTolR gives a three-times-stronger signal for
TolRII-III than for TolRII. To lower the background of the AbTolR
antiserum, it was absorbed against crude tolR cell extracts
(TPS300) as previously described (5). Antisera directed
against TolA (AbTolA) (18), TolB (45), PAL
(5), and the monoclonal antibodies (MAbs) directed against
colicin A (MAb 1C11) (13) have been described previously.
The antiserum directed against LexA was a gift of R. Lloubès. All
of the antisera were used at 1/500 dilution except MAb 1C11 (1/1,000).
Colicin sensitivity tests.
Cell sensitivity to colicin A was
tested in liquid medium as described previously (6, 12, 21).
Before their sensitivity to colicin A was tested, W3110 cells
transformed with pINRII-III, pINRII, and pIN-III-ompA-2
(pIN2) were induced for 30 min with 100 µM IPTG
(isopropyl-
-D-thiogalactopyranoside) and W3110 cells transformed with pBSKR, pBSKRI-II, and pART3 were induced for 2 h
with 0.5 mg of arabinose/ml.
Assays of outer membrane leakage.
The leakiness of wild-type
cells overproducing TolR and TolR derivatives was assessed by testing
on plates, as described by Lazzaroni and Portalier (38), the
release of RNase in the extracellular medium. W3110(pINRII-III),
W3110(pINRII), and W3110(pIN2) cells were induced with IPTG (10 µM),
while W3110(pBSKR), W3110(pBSKRI-II), and W3110(pART3) were induced
with arabinose (0.2 mg/ml). As a control for cell lysis, the release of
a cytoplasmic protein marker was checked on these strains by measuring
the
-galactosidase activity in the extracellular medium
(42) upon culture in liquid medium and after the same
inductions as for the colicin sensitivity tests.
Purification of TolR derivatives tagged with six histidines.
A 1-liter culture of BL21(DE3) cells transformed with pETRII-III,
pETRII, or pETRIII plasmids (optical density at 600 nm
[OD600], 1) was induced for 1.5 h with IPTG (50 µM). The cells were harvested and resuspended in 20 ml of 50 mM
sodium phosphate buffer, pH 8, containing 50 mM NaCl. The
purification of TolRII-III-His, TolRII-His, and TolRIII-His
was then performed as previously described for TolB-His
(45). TolRIII-His became undetectable after purification even when it was performed in the presence of protease inhibitor cocktail (Sigma) at 4°C. TolRII-III-His and TolRII-His were about 90% pure, but TolRII-III-His was detected as two bands of similar molecular mass. Both preparations were concentrated at 1 mg/ml in 50 mM
sodium phosphate buffer, pH 8.
In vivo and in vitro cross-linking with formaldehyde.
In
vivo cross-linking experiments with formaldehyde were performed
directly on whole cells for 20 min as previously described by Bouveret
et al. (5). The production of TolR derivatives or EpTolQ was
induced (as described in the figure legends) before the cross-linkings
were carried out. In vitro cross-linking experiments were carried out
with 10 µg of TolRII-III-His and 10 µg of TolRII-His in a 50-µl
volume. After 20 min at room temperature in the presence of 1%
formaldehyde, cross-linking was stopped by adding 10 mM Tris (pH 6.8)
and incubating the mixture for 15 min. Sample buffer was added, and the
samples were heated for 30 min at 37°C before being analyzed by
SDS-polyacrylamide gel electrophoresis (PAGE) and Western blotting.
Immunoprecipitation of cells producing EpTolQ and TolR
derivatives with the 1C11 MAbs.
A 100-ml culture of TPS13(pEpTolQ)
cells transformed with pINRII-IIIM, pARTR, or pARTRI-II plasmids
was induced for 2.5 h with mitomycin C (300 µg/ml)
(OD600, 0.7). The cells transformed with pINRII-IIIM were
also induced for 30 min with IPTG (50 µM), and the cells transformed
with pARTR and pARTRI-II were induced for 2.5 h with arabinose
(0.5 mg/ml). Half of the cultures were treated for 20 min with
formaldehyde at room temperature. The cells, treated with formaldehyde
or untreated, were then converted into spheroplasts and lysed by four
freeze-thaw cycles, and 2% Triton X-100 was added to solubilize the
membranes (under vigorous agitation for 2 h at 4°C) as described
previously (5). After centrifugation at 105,000 × g for 30 min, the soluble material was immunoprecipitated by
adding Affi-gel 10 beads (Bio-Rad) coupled to 1C11 antibodies in
phosphate-buffered saline buffer (10 µl for 2 OD600
units). After overnight incubation at 4°C and two washes with 150 mM
phosphate buffer (pH 7.0) containing 1% Triton X-100 and 0.5% sodium
deoxycholate and then with 10 mM Tris, pH 7.5, the immunoprecipitates
obtained were dissociated from the beads by adding sample buffer (15 µl per 10 µl of beads) and heating for 2 min at 96°C. Samples
were then analyzed by SDS-PAGE and Western blotting.
Specific radiolabelling of TolRIII-His.
BL21(pETRIII) cells
were grown in M9 minimal medium at 37°C (OD600, 0.3) and
were then induced for 15 min with 100 µM IPTG. Rifampin (0.2 mg/ml)
was then added, and after 15 min of incubation, 1 µl of
[35S]methionine/ml of culture (10 µCi/µl) was
added. After a 2-min pulse, a chase was performed with cold
methionine (0.5 mg/ml) for 3 min, and protein synthesis was
stopped by cooling the mixture at 4°C and harvesting the cells.
Fractionations.
TolRII-III, TolRII, and TolRIII-His (after
labelling) localization was assessed by cell fractionation as described
previously (6, 7). Briefly, a pellet of exponentially
growing cells was resuspended in 10 mM Tris (pH 6.8)-20% sucrose and
incubated for 10 min at 0°C after 100 µg of lysozyme per ml and 0.5 mM EDTA were added. Spheroplasts were pelleted and washed with 10 mM
Tris-20% sucrose and subjected to five freeze-thaw cycles. Membranes
and cytoplasm were separated after 30 min of centrifugation at
105 × g. Periplasmic, cytoplasmic, and
membrane fractions were precipitated with 20% trichloroacetic acid and
analyzed by Western blotting with the AbTolR antiserum (for TolRII-III
and TolRII) and autoradiography (for TolRIII-His). Protein markers of
different compartments (TolB for the periplasm and membranes, LexA for
the cytoplasm, and TolA for the membranes) were detected in the
corresponding fractions.
A sucrose gradient fractionation was performed on W3110(pINRII-III) and
W3110(pINRII) cells. A 100-ml culture of these cells
was induced for 30 min with 50 and 100 µM IPTG, respectively.
After being harvested, the
cells were resuspended at an OD
600 of 50 in 1.3 ml of 10 mM
HEPES (pH 7.4)-20% sucrose with RNase
and DNase (10 µg/ml each) and
broken in a French pressure cell.
The membranes were collected after a
passage on a two-step sucrose
gradient (SG0) and were then subjected to
a multistep sucrose
gradient (SG1) (
28). The fractions were
analyzed by Western
blotting with the AbTolR antiserum and the antisera
directed against
TolA, PAL, and TolB. It should be noted that TolA,
TolR, and TolB
proteins have been shown to be enriched in contact sites
(
25).
Miscellaneous.
