INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Lactic acid bacteria (LAB) are essential for the manufacture of a variety of dairy products, such as cheese and yogurt. Because they are auxotrophic for a number of amino acids, LAB depend upon a complex proteolytic system to obtain essential amino acids from caseins during growth in milk (23). This proteolytic system also plays an important role in cheese flavor development (20). The hydrolysis of casein into amino acids for use by LAB is initiated by a cell envelope proteinase (CEP) which hydrolyzes casein into oligopeptides (23). Oligopeptides are then transported into the bacterial cell via an oligopeptide transport system (Opp) (17, 42). Once the oligopeptides are inside the cell, intracellular peptidases hydrolyze them to free amino acids (25, 27).

Several CEPs (or PrtP proteinases [PrtPs]) from various lactococcal strains have been characterized both biochemically and genetically (23). PrtP is synthesized as a pre-pro-protein of approximately 200 kDa. Autocatalytic cleavage of the pro-region results in a mature, active protein with a molecular mass of approximately 180 to 190 kDa (23). The genes encoding PrtPs have been sequenced from a number of different Lactococcus lactis strains (8, 18, 22, 24, 44, 46). The lactococcal PrtPs are more than 98% identical at the amino acid level (21). Despite this high degree of sequence identity, PrtPs can be classified into at least eight different groups based on substrate specificity by use of _s1-casein fragment 1-23 [_s1-CN (f1-23)] (4, 10, 11). Protein engineering studies have shown that a small number of amino acid substitutions can result in changes in substrate specificity (5, 35, 36, 43).

Much less is known about the CEPs of lactobacilli. The genes encoding CEPs have been cloned from Lactobacillus paracasei subsp. paracasei and Lactobacillus delbrueckii subsp. bulgaricus (13, 15). The deduced CEP amino acid sequences are 95 and 27% identical, respectively, to those of the lactococcal PrtPs. Comparisons of different lactobacilli have indicated heterogeneity of cell surface proteinase activity within the genus Lactobacillus (14, 19). Recent studies have indicated that Lactobacillus helveticus may contain two proteinases with different substrate specificities (14). In addition, a zinc-dependent cell surface proteinase has been purified from L. delbrueckii subsp. bulgaricus (39). This paper describes the genetic and physiological characterization of a CEP from L. helveticus CNRZ32.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains and growth conditions. All cultures were maintained at 80°C in 11% nonfat dry milk-10% glycerol. Escherichia coli DH5 (Gibco-BRL Life Technologies Inc., Gaithersburg, Md.) was grown in Luria-Bertani medium (32). L. helveticus CNRZ32 was propagated in MRS medium (Difco Laboratories, Detroit, Mich.) without shaking at 42°C. Strains for Southern hybridization were obtained from the American Type Culture Collection (Rockville, Md.). L. helveticus L89 was kindly provided by Fred A. Exterkate from The Netherlands Institute for Dairy Research collection. Growth studies with milk were performed by use of twice-steamed, pasteurized skim milk (pasteurized skim milk was steamed for 20 min, kept at 42°C for 2 h, and then steamed for another 20 min) as described previously (6).

Molecular cloning techniques. Recombinant DNA techniques were essentially those described by Sambrook et al. (32). Restriction enzymes and T4 DNA ligase were purchased from Gibco-BRL Life Technologies and were used according to the manufacturer's instructions. E. coli transformation was performed with a Gene Pulser by following the instructions recommended by the manufacturer (Bio-Rad Laboratories, Richmond, Calif.). Transformation of L. helveticus was performed essentially as described previously (6). All antibiotics were obtained from Sigma Chemical Co. (St. Louis, Mo.).

PCR. All primers were synthesized by Gibco-BRL Custom Primers (Grand Island, N.Y.). PCR amplifications were performed with a Perkin-Elmer (Norwalk, Conn.) model 480 thermal cycler. Two primers were designed from an alignment of the conserved regions surrounding the active-site residues of the proteinase genes (Asn₁₉₆ and Ser₄₃₃; numbering is that of L. lactis subsp. cremoris SK11 CEP) from various LAB. The sequences of the primers were as follows: Jp1, 5'GTTATCTCTGCTGGGAAC3'; and Jp2, 5'GTGAAGCCATTGAAGTCC3'. An inverse PCR strategy was used to identify adjacent DNA regions (32). CNRZ32 chromosomal DNA (1 to 5 µg) was digested with an appropriate restriction enzyme. The digested DNA was incubated at 65°C for 20 min to inactivate the restriction enzyme, precipitated in ethanol, and resuspended in 15 µl of deionized H₂O. The digested DNA was self-ligated overnight at 15°C in a 20-µl reaction mixture. A 1-µl sample of the overnight ligation mixture was used as a template for PCR. As the known sequenced progressed, new primers were designed accordingly.

