INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The superoxide dismutases (SODs; EC 1.15.1.1) are metalloenzymes that catalyze the dismutation of superoxide (O₂^.) to hydrogen peroxide (H₂O₂) and molecular oxygen (O₂). They have been found in nearly all organisms examined to date and play a major role in the defense against oxidative stress (reviewed in references 15 and 56). There are three general classes of SODs in bacteria, which differ in their metal cofactors. The manganese-containing (MnSOD) and iron-containing (FeSOD) enzymes are cytoplasmic, while the copper-plus-zinc (CuZnSOD) enzyme is periplasmic. In addition, a new class of nickel-containing SODs has been recently discovered in Streptomyces griseus and S. coelicolor (25, 26, 63). The MnSODs and FeSODs have very similar sequences and structures and are evolutionarily unrelated to CuZnSODs (9, 56). Usually FeSODs and MnSODs require specific metal for activity (8) and can be distinguished on the basis of amino acid sequence (37) and sensitivity to H₂O₂ (7, 9). However, these criteria can be misleading (53, 64), and the purified protein must be analyzed to correctly determine the metal at the active site (54). A small group of Mn/FeSODs, termed cambialistic, are active with either manganese or iron incorporated into the same active site. They have been found in the anaerobic (aerotolerant) species Propionibacterium shermanii (35), Bacteroides fragilis (20), Bacteroides thetaiotaomicron (38), Streptococcus mutans (31), and Porphyromonas gingivalis (1) and in the aerobic methylotrophic Methylomonas strain J (61). The aerobic hyperthermophilic Aquifex pyrophilus (30) SOD is, presumably, also cambialistic.

Sinorhizobium meliloti is an aerobic gram-negative bacterium that can live free in the soil or establish a symbiotic association with the roots of leguminous plants, leading to the formation of nodules. In these specialized structures, the bacteria differentiate to bacteroids that can fix atmospheric nitrogen, converting it to ammonia due to the activity of the nitrogenase enzyme complex. The nitrogenase reductase is rapidly and irreversibly inactivated by oxygen and free radicals (43). Despite the low level of molecular oxygen in the nodules, there have been several reports that free radicals are produced in great quantities (5, 32, 36). The SOD could be important for protecting the nitrogen fixation process, as suggested by Puppo and Rigaud (41). Early reports on the SOD content of several Rhizobium species are confusing. Stowers and Elkan (52) reported the presence of a single FeSOD in free-living bacteria in several species. In contrast, Becana and Salin (6) found one MnSOD in free-living bacteria and two Mn-containing isoenzymes in the nodule bacteroids. Dimitrijevic et al. (12) found that the SOD activity of free-living Rhizobium phaseoli is due to the presence of two isoenzymes, one Mn-type and another Fe-type inducible, and that the bacteroids contained only the Mn type. Only the sodA gene encoding an MnSOD from Bradyrhizobium sp. (Parasponia) strain ANU289 has been cloned and sequenced to date (55), and little is known about the defenses against oxidative stress in the symbiotic interaction between rhizobia and leguminous plants.

This report describes the cloning and sequencing of the S. meliloti sodA gene and characterization of the encoded cambialistic SOD.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains and plasmids. The bacterial strains and plasmids used are listed in Table 1. To obtain pRS51, the sodA coding sequence was amplified by PCR using two primers, 5'TTTTGAATTCCCCGACGAAATCCATGCCA3' and 5'TTTTAAGCTTCCGATTTCCGCTGGTAGAAGC3', which carry 5' EcoRI and HindIII restriction sites, respectively. The amplified fragment was digested with EcoRI and HindIII and inserted into pJF119EH under the control of the tac promoter (16). Two DNA fragments were amplified from pRS41.1 by PCR using the vector polylinker primers and two sodA internal primers, 5'GTTTTGGATCCATTGTGGCATCTCCTCTTG3' and 5'GAAAAGGATCCGCTCGTCCACGGCGCAAC3', which carry a 5' BamHI site. These fragments were ligated at the BamHI site (creating a deletion of amino acids 2 to 154) and inserted into the ApaI-XbaI sites of the vector pJQ200sk (42). Plasmid pRS58 was obtained by inserting the lacZ-Km (kanamycin resistance) cassette from pKOK5 (28) into the BamHI site of pRS56, creating a transcriptional fusion. All constructs were verified by sequencing.