Standard methods were used for DNA
manipulations (48). PCR amplifications were performed as
described by Ho et al. (27), and DNA sequences were
determined by the method of Sanger et al. (49) with the
Sequenase 2.0 sequencing kit (U.S. Biochemicals). SDS-PAGE,
electrotransfer onto nitrocellulose membranes, and Western blot
analysis were performed as previously described (24, 35, 53).
 |
RESULTS |
TolR and TolQ can be cross-linked in vivo.
In an attempt to
characterize all the interactions between TolR and the other Tol
proteins, an antiserum directed against TolR was raised and in vivo
cross-linking experiments with formaldehyde were performed. The
antiserum was raised against a TolR derivative protein with its
cytoplasmic and transmembrane domains (amino acids 1 to 43) deleted and
tagged with a six-His motif for easier purification (TolRII-III-His).
The antiserum obtained (AbTolR) revealed two nonspecific bands at 30 and 75 kDa in total bacterial extracts. After adsorption of the
antiserum on tolR cell extracts (TPS300), the 30-kDa band
was no longer recognized. Upon cross-linking of wild-type cells
overproducing Orf1 (with a theoretical molecular mass of 14.7 kDa),
TolQ (25.5 kDa), TolR (15.5 kDa but migrating at 19 kDa), TolA (44.2 kDa), TolB (47.3 kDa), and PAL (19 kDa) proteins [GM1(pBPAII)], four
major cross-linked products were revealed by the adsorbed AbTolR
antiserum after Western blotting (Fig.
1). Two complexes had very similar
molecular masses at 38 and 38.5 kDa; the other two migrate at 65 and 70 kDa.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 1.
TolR is involved in four specific cross-linked
complexes. Strain GM1 carrying plasmid pBPAII (which encodes Orf1,
TolQ, TolR, TolA, TolB, and PAL), strain TPS13 carrying the pARTR
plasmid (encoding a TolR derivative with three unrelated residues), or
carrying pARTR and pQA plasmids (the latter encoding TolQ and TolA)
were cross-linked for 20 min in the presence of 1% formaldehyde as
described in Materials and Methods. TolR production from pARTR was
induced for 2 h with 0.5 mg of arabinose/ml prior to
cross-linking. Extracts of cells treated (F) or not treated (C) with
formaldehyde were analyzed by immunoblotting of an SDS-7.5% PAGE gel
with the AbTolR adsorbed antiserum and the AbTolA antiserum. The
Western blot was visualized by the peroxidase colorimetric method. A
total of 0.3 OD600 units of each cell extract was loaded.
The positions of the four complexes (C1 to C4) and their molecular
masses are indicated on the right, and those of the molecular mass
markers are indicated on the left.
|
|
The 70-kDa complex (C4) was revealed by the antiserum directed against
TolA (AbTolA) (Fig.
1) and was shifted towards lower
molecular masses
in
tolA cells overproducing Orf1, TolQ, TolR,
and TolA with
the central domain of TolA deleted [JC7782(pOQRA

h)]
(data not shown); therefore, the C4 complex corresponds to the
previously described TolA-TolR complex (
18).
The cross-linking pattern was checked in the absence of the TolQ
protein. However, the amount of TolR (and to a lesser extent
of TolA)
is drastically reduced in
tolQ cells (TPS13). To overproduce
TolR in
tolQ mutant cells, TPS13 cells were transformed with
a
plasmid allowing the inducible overproduction of TolR (pARTR).
pARTR encodes a TolR protein with three unrelated residues at
its N
terminus (two Ala and a Gly). pARTR, which confers resistance
to
chloramphenicol, cannot be maintained in TPS300 cells
(
tolR),
which are already chloramphenicol resistant;
however, it complements
other cells with a
tolR mutant
phenotype [TPS13(pQA)]. In TPS13(pQA,
pARTR)
cross-linked cells, the migration of the C1 complex was
not affected
but that of the C2 complex was slightly shifted towards
a higher
molecular mass (Fig.
1). Therefore, the three additional
residues of
the TolR derivative encoded by pARTR allow a better
separation of
C1 and C2 complexes. In TPS13(pARTR) cross-linked
cells, due to
the low TolA production, C4 could only be detected
when the
chemiluminescence-sensitive revelation method was used;
furthermore,
both C1 and C3 complexes disappeared (Fig.
1). This
suggests that TolQ
might be a component of the C1 and C3 complexes.
C1, with a molecular
mass of 38 kDa, might correspond to a TolQ-TolR
complex. In
contrast, C3 might contain TolQ, TolR, and another
protein. TolQ has
been tagged with an epitope localized in the
N-terminal domain of
colicin A and recognized by the 1C11 MAbs
(
4). We could not
directly detect any EpTolQ-TolR complex upon
cross-linking of
tolQ cells producing EpTolQ and
TolR [TPS13(pEpTolQ,
pARTR)] by using the AbTolR
antiserum or MAb 1C11 because EpTolQ
is produced in insufficient
amounts. However, immunoprecipitation
experiments with MAb 1C11 on
extracts of TPS13(pARTR) and TPS13(pEpTolQ,
pARTR)
cells with or without cross-linking by formaldehyde clearly
showed that
TolR was specifically coimmunoprecipitated with EpTolQ,
even
without cross-linking (Fig.
2). Upon
cross-linking of the
cells, MAb 1C11 immunoprecipitated two other bands
(around 38
and 45 kDa) which were specific for the production of TolR
(Fig.
2). One of them, at 45 kDa, has a molecular mass consistent with
an EpTolQ-TolR complex. Indeed, it corresponds to such a
complex,
as revealed by MAb 1C11 and AbTolR antisera (Fig.
2). These
results,
therefore, strongly suggest that TolQ and TolR interact and
that
the C1 complex corresponds to a TolQ-TolR complex.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
TolR is coimmunoprecipitated with EpTolQ by MAb
1C11. Extracts of TPS13(pARTR) cells (producing TolR with three
unrelated residues) and TPS13(pARTR, pEpTolQ) cells
(producing TolR with three unrelated residues and EpTolQ)
cross-linked (F) or not (C) with 1% formaldehyde were
immunoprecipitated with MAb 1C11. The immunoprecipitates were analyzed
by immunoblotting with AbTolR and MAb 1C11 after separation by
SDS-15% PAGE. Visualization was performed as for Fig. 1. HCAb and
LCAb indicate the heavy chain and the light chain of MAb 1C11,
respectively. The positions of TolR, EpTolQ, and
EpTolQ-TolR (labelled by arrows) are indicated on the right;
the positions of the molecular mass markers are indicated on the
left.
|
|
TolR dimerizes in vivo.
In TPS13(pQA, pARTR)
cells treated with formaldehyde, the C2 complex migrates slightly
higher than the C2 complex of cells producing wild-type TolR (Fig. 1).
The three-residue difference in TolR cannot account for such a
difference. However, the difference in C2 migration might be
explained if the complex corresponded to a TolR dimer.
TolR207 mutant protein has its Pro in position 37 replaced by Ala
(P37A), and it has been shown to suppress the
tolQ925
mutation
(A177V) (
39). The migration of TolR207 is modified
compared
to wild-type TolR (18 instead of 19 kDa) (
39).
pARTR207 encodes
a TolR (P37A) protein with three unrelated
residues at its N terminus.
In TPS13(pQA, pARTR207)
cross-linked cells, the migration of C1
and C2 complexes was
drastically affected. Indeed, they were replaced
by two complexes of 37 and 34 kDa (Fig.