View larger version (53K): [in this window] [in a new window]   FIG. 1.   Partial nucleotide and deduced amino acid sequence of the L. helveticus CNRZ32 prtH gene. The arrowhead indicates the start of transcription. A putative Shine-Delgarno sequence is underlined. The putative cleavage site for the pre-pro-region is marked with a vertical arrow. The putative active-site residues are boxed. Long horizontal arrows indicate primers used for DNA probe synthesis. The stop codon is indicated with an asterisk. Short horizontal arrows indicate the putative transcriptional terminator.

DNA sequence analysis. PCR products were purified with a Qiagen Inc. (Hilden, Germany) PCR purification kit. DNA sequencing reactions were performed with a Perkin-Elmer model 480 thermal cycler and a Prism Ready Reaction DyeDeoxy terminator cycle sequencing kit (Applied Biosystems, Inc., Foster City, Calif.). The DNA sequence determination was conducted at the Nucleic Acid and Protein Facility of the University of WisconsinMadison Biotechnology Center with an ABI Prism model 377XL DNA automated sequencer. Sequences were analyzed with the Genetics Computer Group (Madison, Wis.) sequence analysis program. Protein homology searches were performed by use of the BLAST network service (1). All reported DNA sequence data was confirmed by sequencing both DNA strands from at least two independent PCR products.

RNA methods. Total RNA was isolated by use of an SV Total RNA Isolation System (Promega Corporation, Madison, Wis.). Mapping of the 5' end of the prtH transcript was conducted by use of a 5' rapid amplification of cDNA ends (5' RACE) kit (version 2.0; Gibco-BRL). The nucleotide sequences of the three prtH-specific primers were 5'ATGATAGAAACGACGGTACC3' (Jp16), 5'AACGGTTGAAACGTTAGC3' (Jp43), and 5'GCTTGGTTAGTAATTGCC3' (Jp45).

Southern blot analysis. Chromosomal DNA isolation and Southern hybridization procedures were performed as described previously (9). Probe synthesis was performed as described for a Genius kit (Boehringer Mannheim Biochemicals, Indianapolis, Ind.) with a 2.0-kb internal fragment from the catalytic domain of prtH. The template used for probe synthesis was made by PCR amplification with primers Jp22 (5'CTCTATCCGTCGTATCTGTG3') and Jp23 (5'GCTTGGATAGTAGCGTTAGC3'). Hybridizations were carried out at 42°C. Low-stringency conditions were achieved by use of 10% formamide in the hybridization buffer.

Construction of a prtH deletion mutant of CNRZ32. Primers Jp22bam (primer Jp22 with a BamHI extension at the 5' end) and Jp23bam (primer Jp23 with a BamHI extension at the 5' end) were synthesized. The Jp22bam-Jp23bam PCR product (described above) was digested with BamHI and ligated into pTRKL2. The resulting plasmid was used as a template for reverse PCR with primers Jp25 (5'GGTGAACAAACTGAAGACG3') (nucleotides 1144 to 1162) and Jp26 (5'ATTGTGACCGTATGGCACT3') (nucleotides 876 to 858). The PCR product was self-ligated and transformed into E. coli DH5. The construct that was created contained a 270-bp internal in-frame deletion subcloned into pTRKL2. An integration vector was constructed by subcloning the deletion fragment into pSA3. The deletion was confirmed by PCR and DNA sequencing. The resulting construct was used to construct a prtH deletion derivative of CNRZ32 by gene replacement as described previously (2) with modifications described by Christensen and Steele (7). Transformation of CNRZ32 was performed at 37°C. Six transformants were chosen at random for spread plating on MRS medium plates containing 50 ng of erythromycin per ml at 44°C (nonpermissive temperature for pSA3). Integrants were grown in MRS broth at 37°C without erythromycin, and erythromycin-sensitive colonies were selected for further characterization.

