Previous Article | Next Article 
Journal of Bacteriology, August 1999, p. 4711-4718, Vol. 181, No. 15
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Serotype 1a O-Antigen Modification: Molecular
Characterization of the Genes Involved and Their Novel
Organization in the Shigella flexneri
Chromosome
Pradip
Adhikari,
Gwen
Allison,
Belinda
Whittle, and
Naresh K.
Verma*
Division of Biochemistry and Molecular
Biology, Faculty of Science, The Australian National University,
Canberra, ACT 0200, Australia
Received 15 March 1999/Accepted 7 May 1999
 |
ABSTRACT |
The factors responsible for serotype 1a O-antigen modification in
Shigella flexneri were localized to a 5.8-kb chromosomal HindIII fragment of serotype 1a strain Y53. The entire
5.8-kb fragment and regions up- and downstream of it (10.6-kb total) were sequenced. A putative three-gene operon, which showed homology with other serotype conversion genes, was identified and shown to
confer serotype 1a O-antigen modification. The serotype conversion genes were flanked on either side by phage DNA. Multiple insertion sequence (IS) elements were located within and upstream of the phage
DNA in a composite transposon-like structure. Host DNA homologous to
the dsdC and the thrW proA genes was located
upstream of the IS elements and downstream of the phage DNA,
respectively. The sequence analysis indicates that the organization of
the 10.6-kb region of the Y53 chromosome is unique and suggests that
the serotype conversion genes were originally brought into the host by
a bacteriophage. Several features of this region are also
characteristic of pathogenicity islands.
 |
TEXT |
Shigella flexneri is an
important human pathogen responsible for the majority of cases of
endemic bacillary dysentery prevalent in developing nations. It has
been estimated that shigellosis affects 200 million people worldwide
and causes at least 650,000 deaths among children under 5 years of age
per year (29). Poor sanitation and contaminated water
supplies contribute to the infection by and spread of
Shigella. Due to the expense involved in treating and
preventing the disease, the development of an effective vaccine is required.
Evidence suggests that the immune response to shigellosis is serotype
specific and that the O antigen acts as a protective epitope
(22). S. flexneri is divided into 13 serotypes
based on the structure of the O antigen, a component of the bacterial lipopolysaccharide (LPS) present on the outer membrane of the cell
(26). The different S. flexneri serotypes, with
the exception of serotype 6, contain the basic O-specific repeating
tetrasaccharide unit which consists of the following:
3)-
-D-GlcNac-(1
2)-
-L-Rha-(1
2)-
-L-Rha-(1
3)-
-L-Rha-(1
(Fig. 1). The serotype containing
the basic O antigen is referred to as serotype Y (26).
Different serotypes result from modification of the basic O antigen
which occurs through glucosylation and/or O acetylation of one or more
sugars within the repeating unit. The factors responsible for the
conversion to serotypes 2a, 3b, 5a, and X are encoded by lysogenic
bacteriophages (6, 11, 12, 19, 27, 28). The serotype
conversion loci in these phages contain three genes (6, 11, 12,
19). The first two genes are highly conserved and
interchangeable, while the third gene is unique and encodes the
glucosyltransferase, or Gtr, which mediates specific O-antigen
modification. The addition of an O-acetyl group is mediated by an
O-acetyltransferase encoded by the oac gene
(27). The gtrII, gtrV,
gtrX, and oac genes, which are involved in the
conversion to serotypes 2a, 5a, X, and 3b, respectively, have recently
been characterized (6, 11, 12, 19, 27, 28). In each case,
the resident serotype-converting bacteriophages were inducible.
Characterization of the phage genomes revealed that the genes involved
in serotype conversion are located adjacent to the int attP
region and that this organization was conserved in all cases. It is
thought that phage-encoded serotype conversion factors may be used to
develop recombinant, live, oral vaccine strains expressing different
serotypes. SFL124 is an attenuated strain of S. flexneri
serotype Y which has been shown to be safe and effective in human
volunteers, and it provided protective immunity against challenge with
wild-type serotype Y strains in monkeys (13, 14). SFL124 is
a candidate vaccine strain that could be used in the construction of
recombinant vaccines expressing different serotypes.
In serotype 1a strains, a glucosyl group is attached to the GlcNac
residue of the repeating unit by an
-1,4 linkage (Fig. 1). Previous
attempts to induce phage from 1a strains were unsuccessful. A
chromosomal cosmid library was prepared from strain Y53 and probed with
the int gene from SfV. Cosmid pNV394 hybridized to the
int probe, and it was determined that a 5.8-kb
HindIII fragment from this cosmid encoded factors which
mediated the conversion of a serotype Y strain to serotype 1a
(1). We now report on the molecular characterization of the
O-antigen modification genes responsible for serotype 1a specificity,
including their origins and locations in the genome of S. flexneri Y53.
Characterization of the 5.8-kb fragment.
Bacterial strains and
plasmids used in this study are listed in Table
1. Escherichia coli JM109 was
used for routine transformation experiments, while SFL124 was used in
serotype conversion experiments. Bacterial cultures were grown
according to standard procedures in Luria-Bertani broth or agar
(24). When necessary, media were supplemented with
ampicillin (100 µg/ml) or kanamycin (50 µg/ml).