3). To obtain further
information on the components of these complexes, cross-linking
experiments were performed in
tolQ cells producing TolR207
[TPS13(pBSKR207)].
In the absence of TolQ, the 37-kDa band
disappeared, indicating
that it might correspond to the C1
(TolQ-TolR207) complex. Therefore,
the 34-kDa band might correspond
to the C2 complex. The shift
in the molecular mass of the C2 complex
from 38.5 to 34 kDa might
again be explained if the complex
corresponded to a TolR dimer.
This hypothesis is unambiguously
confirmed by the fact that TPS13
cells producing both TolR207 and the
wild-type TolR (pARTR is
compatible with pBSKR207) exhibit three
cross-linked products:
one at 37 kDa at the level of C2 (TolR dimer) in
TPS13(pARTR)
cells, one at 34 kDa at the level of C2 (TolR207
dimer) in TPS13(pBSKR207)
cells, and one with an intermediate
migration at 35 kDa that might
correspond to a TolR-TolR207 complex
(Fig.
3). These different
results argue in favor of a dimerization of
TolR. This dimerization
is not an artifact of TolR overproduction.
Indeed, the dimer can
be immunodetected by AbTolR when TPS13 cell
extracts (which only
produce a small residual amount of TolR) are
overloaded on SDS-PAGE
and revealed with sensitive methods (Fig.
4).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 3.
C2 complex is a TolR dimer. Strain TPS13 carrying
different plasmids (pARTR, which encodes TolR with three unrelated
residues at the N terminus; pARTR207 and pBSKR207, which encode the
TolR207 mutant with three unrelated residues at the N terminus; and
pQA, which encodes TolQ and TolA) was cross-linked for 20 min in the
presence of 1% formaldehyde as described in Materials and Methods.
TolR and TolR207 production from pARTR and from pARTR207 or
pBSKR207, respectively, was induced for 2 h with 0.5 mg of
arabinose/ml prior to cross-linking. Extracts of cells treated (F) or
not treated (C) with formaldehyde were analyzed by immunoblotting of an
SDS-7.5% PAGE gel with the AbTolR antiserum. Visualization was
performed as for Fig. 1. A total of 0.3 OD600 units of each
cell extract was loaded. The positions of TolR dimer, TolR207 dimer,
TolR-TolR207, TolR-TolQ, and TolR207-TolQ complexes and their molecular
masses are indicated on the right.
|
|

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4.
TolR dimerizes even without overproduction. Strains GM1
(wild-type cells), TPS13 (tolQ), TPS300 (tolR),
and GM1(pBPAII) were cross-linked for 20 min in the presence of 1%
formaldehyde as described in Materials and Methods. Extracts of these
cells treated (F) or not treated (C) with formaldehyde were analyzed by
immunoblotting with the AbTolR antiserum. Twice as much cell extract of
TPS13 and TPS300 (0.6 OD600 units) as of GM1 (0.3 OD600 units) was loaded on an SDS-12.5% PAGE gel. A total
of 0.2 OD600 units of GM1(pBPAII) cross-linked cells were
loaded. The Western blot was visualized by secondary antibodies coupled
to peroxidase and by chemoluminescence, which is a more sensitive
method than the colorimetric one used for the other Western blots. The
positions of TolR and TolR dimer are indicated on the right, and the
positions of the molecular mass markers are indicated on the left.
|
|
In the absence of TolQ [TPS13(pARTR cells)], the C3 complex
was not replaced by a lower-molecular-mass complex. Two hypotheses
might account for such an observation. One is that C3 is composed
of
TolQ, TolR, and another protein, but TolR does not interact
with the
other protein in the absence of TolQ. The other possibility
is that C3
is composed of only TolQ and TolR and that one of them
dimerizes in the
complex. Along this line, C3 might correspond
to a TolQ-TolR dimer
complex, since TolR has been shown to dimerize.
The latter
hypothesis is strengthened by the fact that MAb 1C11
coimmunoprecipitates a 38.5-kDa band that is recognized by
AbTolR
(Fig.
2) and migrates at exactly the same position as
the TolR
dimer in TPS13(pARTR) cross-linked cells (data not
shown). Furthermore,
the shifts in the migration of the C3 complex in
cross-linked
TPS13(pQA, pARTR207) and TPS13(pQA, pARTR)
cells compared to that
in bacteria producing wild-type TolR
[TPS13(pOQRA)] are consistent
with a TolQ-TolR dimer complex
(data not
shown).
C-terminal domain of TolR cofractionates with membranes.
To
determine the regions of TolR protein implicated in the interactions
with itself and with TolQ and TolA, four TolR deletion derivatives were
constructed (Fig. 5). Initially, their
cellular locations were determined.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
The TolR domains and the truncated TolR protein
constructs. The names of TolR derivatives are indicated on the left.
The corresponding vectors encoding these constructs (with or without
the addition of six C-terminal His, as indicated in parentheses) are
indicated on the right. The positions of the different domain
boundaries are indicated (1, 44, 117, and 142); 24 corresponds to the
limit of the transmembrane domain, and 108 corresponds to the first
TolR residue of the TolRIII derivative; (+3) and (+7) indicate that
three and seven unrelated residues, respectively, are added to the N
terminus of some TolR derivatives for the constructs.
|
|
Fractionation experiments were performed on cells producing the
different TolR derivatives. As expected, due to the presence
of the
transmembrane domain, TolRI-II was found in the membrane
fractions of TPS13(pQA, pARTRI-II) cells (data not shown).
TolRII
was found exclusively in the periplasmic fraction (Fig.
6A), while
TolRII-III was detected in the
periplasmic and the membrane fractions
(data not shown). The
localization of TolRIII-His protein was
also assessed by fractionating
BL21(DE3)(pETRIII) cells. The AbTolR
antiserum still recognizes
TolRIII-His but with a lower affinity
than the other TolR deletion
mutants. To avoid any detection problems
due to its low molecular mass
(6 kDa), TolRIII-His protein was
specifically labelled with
[
35S]methionine by using the T7 polymerase system, and
the resulting
BL21(DE3)(pETRIII) cell extracts were
fractionated. TolRIII-His
appeared to be partially associated with the
membrane fraction
(data not shown). To rule out the possibility of an
aggregation
problem for TolRII-III membrane localization,
a sucrose gradient
fractionation was performed. Fractions
corresponding to the inner
membrane, the contact sites, and the outer
membrane were determined
after the localization of different
protein markers (TolA, TolB,
TolR, and PAL). TolRII-III appeared
to be enriched in fractions
with a sucrose density intermediate between
the fractions corresponding
to the inner membrane and the outer
membrane (Fig.
6B). TolRII-III
was also present in fractions
corresponding to the outer membrane.
As expected, TolRII was not
detected in any of the gradient fractions,
confirming that it was not
membrane associated (data not shown).
Again, these results argue in
favor of an interaction of the TolR
C-terminal domain with the
membranes, but they go further by suggesting
a localization of this
domain in the contact sites between the
inner and outer membranes.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 6.
Fractionation of cells producing TolRII-III and TolRII
proteins. (A) W3110(pINRII) cells were induced for 45 min with 100 µM
IPTG and were fractionated as described in Materials and Methods into
periplasmic (P), cytoplasmic (C), and membrane (M) fractions. Total
cells is the total fraction before cell fractionation (T). Equal
amounts of each cell fraction (OD600, 0.3) were loaded on
SDS-12.5% PAGE gels, transferred onto nitrocellulose, and analyzed by
AbTolR. (B) W3110(pINRII-III) cells were induced for 45 min with 50 µM IPTG. They were broken in a French pressure cell, and the
membranes were subjected to a sucrose gradient. Fractions (100 µl)
were collected, and 20 µl of each of the fractions indicated by
numbers was analyzed by Western blotting with different antibodies.