Proteinase activity. Cells were grown from frozen stocks in MRS broth to the logarithmic growth phase and then were transferred to citrate-milk medium that had been steamed for 30 min. Cells were grown to an optical density of 0.7 absorbance unit at 590 nm, harvested by centrifugation, washed twice with 50 mM Na₂PO₄ buffer (pH 6.8), and resuspended in Jennes-Koops buffer (16). Isolation of _s1-CN (f1-23) was performed as described by Exterkate and Alting (12). L. helveticus whole cells were incubated in Jennes-Koops buffer with the _s1-CN (f1-23) fragment at 30°C for 5 min, 15 min, 30 min, or 1 h at pH 6.5 (16). Samples from the reaction mixture were analyzed by high-performance liquid chromatography (HPLC) as described previously (4). Several hydrolysis products [_s1-CN (f1-6), _s1-CN (f18-23), _s1-CN (f9-23), and _s1-CN (f10-23)] were identified by mass spectrometry at the Nucleic Acid and Protein Facility of the University of WisconsinMadison Biotechnology Center. All other peptides were identified by use of standards as described previously (4).

Nucleotide sequence accession number. The GenBank accession no. for the nucleotide sequence reported in this paper is AF133727.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Identification and sequencing of a cell envelope-associated serine proteinase gene (prtH) from L. helveticus CNRZ32. PCR amplification was used to identify a CEP gene from L. helveticus CNRZ32. A single 700-bp PCR product was obtained and sequenced (data not shown). New primers were designed based on the sequence of this product, and inverse PCR was used to identify the adjacent DNA regions.

Comparison with other cell surface proteinases. A comparison of the N-terminal region of PrtH with those of other CEPs indicates that PrtH may be synthesized as a pre-pro-protein. The N-terminal segment of the deduced PrtH is positively charged and is followed by a putative membrane-spanning domain. This region closely resembles the signal peptide sequence for gram-positive bacteria (33, 38). The predicted cleavage site for the signal peptide is at Ala₁₅₂-Glu₁₅₁ (29). Adjacent to the signal peptide is a region that has 51% amino acid identity with the pro-region of the PrtPs. This finding suggests that PrtH will be processed similarly. Such processing would result in a mature PrtH of 1,673 amino acids and having 45% identity with the lactococcal PrtPs.

Distribution of prtH within L. helveticus. Southern blot analysis was used to determine the distribution of prtH among various strains of L. helveticus (CNRZ32, ATCC 15009, ATCC 10797, ATCC 12046, ATCC 8018, ATCC 15807, ATCC 10386, and L89). Under low-stringency conditions (10% formamide and 42°C), a prtH DNA probe hybridized only to a 4.1-kb DNA fragment from L. helveticus CNRZ32 and L89 (data not shown). Because the hybridization patterns were identical for CNRZ32 and L89, we compared the DNA sequences of the substrate binding regions for these two proteinases. The L89 substrate binding region was amplified by PCR with primers specific for the CNRZ32 prtH gene. Sequence analysis revealed that the L89 subtilase-like substrate binding region is 100% identical at the nucleotide level to prtH (data not shown). Although L. helveticus ATCC 15009, ATCC 10797, ATCC 12046, ATCC 8018, ATCC 15807, and ATCC 10386 have cell surface proteinase activity, as measured by the hydrolysis of _s1-CN (f1-23) (data not shown), Southern blot analysis indicates that they do not contain a prtH-like gene.

Physiological role of PrtH. To determine the physiological role of PrtH, an in-frame deletion was constructed in prtH. A 1.7-kb DNA fragment internal to prtH was constructed to contain a deletion of 270 bp. This deletion removed the active-site residue, His₉₄, and the subtilase-like substrate binding region. The 1.7-kb prtH deletion construct was subcloned into the plasmid vector pSA3 and used to create a prtH deletion mutant of CNRZ32 (data not shown). Growth in milk of CNRZ32 and the prtH deletion mutant was examined. No difference in acidification rate or maximum specific growth rate was observed between CNRZ32 and the prtH deletion mutant (data not shown).

Characterization of cell surface proteinase activity and specificity with _s1-CN (f1-23) as a substrate. To determine the cell surface proteinase activity and specificity of CNRZ32 whole cells, _s1-CN (f1-23) was used as a substrate for hydrolysis. The hydrolysis products were analyzed by reverse-phase HPLC (Fig. 2A). Brief incubations (5 to 15 min) with CNRZ32 whole cells results in the formation of eight peptides: _s1-CN (f1-9), _s1-CN (f1-6), _s1-CN (f1-17), _s1-CN (f1-16), _s1-CN (f17-23), _s1-CN (f18-23), _s1-CN (f9-23), and _s1-CN (f10-23). This finding indicates that several bonds are preferentially hydrolyzed. Hydrolysis of the Leu₁₆---Asn₁₇ and Asn₁₇---Glu₁₈ bonds results in the formation of four peptides: _s1-CN (f1-16), _s1-CN (f17-23), _s1-CN (f1-17), and _s1-CN (f18-23). Hydrolysis of the Gln₉---Gly₁₀ bond results in the formation of two peptides: _s1-CN (f1-9) and _s1-CN (f10-23). Other bonds that appear to be hydrolyzed are the Ile₆---Lys₇ and His₈---Gln₉ bonds.