Growth conditions. E. coli was grown aerobically at 37°C in Luria-Bertani medium (LB; yeast extract, 5 g/liter; tryptone, 10 g/liter; NaCl, 10 g/liter). Anaerobic cultures were grown in a Forma Scientific anaerobic chamber in LB medium supplemented with 1% glucose. All media and materials were equilibrated in the anaerobic chamber for 24 h before use. S. meliloti was grown at 30°C in LB containing 2.5 mM CaCl₂ and 2.5 mM MgSO₄ (18) under aerobic conditions. Ampicillin (500 µg/ml in liquid media and 50 µg/ml in plates), rifampin (20 µg/ml), kanamycin (20 µg/ml), gentamicin (20 µg/ml), and isopropyl--D-thiogalactopyranoside (IPTG) were added to the medium when needed. Reagent-grade chemicals were purchased from Sigma.

Cloning strategy. (i) S. meliloti genomic library construction. Genomic DNA was extracted from stationary-phase S. meliloti Rm5000 by the method of Pitcher et al. (40). The DNA was partially digested with Sau3A (200 ng of DNA to 0.4 U of Sau3A), and 100-µg DNA fragments were fractionated in a 5 to 30% sucrose gradient (Beckman SW41 rotor, 15°C, 27,500 rpm, 20 h) as described by Sambrook et al. (45). Fragments of 2.3 to 4.3 kb were collected, dialyzed against 1 mM EDTA-10 mM Tris-Cl (pH 8.0), and inserted into the BamHI site of pUC18. Approximately 11,000 transformants were obtained with strain DH5.

(ii) Nested-PCR amplification of a sodA fragment. The PCR mix contained 100 pmol of each primer, 300 ng of genomic DNA, 0.2 mM deoxynucleoside triphosphate (Pharmacia), 1.25 mM MgCl₂, 1× Taq polymerase buffer, and 0.4 U Taq DNA polymerase (Goldstar). The reaction parameters were 4 cycles (2 min at 94°C, 2 min at 40°C, 2 min at 72°C) followed by 30 identical cycles with 45°C as the annealing temperature and a final elongation step of 10 min at 72°C. Degenerate primers were designed according to the conserved amino acid regions 2, 3, and 4 of SOD proteins defined by Heinzen et al. (21): 5'CCAYCAYGACAAGCAYC3' (KHH3), 5'CCANCCNGANCCRAA3' (FGS1), 5'TTYGGNTCNGGNTGGGCNTGG3' (WAW1), 5'TARTANGCRTGYTCCCANACRTC3' (DVWEH), and 5'RTAGTASGCARGTYCCC3' (WEH6). Two primer combinations, KHH3-DVWEH and KHH3-WEH6, allowed amplification of a fragment of approximately 400 bp from Rm5000 genomic DNA. Using nested primers (region 3) in both orientations, the expected size fragments were obtained by the pairs WAW1-DVWEH/WEH6 and KHH3-FGS1. The sequence of the amplified 422-bp KHH3-DVWEH fragment was determined and found to be very similar to those of known Mn/FeSODs. This fragment was radiolabeled and used as a probe to screen the genomic library by colony hybridization (45). A clone carrying a plasmid with a 2.7-kb insert (pRS41) was isolated, and subcloning located the sodA gene in a 1.5-kb EcoRI-HindIII fragment (pRS41.1).

General techniques. The molecular cloning techniques and gel electrophoresis were essentially as described by Sambrook et al. (45). Small-scale preparation of bacterial DNA was by the procedure of Chen and Kuo (11). Pure plasmid DNA was prepared by using a Qiagen kit. DNA fragments were isolated from agarose gels with a QIAEX kit (Qiagen). Southern blotting, hybridization, and detection methods were previously described (48), and the DNA was labeled with [-³²P]dATP (ICN, Orsay, France), using the Megaprime DNA labeling system (Amersham). Plasmid proteins were labeled in maxicells as previously described (46). Plasmid double-stranded DNA was sequenced by the dye terminator method on an ABI model 377 DNA sequencer. The sequence of 1,196 bp from pRS41.1 was obtained by primer walking on both strands.