AbTolA, AbTolB, and AbPAL antisera allowed the determination of the
fractions corresponding to the inner membrane (TolA), the contact sites
(TolA and TolB), and the outer membrane (TolB and PAL). AbTolR revealed
the localization of TolR and TolRII-III. Total cell extracts (cells)
were also analyzed with the different antisera.
|
|
Role of TolR domains in its interaction with TolA and TolQ and in
its dimerization.
To evaluate the role of the TolR domains
in its interactions with TolA and TolQ and in its dimerization, in vivo
cross-linking experiments were performed on cells producing
different TolR deletion derivatives. The experiments were carried out
in tolQ cells (TPS13) transformed with the pQA plasmid (to
restore the synthesis of TolQ and TolA) and with a compatible plasmid
encoding the TolR derivatives. pINRII-IIIM, encoding TolRII-III and
compatible with pQA, was constructed, and cross-linking
experiments were performed on TPS13(pQA, pINRII-IIIM) cells
[with TPS13(pQA) and TPS13(pINRII-IIIM) cells as
controls]. After detection with the AbTolR antiserum, a single band
migrating at 32 kDa appeared in TPS13(pINRII-IIIM) and
TPS13(pQA, pINRII-IIIM) cells (Fig.
7). This band probably corresponds to the
TolRII-III dimer complex, since its presence is correlated to
TolRII-III production. No band that may correspond to TolRII-III-TolQ
or TolRII-III-TolA complexes was detected with AbTolR or AbTolA
antiserum (data not shown). Therefore, when its domain I has been
deleted, TolR seems to still be able to dimerize but does not seem to
interact with TolA and TolQ any longer. The ability of TolRII-III to
dimerize was confirmed in vitro with the purified protein tagged with
six His (TolRII-III-His) (data not shown).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 7.
TolRII-III dimerizes and does not interact with TolA and
TolQ. TPS13(pQA), TPS13(pINRII-IIIM), and TPS13(pQA,
pINRII-IIIM) cells were cross-linked for 20 min in the presence of 1%
formaldehyde as described in Materials and Methods. TolRII-III
production from pINRII-IIIM was induced for 30 min with 50 µM IPTG
prior to cross-linking. Extracts of these cells, treated (F) or not
treated (C) with formaldehyde, were analyzed by immunoblotting on an
SDS-12.5% PAGE gel with the AbTolR antiserum, as described in the
legend to Fig. 1. The positions of TolRII-III and TolRII-III dimer and
their molecular masses are indicated on the right, and the positions of
the molecular mass markers are indicated on the left.
|
|
To assess the role of TolR domain III, the cross-linking patterns
of TPS13(pQA, pARTRI-II), TPS13(pARTRI-II),
and TPS13(pQA)
cells were compared. The AbTolR
antiserum revealed a unique band
at 33 kDa in
TPS13(pARTRI-II) cells and two bands, one migrating
at 33 kDa and the other migrating at 36 kDa, in TPS13(pQA, pARTRI-II)
cells (Fig.
8). The 33-kDa complex may
correspond to the TolRI-II
dimer because its detection is linked to
TolRI-II production.
In view of its molecular mass, the 36-kDa complex
may correspond
to the TolRI-II-TolQ complex. No band corresponding to
the TolRI-II-TolA
complex was revealed by the AbTolR
antiserum. Furthermore, TPS13(pQA)
and TPS13(pQA,
pARTRI-II) cells exhibited no difference when revealed
with the
AbTolA antiserum (data not shown). Therefore, TolR domain
III is
not essential for TolR dimerization, and it plays a role
in
the TolA-TolR interaction. Cross-linking experiments performed
on the purified TolRII-His protein (Fig.
9) showed that TolRII-His
forms
a 30-kDa dimer (and even a trimer). These experiments, therefore,
confirm that domains I and III of TolR are not required for TolR
dimerization. The exact role of TolR domain III was also evaluated
by
performing cross-linking experiments on
BL21(DE3)(pETRIII)
cells. Strikingly, TolRIII-His appeared
to dimerize, but no TolA-TolRIII-His
nor TolQ-TolRIII-His
complexes were detected with AbTolA and AbTolR
antisera,
respectively (data not shown). Since our TolRIII-His
mutant
shares nine residues with TolRII, we wondered whether these
residues were involved in TolR dimerization. A new TolRII
deletion
mutant with residues 108 to 117 deleted still dimerized
[BL21(pETRII

108-117)
cells were cross-linked with
formaldehyde] (data not shown). Therefore,
TolR domains II and
III have the intrinsic capacity to dimerize.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 8.
TolRI-II dimerizes and interacts with TolQ, but not with
TolA. TPS13(pARTRI-II), TPS13(pQA), and TPS13(pQA,
pARTRI-II) cells were cross-linked for 20 min in the presence of
1% formaldehyde, as described in Materials and Methods. TolRI-II
production from pARTRI-II was induced for 2 h with 0.5 mg of
arabinose/ml prior to cross-linking. Extracts of these cells, treated
(F) or not treated (C) with formaldehyde, were analyzed by
immunoblotting on an SDS-10% PAGE gel with the AbTolR antiserum as
described in the legend to Fig. 1. The positions of TolRI-II dimer and
TolRI-II-TolQ complex and their molecular masses are indicated on the
right.
|
|

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 9.
TolRII-His dimerizes in vitro. Purified TolRII-His (10 µl; 1 mg/ml) was treated (F) or not treated with formaldehyde. The
samples not treated with formaldehyde were heated (H) or not heated
(NH) for 20 min at 96°C before being loaded on SDS-PAGE gels. After
transfer to nitrocellulose, bands were revealed with the AbTolR
antiserum as described in the legend to Fig. 1. The positions of
TolRII-His, TolRII-His dimer, and TolRII-His trimer are indicated
on the right. The positions of the molecular mass markers are
indicated on the left.
|
|
TolR, TolRII, and, to a lesser extent, TolRII-III overproduction
induce a tolerant phenotype.
When produced in tolR
cells, TolRI-II and periplasmic TolRII-III and TolRII could
not restore the sensitivity of the cells to colicin A nor
complement their envelope integrity defects (data not shown).
However, wild-type cells producing TolRI-II [W3110(pBSKRI-II)] or
TolRII-III [W3110(pINRII-III)] and TolRII
[W3110(pINRII)] in their periplasms became
tolerant to colicin A (Fig. 10A).
Surprisingly, wild-type cells overproducing wild-type TolR
[W3110(pBSKR)] also became tolerant to colicin A (Fig. 10A). All
of the experiments were done in duplicate or triplicate. In parallel,
the production levels of TolR and TolR derivatives were compared (Fig.
10B). TolR and TolR derivative overproduction also caused the leakage
of a periplasmic marker protein (RNase I) but no significant cell lysis
(data not shown), indicating that the cell envelope integrity might be
affected.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 10.