View larger version (16K): [in this window] [in a new window]   FIG. 2.   Reverse-phase HPLC patterns of the hydrolysis products from s1-CN (f1-23) after 15 min of incubation with wild-type CNRZ32 whole cells (A) and CNRZ32 prtH deletion mutant whole cells (B).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

A CEP that has 45% identity to the lactococcal PrtPs was identified in L. helveticus CNRZ32. The highest sequence identity (65%) is within the N-terminal catalytic domain. The substrate binding region of PrtH is distinct from those of all previously identified CEPs; thus, PrtH is classified as a new group, designated group I (Table 1).

Much is known concerning structure-function relationships in the subtilase family (30). An alignment of subtilisin BPN', thermitase, and the CEPs from LAB reveal regions that are highly conserved (Table 1). Gln₁₅₆ and Tyr₂₁₇ have been shown to effect substrate specificity in subtilisins (45). All identified CEPs from LAB contain Ser and Met at the corresponding positions. Interestingly, amino acid substitutions at position 156 in the subtilisins can alter the pH profile by affecting the pK_a of the active-site His (31). Comparisons such as this can lead to protein engineering strategies to change the substrate specificity and pH profile for CEPs.

These studies reveal significant differences in the proteolytic systems of CNRZ32 and lactococci. First, CNRZ32 appears to have at least two proteinases present at the cell surface. A prtH deletion mutant of CNRZ32 is indistinguishable from wild-type CNRZ32 in growth rate and acid production in milk. This finding is in contrast to the requirement of PrtP for rapid growth and fast acid production in lactococci. The most probable explanation is the presence in CNRZ32 of a second proteinase that is sufficient for rapid growth and fast acid production in milk. Recent studies support the hypothesis of at least two proteinases present at the cell surface of some lactobacilli (14, 40). In addition to a serine proteinase, L. delbrueckii subsp. bulgaricus ACA DC235 has a zinc-dependent cell surface proteinase (39).

Characterization of cell surface proteinase activity further supports the hypothesis that CNRZ32 has at least two cell surface proteinases. It appears that PrtH hydrolyzes the Leu₁₆---Asn₁₇ and Asn₁₇---Glu₁₈ bonds of _s1-CN (f1-23), resulting in the formation of peptides _s1-CN (f1-16), _s1-CN (f17-23), _s1-CN (f1-17), and _s1-CN (f18-23). These peptides are not detected from hydrolysis of _s1-CN (f1-23) in the prtH deletion mutant of CNRZ32. However, peptides _s1-CN (f1-9), _s1-CN (f10-23), _s1-CN (f1-6), and _s1-CN (f9-23) are detected in approximately equal quantities in both wild-type CNRZ32 and the prtH deletion mutant. Therefore, a second proteinase on the CNRZ32 cell surface is likely responsible for the formation of these peptides. These findings demonstrate that CNRZ32 has at least two cell surface proteinases that differ in substrate specificity.

Cell surface proteinase activity was detected in all L. helveticus strains tested (data not shown). However, Southern blot analysis indicates that prtH is not broadly distributed within the species. A prtH DNA probe hybridized to only L. helveticus CNRZ32 and L89. Sequence analysis of the L89 CEP substrate binding region revealed 100% identity at the nucleotide level to prtH. The L89 proteinase has been purified, and its substrate specificity has been characterized (26). Like PrtH, many CEPs, including the L89 CEP, are able to hydrolyze the Leu₁₆---Asn₁₇ and Asn₁₇---Glu₁₈ bonds (23). Although we expect PrtH and the L89 CEP to have identical substrate specificities, further comparisons are not possible because PrtH has not yet been purified and CNRZ32 has at least two cell surface proteinases. The proteinase activity detected in the other L. helveticus strains examined is most likely due to an unknown cell surface proteinase that does not have significant sequence similarity to PrtH.

Neither PrtH nor PrtB has the cell membrane anchor motif LPxTG, which has been found in many cell surface proteins, including the lactococcal PrtPs (28). However, both PrtH and PrtB have C-terminal regions similar to those of S-layer proteins from lactobacilli (3). The C-terminal region of PrtB (amino acid residues 1743 to 1938) has up to 25% identity to the C-terminal region of the S-layer protein from L. acidophilus (3). These results suggest that PrtH and PrtB are anchored to the cell envelope in a manner similar to that of S-layer proteins.