RNA isolation and analysis. RNA was isolated from a S. meliloti culture at an optical density at 600 nm (OD₆₀₀) of 1.6 by the method of Babst et al. (2). RNA (10 µg) was separated on a 1.0% gel using the RNA Transcripts 9488-363 nt (USB Amersham) as size markers. Northern blotting and hybridization (at 42°C in 50% [vol/vol] formamide) were essentially as described by Sambrook et al. (45). An internal sodA fragment amplified by PCR with primers 5'CGGTCTTTCCGATC3' and 5'TGCGCCGTGGAC3' was used as the probe. Primer extension was carried as previously described (58), using primer 5'GTCATAGGGAAGGTTCGGCA3', complementary to nt 255 to 274. The extended primer was loaded onto a sequencing gel next to sequencing reactions performed with the same primer by the dideoxy-chain termination method with a Sequenase kit version 2.0 (U.S. Biochemical Corp.) with [-³⁵S]dATP (ICN).

Preparation of cell lysates and SOD activity assay. Saturated cultures of E. coli and S. meliloti were harvested by centrifugation, washed, and disrupted by sonication. The doubling time being much longer for S. meliloti than for E. coli, saturation (OD of 4 to 5) was reached for E. coli and S. meliloti overnight and after 2 days, respectively. The total protein concentration was measured by using the bicinchoninic acid reagent (Pierce Chemical Company) and bovine serum albumin as the standard. Specific activity was determined by using the standard xanthine oxidase/cytochrome c assay at pH 7.8 (34). SOD activity in nondenaturing 10% polyacrylamide gels was visualized by nitroblue tetrazolium negative staining (4). The gels were stained in presence of 5 mM H₂O₂ or 10 mM potassium cyanide (KCN) for activity inhibition studies.

Protein purification and metal cofactor determination. The SodA from S. meliloti was purified essentially as described by Slykhouse and Fee (49). The soluble protein fraction from 15 g of cells was precipitated at 90% ammonium sulfate. The resulting precipitate was suspended in 5 mM potassium acetate (pH 5.5), dialyzed, and run on a CM50 (Pharmacia) column equilibrated with 5 mM potassium acetate. The column was eluted stepwise with 10, 20, 30, 40, and 50 mM potassium acetate. The fractions containing SOD activity (40 and 50 mM) were pooled, dialyzed against 5 mM potassium phosphate (pH 7.4) for 2 days, loaded onto a DEAE column (Pharmacia) equilibrated with the same buffer, and eluted stepwise with 10 to 60 mM potassium phosphate. The SOD was eluted at 50 and 60 mM potassium phosphate (pH 7.4). These fractions were pooled and concentrated with a 10-kDa-cutoff Centricon (Amicon).

Nucleotide sequence accession number. The S. meliloti sodA sequence has been registered in GenBank and assigned accession no. AF110770.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

SOD activity in S. meliloti and sodA gene cloning. Previous results based on the inhibition of SOD activity in two S. meliloti strains by H₂O₂ and KCN suggested that strain 102F28 had an FeSOD (52) and strain 102F51 an MnSOD (6). The SOD in S. meliloti Rm5000 in free-living growth conditions (Fig. 1A) gave a single activity band on nondenaturing PAGE. The enzyme activity was not inhibited by H₂O₂ (Fig. 1B) and KCN (data not shown), suggesting an MnSOD.

View larger version (46K): [in this window] [in a new window]   FIG. 1.   Detection of SOD in E. coli and S. meliloti on nondenaturing polyacrylamide gels stained for SOD activity. (A) No inhibitors; (B) with 5 mM H2O2. Lanes: 1, E. coli DH5; 2, S. meliloti Rm5000; 3, E. coli sodA sodB strain QC1799; 4, QC1799/pRS41.1 with S. meliloti sodA gene. Lanes contain crude extracts of saturated cultures (35 µg of total protein). The E. coli MnSOD, hybrid SOD (HySOD), and FeSOD are indicated.

Sequence of sodA from S. meliloti. A total of 1,196 bp from pRS41.1 was sequenced on both strands. There was an open reading frame of 600 nucleotides coding for a 200-residue protein with a theoretical M_r of 22,430 and a pI of 5.8. A ribosome binding site similar to the Shine-Dalgarno sequence of E. coli was located 8 bp upstream of the ATG initiation codon. A 10-bp inverted repeat sequence followed by a stretch of T's was found 25 bp downstream of the stop codon and could function as a rho-independent RNA polymerase terminator. The G+C content of the sodA gene was 59%, similar to that of other S. meliloti genes.