Protective effect of TolR and TolR derivative
overproduction against colicin A. (A) W3110 cells overproducing TolRII
(pINRII) or TolRII-III (pINRII-III), or transformed with the
pIN-III-OmpA-2 plasmid (pIN2) as a control, were induced for
30 min with 100 µM IPTG, and their sensitivity to colicin A was
tested as described in Materials and Methods. Similarly, the colicin A
sensitivity of W3110 cells overproducing TolRI-II (pBSKRI-II) and TolR
(pBSKR) or transformed with the pART3 plasmid was tested after
2 h of induction with 0.5 mg of arabinose/ml. The dilution factors
and the cells tested are indicated. Since the sensitivity curves of the
two controls [W3110(pART3) and W3110(pIN2)] are superimposable,
only one curve is presented. (B) Comparison of the amount of TolRII,
TolRII-III, TolRI-II, and TolR production to that of the chromosomally
encoded TolR in W3110. A total of 0.3 OD600 units of
W3110(pIN2)-, W3110(pINRII)-, and W3110(pINRII-III)-induced cells (100 µM IPTG) or W3110(pBSKR)- and W3110(pBSKRI-II)-induced cells (0.5 mg/ml of arabinose), used for the sensitivity tests to colicin A,
were analyzed by Western blotting with AbTolR as described in the
legend to Fig. 1.
|
|
 |
DISCUSSION |
TolA, TolQ, and TolR interact with each other inside the inner
membrane. TolR interacts with the transmembrane domain of TolA (18) and with the third transmembrane domain of TolQ
(39); however, it is not known whether these interactions
are simultaneous, since no trimeric TolA-TolR-TolQ complex has ever
been detected. One of the objectives of this work was to identify other
proteins of the Tol-PAL system interacting with TolR. Using
formaldehyde as a cross-linker, antisera directed against many proteins
of the Tol-PAL system, and mutants in the tol-pal genes, we
biochemically confirmed the TolQ-TolR interaction and unambiguously
showed that TolR dimerizes in vivo, without TolR overproduction. This
dimerization was fully confirmed by the double-hybrid technique in
Saccharomyces cerevisiae in a systematic screening of Tol
protein interactions (14a). Surprisingly, in our hands, the
TolR dimer (with a theoretical molecular mass in accordance with the
one observed around 38.5 kDa) migrates slightly more slowly than the
TolQ-TolR complex (which has an apparent molecular mass around 38 kDa but a theoretical molecular mass of 44 kDa). This might be due to
the use of a different SDS-PAGE system than that used by Germon et al.
(22). Indeed, the three unrelated residues of the TolR
protein used to identify the two complexes induce a slight displacement
of TolR dimer towards a higher molecular mass, but by no means could it
be responsible for the inversion of the bands corresponding to
TolR dimer and TolQ-TolR complexes. Higgs et al.
(26) have recently shown that ExbB and ExbD form homodimers
and homotrimers in vivo. We could not demonstrate the existence of TolR
trimers in vivo, but purified forms of six-histidine-tagged TolR
deletion mutants were shown to trimerize in vitro. Interestingly, a
TolQ-TolR dimer complex was also detected. This means that at least
one TolR molecule of the TolR dimer is able to interact with TolQ. It
suggests that even in a dimerized form, TolR might still be involved in
other complexes with Tol proteins of the inner membrane. If each TolR molecule of the dimer interacts with TolQ and TolA, and if these interactions are simultaneous, the Tol complex in the inner membrane would be a hexamer composed of 10 transmembrane domains. This hypothesis is consistent with what Higgs et al. (26) have
proposed for the TonB system. Another alternative is that there might
be a subtle equilibrium between TolQ-TolA, TolR-TolA, and
TolQ-TolR dimer interactions. Despite our efforts, no
TolA-TolR dimer complex or TolQ dimer-TolR dimer complex
could be detected. However, the low cross-linking efficiency, the
requirement for the close proximity of formaldehyde-reactive residues,
and the limits of detection of the antibodies do not allow us to
exclude the existence of these two complexes. Along the same line, the
absence of other cross-linked products between TolR and other proteins
of the Tol-PAL system does not mean that such interactions do not exist.
TolR can be divided into three distinct domains. One domain,
extending from residues 1 to 43 and called domain I, includes the
transmembrane domain (amino acids 23 to 43), which exhibits a
high percentage of conserved residues among the different TolR and ExbD
proteins sequenced so far. It is separated from another conserved
domain at the C terminus (extending from residues 117 to 142 and called
domain III) by the central region of the protein (domain II), which is,
in contrast, poorly conserved. The conserved C-terminal domain has a
residue distribution suggesting that it may form an amphiphilic
-helix (39). This suggested that it may be in contact
with the inner membrane and may play a role in the TolQ-TolR
interaction. TolR deletion mutants were constructed, and cross-linking
experiments were performed to determine the TolR domains involved in
its dimerization and its interaction with TolA and TolQ. Our results
directly confirm the role of the TolR transmembrane domain in its
interaction with TolA and TolQ, since no cross-linked complexes
were detected between TolR with its domain I deleted and TolA or TolQ.
Our results also demonstrate that both domains II and III of TolR have
the intrinsic capacity to dimerize. We cannot exclude, however, the
possibility that TolR domain I dimerizes. Nevertheless, this seems
unlikely because it already interacts with TolQ and TolA, unless
these interactions are not simultaneous. Lazzaroni et al.
(39) showed that TolR domain III participates in the
TolQ-TolR interaction; however, TolR with its domain III deleted
still cross-linked to TolQ. Therefore, the interaction might be
affected in a way that does not lower or disrupt the cross-linking.
Such a phenomenon has also been observed for the tolQ925
mutant. This tolQ mutant [TolQ(A177V)], which harbors
a tolR phenotype and has been shown to be affected in its
interaction with TolR (39), exhibits a TolQ(A177V)-TolR cross-linked complex (data not shown). Therefore, the two proteins still interact, but TolR function is altered because the
characteristics of the interaction have changed or because TolR
conformation is modified. In any case, the equilibrium of TolR
interactions with other proteins might be disturbed. Since TolR
dimerizes and interacts with TolA, it might be that these two
interactions are indirectly affected by the tolQ925
mutation. This was tested, but no difference was detected in the
formation of TolR dimer and TolA-TolR complexes compared to that in
bacteria expressing wild-type TolQ (data not shown). Therefore, even if
the tolQ925 mutation has an indirect effect on the
TolQ(A177V)-TolR, TolR dimer, and TolA-TolR interactions, this is not
detectable by cross-linking. The deletion of domain III resulted
in the disappearance of the TolA-TolR complex, demonstrating that the
C-terminal domain of TolR also plays a role in the TolA-TolR interaction. Fractionation experiments on TolR deletion mutants have
shown that TolR domain III partially cofractionates with the membranes.
Furthermore, this domain is responsible for TolRII-III localization in contact sites and in the outer membrane upon sucrose gradient fractionation. Rather than a direct interaction with the inner
membrane, these results suggest that TolRIII interacts with proteins
localized in the contact sites and the outer membrane. These results
are consistant with those of Lazzaroni et al. (39), who
showed that the C-terminal domain of TolR was not accessible to
carboxypeptidase. In the case of ExbD, a role for its C-terminal domain
in the interaction with ExbB and TonB has also been suggested. Indeed,
a deletion in ExbD domain III suppresses the negative-complementation phenotype induced by a point mutation in its transmembrane domain (11). TolRII-III and TolRI-II are unable to complement
tolR cells. Therefore, domains I and III play a role in TolR
function. Since these two domains are involved in the interactions with TolA and TolQ, it seems likely that these interactions are important for TolR function. Two point mutations localized in the transmembrane domain and the C-terminal domain of ExbD (D25N and L132Q, respectively) also pointed out the importance of these two domains in ExbD
function (11). We could not demonstrate a direct interaction
of TolR domain III with TolA or TolQ (data not shown); therefore,
it might be that domain III affects the TolQ-TolR and TolA-TolR
interactions by affecting domain I conformation. If we consider that
TolA, TolQ, and TolR proteins do not form a stable complex but cycle between different interactions, we could imagine that TolR domain III
plays a role in specific complex formation in response to different
physiological states of the cells. TolR domain II also seems to play an
important role in TolR function because TolRII production in the
periplasms of wild-type cells induces a partial inhibition of TolR
function. Its role might be to allow the formation of a TolR dimer or
to allow an interaction of TolR with another protein of the
Tol-PAL system. However, these interactions, if they exist, would not
result in TolRII association with the membranes, as is the case for
TolRIII. When produced in wild-type cells, the TolRII-III mutant also
induced a negative complementation. However, the same level of negative
complementation is induced by much higher overproduction of
TolRII-III compared to TolRII. It might be that the presence of domain
III somehow inhibits the competitive effect of domain II by affecting
its conformation or by hindering its interaction with other envelope proteins.
When overproduced, wild-type TolR also induces a negative
complementation. Different explanations might account for this result. First, the excess of TolR molecules might sequester TolA and TolQ, preventing them from forming active TolA-TolQ-TolR complexes in the
inner membrane. Second, the excess of TolR molecules which are not
involved in the TolA-TolQ-TolR inner membrane complex might
interact with another protein of the Tol-PAL system, preventing it from
functionally interacting with the TolA-TolQ-TolR complex. These
explanations are not mutually exclusive, and this might explain why the
competition induced by TolR overproduction is stronger than that
induced by the TolR central domain. When TolR has its domain III
deleted, it still induces a negative complementation. This result was
unexpected because when ExbD (D25N) had its domain III deleted, its
negative complementation was abolished (11). However, the
effects induced by wild-type TolR and ExbD (D25N), although both result
in a modification of the phenotype, are probably different, and this
might account for this discrepancy.
It is noteworthy that the two conserved domains of TolR are involved in
interactions with other Tol proteins of the inner membrane. It appears
that the regions of TolA and TolQ in interaction with TolR
(transmembrane domains) are also conserved among TolA, TonB, TolQ, and
ExbB proteins sequenced so far in other gram-negative bacteria. These domains might be conserved because they are all involved in a specific function which is similar in the Tol and TonB systems.
Our study has allowed us to demonstrate for the first time that TolR
interacts with another partner, itself, and that both its transmembrane
and C-terminal domains are involved in the interactions with TolA and
TolQ. We do not know if the Tol system function needs the formation of
a stable multimer of a definite stoichiometry between TolA, TolQ, and
TolR or results from a subtle equilibrium between different
interactions. Cross-linking experiments alone cannot completely answer
this question. They should be combined with suppression mutant
analyses, double-hybrid system analysis, and purification experiments
in conditions preserving the interactions in wild-type or in
tol mutant cells and with information on the Tol-PAL system
function to elucidate the stoichiometry and the dynamics of the inner
membrane Tol complex.
 |
ACKNOWLEDGMENTS |
We are grateful to R. Lloubès for helpful discussions,
critical reading of the manuscript, and the gift of the anti-LexA antiserum. We also thank E. Bouveret for helpful advice and L. M. Olivera for careful reading of the manuscript.
This work was supported by the Life Science department and the Mission
Physique et Chimie du Vivant of the CNRS, the INSERM Programme
Environnement Santé 96 (EN96C3), and the European Community (BIO4-CT97-2313).
 |
FOOTNOTES |
*
Corresponding author. Present address: Centre de
Biophysique Moléculaire, CNRS, UPR4301, University of
Orléans, rue Charles Sadron, 45071, Orleans Cedex 2, France.
Phone: 33 (0)2 38 25 55 67. Fax: 33 (0)2 38 63 15 17. E-mail:
benedett{at}cnrs-orleans.fr.
 |
REFERENCES |
| 1.
|
Bachman, B. J.
1987.
Derivatives and genotypes of some mutant derivatives of Escherichia coli K-12, p. 1190-1219.
In
F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, D.C.
|
| 2.
|
Bénédetti, H., and V. Géli.
1996.
Colicin transport, channel formation and inhibition, p. 665-691.
In
W. N. Konings, H. R. Kaback, and J. S. Lolkema (ed.), Handbook of biological physics, vol. 2. Elsevier Science, New York, N.Y.
|
| 3.
|
Bernadac, A.,
M. Gavioli,
J. C. Lazzaroni,
S. Raina, and R. Lloubès.
1998.
Escherichia coli tol/pal mutants form outer membrane vesicles.
J. Bacteriol.
180:4872-4878[Abstract/Free Full Text].
|
| 4.
|
Bourdineaud, J. P.,
S. P. Howard, and C. Lazdunski.
1989.
Localization and assembly onto the Escherichia coli envelope of a protein required for entry of colicin A.
J. Bacteriol.
171:2458-2465[Abstract/Free Full Text].
|
| 5.
|
Bouveret, E.,
R. Derouiche,
A. Rigal,
R. Lloubès,
C. Lazdunski, and H. Bénédetti.
1995.
Peptidoglycan-associated lipoprotein-TolB interaction.
J. Biol. Chem.
270:11071-11077[Abstract/Free Full Text].
|
| 6.
|
Bouveret, E.,
A. Rigal,
C. Lazdunski, and H. Bénédetti.
1997.
The N-terminal domain of colicin E3 interacts with TolB which is involved in the colicin translocation step.
Mol. Microbiol.
23:909-920[Medline].
|
| 7.
|
Bouveret, E.,
A. Rigal,
C. Lazdunski, and H. Bénédetti.
1998.
Distinct regions of the colicin A translocation domain are involved in the interaction with TolA and TolB proteins upon import into Escherichia coli.
Mol. Microbiol.
27:143-157[Medline].
|
| 8.
|
Bradbeer, C.
1993.
The proton motive force drives the outer membrane transport of cobalamin in Escherichia coli.
J. Bacteriol.
175:3146-3150[Abstract/Free Full Text].
|
| 9.
|
Braun, V.
1989.
The structurally related exbB and tolQ genes are interchangeable in conferring tonB-dependent colicin, bacteriophage, and albomycin sensitivity.
J. Bacteriol.
171:6387-6390[Abstract/Free Full Text].
|
| 10.
|
Braun, V., and C. Hermann.
1993.
Evolutionary relation of uptake systems for biopolymers in Escherichia coli: cross-complementation between the TonB-ExbB-ExbD and the TolA-TolQ-TolR proteins.
Mol. Microbiol.
8:261-268[Medline].
|
| 11.
|
Braun, V.,
S. Gaisser,
C. Herrmann,
K. Kampfenkel,
H. Killmann, and I. Traub.
1996.
Energy-coupled transport across the outer membrane of Escherichia coli: ExbB binds ExbD and TonB in vitro, and leucine 132 in the periplasmic region and aspartate 25 in the transmembrane region are important for ExbD activity.
J. Bacteriol.
178:2836-2845[Abstract/Free Full Text].
|
| 12.
|
Cavard, D.,
A. Bernadac,
J. M. Pagès, and C. Lazdunski.
1984.