View larger version (23K): [in this window] [in a new window]   FIG. 2.   S. meliloti sodA transcript analysis. (A) Northern blot analysis of S. meliloti mRNA with an internal sodA fragment as a probe; (B) determination of the transcription start site of sodA. Lanes: P, primer extension product; G, A, T, and C, sequence obtained with the same primer. The 10 promoter region and the transcription start point (*) are in boldface. rbs, ribosome binding site.

Location of the sodA gene in the chromosome. The genome of strain Rm5000 has a chromosome of 3.54 Mb plus two symbiotic megaplasmids, pSym-a (pRmSU47a) of 1.34 Mb and pSym-b (pRmSU47b) of 1.7 Mb (22). These plasmids were mobilized into the Agrobacterium tumefaciens GMI9023, creating the hybrid strains At125 (carrying pSym-b) and At128 (carrying pSym-a) (14). The genomic DNAs of Rm5000, GMI9023, and hybrid strains were probed with a sodA fragment by Southern blotting (data not shown). No specific hybridization signal was obtained with the hybrid A. tumefaciens strains, indicating that the gene lies in the S. meliloti chromosome, unlike the case for the symbiotic plasmid-specific genes.

Expression of sodA gene complements SOD-deficient E. coli mutant. E. coli sodA sodB recA strain (QC2375) cannot survive in aerobic conditions, due to unrepaired DNA oxidative damage (57). Transformation with plasmids pRS41 and pRS41.1 did not rescue the aerobic growth (Fig. 3A). This absence of complementation of SOD deficiency was surprising, because the SOD was seen in protein extracts from aerobically grown QC1799 (sodA sodB)/pRS41.1 (Fig. 1). To test whether the absence of complementation was due to a defect of expression, the sodA gene was expressed under the control of the synthetic IPTG-inducible tac promoter (pRS51). Production of the corresponding protein (23 kDa) was verified in maxicells (data not shown). Expression of SOD from pRS51 restored aerobic survival of QC2375 (Fig. 3A), indicating that the S. meliloti enzyme complements the E. coli SOD deficiency. Two observations suggested explanations for the failure of pRS41.1 to complement QC2375. Measurements of sodA expression in E. coli from a plasmid containing a transcriptional sodA-lacZ fusion (plasmid pRS58) showed that sodA from S. meliloti was weakly expressed during exponential growth, but protein production increased upon entry into stationary phase (Fig. 3B). The sodA-lacZ fusion was not expressed in anaerobiosis (Fig. 3B), and no detectable SOD activity was found in anaerobic crude extracts from QC2375/pRS41.1 (Table 2). Thus, a shift from anaerobiosis to aerobiosis results in lethal damage to QC2375 before enough SOD has been produced from pRS41.1.

View larger version (23K): [in this window] [in a new window]   FIG. 3.   (A) Aerobic survival of E. coli QC2375 (sodA sodB recA) transformed with plasmids pUC18, pRS41.1, pJF119EH, and pRS51. Saturated anaerobic cultures were plated under anaerobic conditions (black) and aerobic conditions without (white) and with (shaded) 2 mM IPTG. CFU were counted after incubation overnight. Values are means of at least three independent experiments, and bars represent standard deviations. (B) Expression of S. meliloti sodA-lacZ in E. coli. Strain QC2461 was transformed with pRS58 and assayed for -galactosidase activity in aerobiosis (circles) and anaerobiosis (squares).

The sodA gene encodes a cambialistic SOD. The deduced S. meliloti sodA amino acid sequence was used to search protein databases on the National Center for Biotechnology Information BLAST server. It was very similar to prokaryotic and eukaryotic SODs, being most like FeSODs, with 48% identity to Rhodobacter capsulatus and Chlamydomonas reinhardtii FeSODs. The majority of residues used to distinguish between the Mn- and Fe-type enzymes matched an FeSOD (24, 33, 37). It also had unusual features, with residues not commonly found in SODs such as tyrosine at position 74 (74Tyr), 78His, 82Trp, and 164Ser (Fig. 4). However, the predicted three-dimensional structure of the S. meliloti SodA (Swiss-Model; Glaxo Wellcome Experimental Research, Geneva, Switzerland) showed a typical secondary structure of Mn/FeSODs with two domains, the N terminal with two -helices and the C terminal with two -helices, followed by three -strands and two -helices (data not shown) (9, 24, 37).

View larger version (21K): [in this window] [in a new window]   FIG. 4.   Comparison of residues from S. meliloti SodA, cambialistic SODs, and three atypical FeSODs with corresponding residues that distinguish between FeSODs and MnSODs (S. meliloti SodA amino acid sequence numbering). Typical FeSOD and MnSOD consensus residues were obtained from comparison of 19 and 42 sequences, respectively. , ligands to metal cofactor; *, +, and ¥, no typical residue of alternative metal was found. Signs above the typical FeSOD sequence: *, zero to one mismatch; +, two to five mismatches. Signs below typical MnSOD sequence: *, zero to one mismatch; +, two to six mismatches. X, variable; boldface, typical FeSOD residues; bold italic, typical MnSOD residues; underline, residues found rarely among the 70 sequences. Amino acid sequences of SODs from Bacteroides fragilis (P53638), Porphyromonas gingivalis (P19665), Aquifex pyrophilus (AE000743), Tetrahymena pyriformis (P19666), Methanobacterium thermoautotrophicum (Q60036), Mycobacterium tuberculosis (P17670), Propionibacterium shermanii (P80293), Methylomonas strain J (P23744), and Streptococcus mutans (P09738) are from SWISS-PROT and GenBank databases.

View larger version (21K): [in this window] [in a new window]   FIG. 5.   (A) Purification of S. meliloti SOD as visualized by Coomassie brilliant blue staining of an SDS-polyacrylamide gel. Lanes: 1, Rainbow molecular weight marker (Amersham); 2, ammonium sulfate 90% precipitate; 3, flowthrough from a CM50 column; 4, elution from a CM50 column; 5, sixfold-concentrated eluate from DEAE column. (B) Molecular mass of native SodA determinated by HPLC-gel filtration. The standards used were bovine gamma globulin (158,000 Da), chicken ovalbumin (44,000 Da), horse myoglobin (17,000 Da), and vitamin B12 (1,350 Da).

View larger version (109K): [in this window] [in a new window]   FIG. 6.   Activity of reconstituted SodA from S. meliloti Rm5000 with manganese and iron. (A) No inhibitors; (B) with 5 mM H2O2. Lanes: 1, E. coli DH5; 2, crude extract; 3, apoenzyme; 4, Mn-reconstituted SOD; 5, Fe-reconstituted SOD.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

The SOD from S. meliloti Rm5000, the only cytoplasmic SOD detectable in free-living bacteria, belongs to the family of cambialistic Mn/FeSODs. Cambialistic SODs generally function efficiently with either manganese or iron at their active sites. The SODs from Propionibacterium shermanii (35) and P. gingivalis (1) have similar activities with both metals. In contrast, Methylomonas strain J (61) is more active with manganese, both native and reconstituted FeSOD showing less than 10% of the activity of the MnSOD. Similarly, in S. meliloti, the Mn-reconstituted SOD from apo-SOD is more active than the Fe-reconstituted SOD (15% activity with Fe compared to Mn).