Colicins are not transiently accumulated in the periplasmic space before release from colicinogenic cells.
Biol. Cell
51:79-86[Medline].
|
| 13.
|
Cavard, D.,
V. Crozel,
J. P. Gorvel,
F. Pattus,
D. Baty, and C. Lazdunski.
1986.
A molecular, genetic and immunological approach to the functioning of colicin A, a pore-forming protein.
J. Mol. Biol.
187:449-459[Medline].
|
| 14.
|
Clavel, T.,
P. Germon,
A. Vianney,
R. Portalier, and J. C. Lazzaroni.
1998.
TolB protein of Escherichia coli K-12 interacts with the outer membrane peptidoglycan-associated proteins Pal, Lpp and OmpA.
Mol. Microbiol.
29:359-367[Medline].
|
| 14a.
| Corda, Y., et al. Unpublished data.
|
| 15.
|
Davies, J. K., and P. Reeves.
1975.
Genetics of resistance to colicins in Escherichia coli K-12. Cross-resistance among colicins of group B.
J. Bacteriol.
123:96-101[Abstract/Free Full Text].
|
| 16.
|
Davies, J. K., and P. Reeves.
1975.
Genetics of resistance to colicins in Escherichia coli K-12. Cross-resistance among colicins of group A.
J. Bacteriol.
123:102-117[Abstract/Free Full Text].
|
| 17.
|
Deich, R. A.,
B. N. J. Metcalf,
C. W. Finn,
J. E. Farley, and B. A. Green.
1988.
Cloning of genes encoding a 15,000-dalton peptidoglycan-associated outer membrane lipoprotein and an antigenically related 15,000-dalton protein from Haemophilus influenzae.
J. Bacteriol.
170:489-498[Abstract/Free Full Text].
|
| 18.
|
Derouiche, R.,
H. Bénédetti,
J. C. Lazzaroni,
C. Lazdunski, and R. Lloubès.
1995.
Protein complex within Escherichia coli inner membrane TolA N-terminal domain interacts with TolQ and TolR proteins.
J. Biol. Chem.
270:11078-11084[Abstract/Free Full Text].
|
| 19.
|
Derouiche, R.,
M. Gavioli,
H. Bénédetti,
A. Prilipov,
C. Lazdunski, and R. Lloubès.
1997.
TolA central domain interacts with Escherichia coli porins.
EMBO J.
15:6408-6415.
|
| 20.
|
Fognini-Lefebvre, N.,
J. C. Lazzaroni, and R. Portalier.
1987.
tolA, tolB and excC, three cistrons involved in the control of pleiotropic release of periplasmic proteins by Escherichia coli K12.
Mol. Gen. Genet.
209:391-395[Medline].
|
| 21.
|
Géli, V.,
D. Baty, and C. Lazdunski.
1988.
Use of a foreign epitope as a tag for the localization of minor proteins: the case of the immunity protein to colicin A.
Proc. Natl. Acad. Sci. USA
85:689-693[Abstract/Free Full Text].
|
| 22.
|
Germon, P.,
T. Clavel,
A. Vianney,
R. Portalier, and J. C. Lazzaroni.
1998.
Mutational analysis of the Escherichia coli K-12 TolA N-terminal region and characterization of its TolQ-interacting domain by genetic suppression.
J. Bacteriol.
180:6433-6439[Abstract/Free Full Text].
|
| 23.
|
Ghrayeb, J.,
H. Kimura,
M. Takahara,
H. Hsiung,
Y. Masui, and M. Inouye.
1984.
Secretion cloning vectors in Escherichia coli.
EMBO J.
3:2437-2442[Medline].
|
| 24.
|
Gorvel, J. P.,
A. Rigal,
J. Sarles, and S. Maroux.
1985.
Aminopeptidase N and human blood group A-antigenicity along the digestive tract and associated glands in the rabbit.
Cell Tissue Res.
239:241-248[Medline].
|
| 25.
|
Guihard, G.,
P. Boulanger,
H. Bénédetti,
R. Lloubès,
M. Besnard, and L. Letellier.
1994.
Colicin A and the Tol proteins involved in its translocation are preferentially located in the contact sites between the inner and outer membranes of Escherichia coli cells.
J. Biol. Chem.
269:5874-5880[Abstract/Free Full Text].
|
| 26.
|
Higgs, P. I.,
P. S. Myers, and K. Postle.
1998.
Interactions in the TonB-dependent energy transduction complex: ExbB and ExbD form homomultimers.
J. Bacteriol.
180:6031-6038[Abstract/Free Full Text].
|
| 27.
|
Ho, S. N.,
H. D. Hunt,
R. M. Horton,
J. K. Pullen, and L. R. Pease.
1989.
Site-directed mutagenesis by overlap extinction using the polymerase chain reaction.
Gene
77:51-59[Medline].
|
| 28.
|
Ishidate, K.,
E. S. Creeger,
J. Zike,
S. Deb,
B. Glauner,
T. J. MacAlister, and L. I. Rothfield.
1986.
Isolation and differentiated membrane domains from Escherichia coli and Salmonella typhimurium, including a fraction containing attachment sites between the inner and outer membranes and the murein skeleton of the cell envelope.
J. Biol. Chem.
261:428-443[Abstract/Free Full Text].
|
| 29.
|
Isnard, M.,
A. Rigal,
J. C. Lazzaroni,
C. Lazdunski, and R. Lloubès.
1994.
Maturation and localization of the TolB protein required for colicin import.
J. Bacteriol.
176:6392-6396[Abstract/Free Full Text].
|
| 30.
|
Jaskula, J. C.,
T. E. Letain,
S. K. Roof,
J. T. Skare, and K. Postle.
1994.
Role of the TonB amino terminus in energy transduction between membranes.
J. Bacteriol.
175:2326-2338.
|
| 31.
|
Jiang, X.,
M. A. Payne,
Z. Cao,
S. B. Foster,
J. B. Feix,
M. C. Newton, and P. E. Klebba.
1997.
Ligand-specific opening of a gated-porin channel in the outer membrane of living bacteria.
Science
276:1261-1264[Abstract/Free Full Text].
|
| 32.
|
Kadner, R. J.,
C. V. Franklund, and J. T. Lathrop.
1996.
Communication between membranes in TonB-dependent transport across the bacterial outer membrane, p. 637-664.
In
W. N. Konings, H. R. Kaback, and J. S. Lolkema (ed.), Handbook of biological physics, vol. 2. Elsevier Science, New York, N.Y.
|
| 33.
|
Karlsson, M.,
K. Hannavy, and C. F. Higgins.
1993.
A sequence-specific function for the N-terminal signal-like sequence of the TonB protein.
Mol. Microbiol.
8:379-388[Medline].
|
| 34.
|
Koebnik, R.
1993.
The molecular interaction between components of the TonB-ExbBD-dependent and the TolQRA-dependent bacterial uptake systems.
Mol. Microbiol.
9:219[Medline].
|
| 35.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 36.
|
Larsen, R. A.,
M. G. Thomas,
G. E. Wood, and K. Postle.
1994.
Partial suppression of an Escherichia coli TonB transmembrane domain mutation (D17V) by a missense mutation in ExbB.
Mol. Microbiol.
13:627-640[Medline].
|
| 37.
|
Lazdunski, C. J.,
E. Bouveret,
A. Rigal,
L. Journet,
R. Lloubes, and H. Bénédetti.
1998.
Colicin import into Escherichia coli cells.
J. Bacteriol.
180:4993-5002[Free Full Text].
|
| 38.
|
Lazzaroni, J. C., and R. Portalier.
1981.
Genetic and biochemical characterization of periplasmic-leaky mutants of Escherichia coli K-12.
J. Bacteriol.
145:1351-1358[Abstract/Free Full Text].
|
| 39.
|
Lazzaroni, J. C.,
A. Vianney,
J. L. Popot,
H. Benedetti,
F. Samatey,
C. Lazdunski,
R. Portalier, and V. Geli.
1995.
Transmembrane alpha-helix interactions are required for the functional assembly of the Escherichia coli Tol complex.
J. Mol. Biol.
246:1-7[Medline].
|
| 40.
|
Letain, T. E., and K. Postle.
1997.
TonB protein appears to transduce energy by shuttling between the cytoplasmic membrane and the outer membrane in Escherichia coli.
Mol. Microbiol.
24:271-283[Medline].
|
| 41.
|
Lim, A., Jr.,
D. De Vos,
M. Brauns,
D. Mossialos,
A. Gaballa,
D. Quing, and P. Cornelis.
1997.
Molecular and immunological characterization of Opr1, the 18 kDa outer membrane peptidoglycan-associated lipoprotein (PAL) of Pseudomonas aeruginosa.
Microbiology
143:1709-1711[Abstract/Free Full Text].
|
| 42.
|
Miller, J. H.
1992.
A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria, p. 435-447.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 43.
|
Pérez-Pérez, J., and J. Gutierrez.
1995.
An arabinose-inducible expression vector, pART3, compatible with ColE1-derived plasmids.
Gene
158:141-142[Medline].
|
| 44.
|
Postle, K., and J. T. Skare.
1988.
Escherichia coli TonB protein is exported from the cytoplasm without proteolytic cleavage of its amino terminus.
J. Biol. Chem.
263:11000-11007[Abstract/Free Full Text].
|
| 45.
|
Rigal, A.,
E. Bouveret,
R. Lloubes,
C. Lazdunski, and H. Bénédetti.
1997.
The TolB protein interacts with the porins of Escherichia coli.
J. Bacteriol.
179:7274-7279[Abstract/Free Full Text].
|
| 46.
|
Rodríguez-Herva, J. J.,
M. I. Ramos-González, and J. L. Ramos.
1996.
The Pseudomonas putida peptidoglycan-associated outer membrane lipoprotein is involved in maintenance of the integrity of the cell envelope.
J. Bacteriol.
178:1699-1706[Abstract/Free Full Text].
|
| 47.
|
Rutz, J. M.,
J. Liu,
J. A. Lyons,
J. Gotanson,
S. K. Armstrong,
M. A. McIntosh,
J. B. Feix, and P. E. Klebba.
1992.
Formation of a gated channel by a ligand-specific transport protein in the bacterial membrane.
Science
258:471-475[Abstract/Free Full Text].
|
| 48.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 49.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 50.
|
Skare, J. T.,
B. M. M. Ahmer,
C. L. Seachord,
R. P. Darveau, and K. Postle.
1993.
Energy transduction between membranes. TonB, a cytoplasmic membrane protein, can be chemically cross-linked in vitro to the outer membrane receptor FepA.
J. Biol. Chem.
268:16302-16308[Abstract/Free Full Text].
|
| 51.
|
Sun, T. P., and R. E. Webster.
1986.
fii, a bacterial locus required for filamentous phage infection, and its relation to colicin-tolerant tolA and tolB.
J. Bacteriol.
165:107-115[Abstract/Free Full Text].
|
| 52.
|
Tibor, A.,
V. Weynants,
P. Denoel,
B. Lichtfouse,
X. de Bolle,
E. Saman,
J. N. Limet, and J. J. Letesson.
1994.
Molecular cloning, nucleotide sequence, and occurrence of a 16.5-kilodalton outer membrane protein of Brucella abortus with similarity to PAL lipoproteins.
Infect. Immun.
62:3633-3639[Abstract/Free Full Text].
|
| 53.
|
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 54.
|
Vianney, A.,
M. M. Muller,
T. Clavel,
J. C. Lazzaroni,
R. Portalier, and R. E. Webster.
1996.
Characterization of the tol-pal region of Escherichia coli K-12: translational control of tolR expression by TolQ and identification of a new open reading frame downstream of pal encoding a periplasmic protein.
J. Bacteriol.
178:4031-4038[Abstract/Free Full Text].
|
Journal of Bacteriology, August 1999, p. 4476-4484, Vol. 181, No. 15
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhang, X. Y.-Z., Goemaere, E. L., Thome, R., Gavioli, M., Cascales, E., Lloubes, R.
(2009). Mapping the Interactions between Escherichia coli Tol Subunits: ROTATION OF THE TolR TRANSMEMBRANE HELIX. J. Biol. Chem.
284: 4275-4282
[Abstract]
[Full Text]
-
Goemaere, E. L., Devert, A., Lloubes, R., Cascales, E.
(2007). Movements of the TolR C-terminal Domain Depend on TolQR Ionizable Key Residues and Regulate Activity of the Tol Complex. J. Biol. Chem.
282: 17749-17757
[Abstract]
[Full Text]
-
Cascales, E., Buchanan, S. K., Duche, D., Kleanthous, C., Lloubes, R., Postle, K., Riley, M., Slatin, S., Cavard, D.
(2007). Colicin Biology. Microbiol. Mol. Biol. Rev.
71: 158-229
[Abstract]
[Full Text]
-
Llamas, M. A., Rodriguez-Herva, J. J., Hancock, R. E. W., Bitter, W., Tommassen, J., Ramos, J. L.
(2003). Role of Pseudomonas putida tol-oprL Gene Products in Uptake of Solutes through the Cytoplasmic Membrane. J. Bacteriol.
185: 4707-4716
[Abstract]
[Full Text]
-
Karlsson, F., Borrebaeck, C. A. K., Nilsson, N., Malmborg-Hager, A.-C.
(2003). The Mechanism of Bacterial Infection by Filamentous Phages Involves Molecular Interactions between TolA and Phage Protein 3 Domains. J. Bacteriol.
185: 2628-2634
[Abstract]
[Full Text]
-
Llamas, M. A., Ramos, J. L., Rodriguez-Herva, J. J.
(2003). Transcriptional Organization of the Pseudomonas putida tol-oprL Genes. J. Bacteriol.
185: 184-195
[Abstract]
[Full Text]
-
Cascales, E., Bernadac, A., Gavioli, M., Lazzaroni, J.-C., Lloubes, R.
(2002). Pal Lipoprotein of Escherichia coli Plays a Major Role in Outer Membrane Integrity. J. Bacteriol.
184: 754-759
[Abstract]
[Full Text]
-
Germon, P., Ray, M.-C., Vianney, A., Lazzaroni, J. C.
(2001). Energy-Dependent Conformational Change in the TolA Protein of Escherichia coli Involves Its N-Terminal Domain, TolQ, and TolR. J. Bacteriol.
183: 4110-4114
[Abstract]
[Full Text]
-
Bouveret, E., Bénédetti, H., Rigal, A., Loret, E., Lazdunski, C.
(1999). In Vitro Characterization of Peptidoglycan-Associated Lipoprotein (PAL)-Peptidoglycan and PAL-TolB Interactions. J. Bacteriol.
181: 6306-6311
[Abstract]
[Full Text]