Comparison of sequences of FeSODs and MnSODs and structural data led several authors to identify amino acid residues in the metal ligand environment that might account for metal specificity (24, 33, 37). We aligned (by MaxHom [47] at the Predict Protein server) the S. meliloti SodA amino acid sequence with 70 complete published sequences of SODs including 42 MnSODs, 19 FeSODs, 6 cambialistic SODs, and 3 atypical FeSODs. Alignment revealed several unusual features. While the S. meliloti native enzyme, at least in free-living growth conditions, is essentially a manganese-containing SOD, sequence comparison shows higher similarity to FeSODs (Fig. 4). Among residues that highly discriminate between the typical FeSODs and MnSODs, seven are of Fe type and only two are of Mn type in S. meliloti SodA, while others are atypical. This clearly classifies the S. meliloti sequence among those of atypical FeSODs. In typical FeSODs, the solvent interacts with the 72Gln residue (S. meliloti SodA numbering), and with the 144Gln in typical MnSODs. The glutamine residues occupy very similar positions in the structure (29). The presence of a 72Gln and a 144Gly in the S. meliloti SodA suggests that 72Gln interacts with the solvent, as in FeSODs. Further, several highly conserved residues are not found in S. meliloti SodA. The 85Pro conserved in 58 of 70 sequences, 104Phe in 64 of 70, 106Ser in 59 of 70, and 164Ala in 68 of 70 are replaced by Lys, Leu, Gly, and Ser, respectively. A 78His residue nearby 76His metal ligand is unique among all sequences analyzed. The high activity of S. meliloti SOD when it incorporates manganese is puzzling. This is a unique example of an Fe-type protein, according to its specific residues, that is more active with manganese. The Mycobacterium tuberculosis FeSOD, in contrast, with an Mn-type sequence and a 72Gly, binds iron in an Mn-type way with a 144His acting as the metal solvent ligand (24). The many unusual residues in the environment of the active site in S. meliloti SodA may contribute to a subtle change that favors activation with manganese.

The Fe-reconstituted SOD from S. meliloti is not sensitive to 5 mM H₂O₂. The inactivation of E. coli FeSOD by H₂O₂ depends on the presence of iron at the active site and is correlated with oxidation of tryptophan residues (7). The tryptophan at position 74, replaces by a valine in the H₂O₂-resistant FeSOD from Methanobacterium thermoautotrophicum, has been proposed to be responsible for inactivation (37, 54). However, some findings were incompatible with this hypothesis. For example, a valine in this position does not make the FeSODs from Tetrahymena pyriformis (3) and Mycobacterium tuberculosis (10) resistant to H₂O₂, and the FeSOD from Campylobacter jejuni, which has a tyrosine instead of tryptophan, is sensitive (39). The cambialistic SODs all lack a 74Trp (Fig. 4). However, the reconstituted SODs from B. fragilis (20) and P. gingivalis (1) are sensitive with iron at the active site and resistant with manganese. The Fe-substituted form of cambialistic SOD from Propionibacterium shermanii is only partially inactivated (60%) when exposed to 5 mM H₂O₂, and a mutant in which the tryptophan has been substituted for valine is completely inactivated (17). Conversely, mutation of 74Trp to Val in the sensitive FeSOD from Plasmodium falciparum did not reverse H₂O₂ sensitivity, although it was shown that iron was more stable in the mutant during inactivation (19). Recently, Yamakura et al. (62) demonstrated that oxidation of the conserved 161Trp residue was responsible for inactivation of the Fe form of P. gingivalis cambialistic SOD. Altogether, these results suggest that the difference in H₂O₂ sensitivity is caused by the fine-tuning of amino acid environment determining the redox activity of Fe center with regard to H₂O₂, rather than by the position of tryptophan H₂O₂-sensitive residues (62). The unusual active-site environment in S. meliloti SOD may explain the resistance of the Fe-reconstituted enzyme.

It has been demonstrated that the E. coli MnSOD and FeSOD are not physiologically equivalent; the MnSOD associates with DNA (51) and is more efficient in preventing DNA damage, while the FeSOD is more effective in protecting cytoplasmic superoxide-sensitive enzymes (23). The reason why the S. meliloti SodA does not rescue the E. coli sodA sodB recA strain as efficiently as the E. coli MnSOD is unclear. Nonetheless, the atypical nature of the S. meliloti SodA might account for the reduced protection of DNA oxidative damage.

It was shown that incorporation of metal in cambialistic SODs depends on its availability in the medium (31, 33, 35) and is oxygen dependent, iron being preferentially used under anaerobiosis and manganese under aerobiosis (1). S. meliloti encounters two completely different environments during its life cycle, the soil and the nodules. The free oxygen concentration in the nodules is low (50), and iron is abundant (5). Also, manganese is not available in high concentration in the cytoplasm of eukaryotic cells, since it is actively pumped into organelles like the lysosomes and Golgi apparatus (14a). Moreover, acidic conditions within the nodule should favor higher activity of an iron-substituted SOD (59, 60). The transition from the aerobic cycle to the microaerobic nodule environment, together with increased iron and presumably reduced manganese availability, might have encouraged the evolution of a cambialistic SOD that is active with manganese when free-living and active with iron in nodules.