The 5.8-kb
HindIII chromosomal fragment from
S. flexneri serotype 1a strain Y53 was sequenced by generating
successive deletions
with the Erase-a-Base kit (Promega) and filling in
the gaps by
primer walking. The Genetics Computer Group
(University of Wisconsin)
programs and programs available through
the Australian National
Genomic Information Service were used to
analyze sequence data.
Within the 5.8-kb fragment, a total of four
complete open reading
frames (ORFs) and one incomplete ORF were
predicted (Table
2).
Sequences homologous
to IS
600 were found on both ends of the fragment.
ORFs
orf1,
orf2, and
orf3 are
transcribed in the same direction (Table
2). Putative ribosomal binding
sites were identified
upstream of each ORF. A promoter was identified
within a reasonable
distance upstream of
orf1 (

35 region,
nucleotides [nt] 796 to
801;

10 region, nt 811 to 816), and a
potential rho-independent
transcriptional terminator was identified
downstream of
orf3 (nt
3690 to 3715). The general
organization of
orf1,
orf2, and
orf3 and the locations of putative transcriptional and translational
signals
suggest that it is likely that these 3 ORFs form an operon.
A database
search revealed that the proteins encoded by
orf1 and
orf2 exhibit very high degrees of homology (88 to 99%
identity)
to proteins encoded by genes within the serotype conversion
loci
of
S. flexneri bacteriophages SfII (
19), SfV
(
11), and SfX
(
6) (Table
2). Homologues of these
genes are also found in
the
E. coli K-12 genome (
2,
19). Database comparisons revealed
that there are no significant
nucleotide or protein sequences
homologous to
orf3,
suggesting that
orf3 is unique to
S. flexneri 1a.
The general organization of this putative operon is similar
to that in
phages SfII, SfV, and SfX, in which two conserved genes
are followed by
a gene which encodes the specific
glucosyltransferase.
The regions up- and downstream of
orf1,
orf2, and
orf3 were analyzed. The region upstream of
orf1
shows a significant level
of similarity to attachment sites
(
attP) of several bacteriophages.
The nucleotide sequence
between positions 601 and 646 is identical
to the
attP core
sequence of SfV (
11), SfII (
19), P22
(
15),
and DLP12 (
17) (Table
2). Two potential
ORFs present on the
complementary strand,
orf4 and
orf5', were identified downstream
of
orf3 (Table
2). A putative Shine-Dalgarno sequence was identified
upstream of
orf4; however, a promoter sequence was not evident.
The
hypothetical protein encoded by
orf4 is almost identical to
that encoded by
orf3 of SfV (Table
2), which is thought to
play
a role in tail fiber assembly of the phage particle
(
12).
orf5'
is interrupted by IS
600
and is predicted to encode a protein of
170 amino acids. The first 66 amino acids of the Orf5 protein
have a high degree of homology (94%
identity) to the last 66 amino
acids of the protein encoded by
orf2 of SfV (Table
2), which
has no known function
(
12). The Orf5 protein also exhibits various
degrees of
homology to hypothetical proteins encoded by the
E. coli
genome (data not shown). One of these proteins is encoded
by section
214 of the chromosome, which is located downstream
of section 213, where the
orf1 and
orf2 homologues of
E. coli are found (
2).
The general organization of this region in the Y53 chromosome is
remarkably similar to that of other
S. flexneri phages. The
attP sites of SfII and SfV are located immediately upstream
of
the glucosyltransferase genes (
11,
19). This organization
is also conserved in the
Salmonella typhimurium
bacteriophage
P22, which is involved in serotype conversion
(
19). In SfV,
orf3 and
orf2 are
located downstream of the glucosyltransferase
genes (
11,
12). These data suggest that the DNA in this region
of the Y53
chromosome is of phage origin and may be involved in
serotype
conversion.
Functional analysis of orf1, orf2, and
orf3.
To determine if the putative three-gene operon within
the 5.8-kb HindIII fragment is involved in O-antigen
modification, this region of the Y53 chromosome was introduced into
SFL124. PCR was used to amplify orf3, using primers GTRF (5'
AATGGATCCAACCTTTCCTCTTCGCGT [nt 1871 to 1889])
and GTRR (5' CATAAGCTTGTTGTATACGGCAACCAC
[complementary to nt 3759 to 3740]). To amplify
orf1, orf2, and orf3, primers GTRALL
(5' TATGGATTCATCCCATCAACACTGCGC [nt 677 to 694]) and GTRR were used. The nucleotide positions of the primers refer to their positions within the 5.8-kb fragment only, and restriction sites incorporated into the primers are underlined. Plasmid pNV462 (Table 1)
was used as a template for both reactions. The orf3 PCR
product was digested with BamHI and HindIII
and cloned into pUC18 to form pNV711. A 3.1-kb fragment containing the
three ORFs was first cloned into pCR2.1 (Invitrogen) and then subcloned
into the BamHI and HindIII sites of pUC18 to
form pNV712. In both constructs, the lac promoter of the
vector was in the correct orientation with respect to the ORF(s).
SFL124 was transformed with pNV711 and pNV712, resulting in SFL1243 and
SFL1244, respectively. LPS was extracted from the
control and
recombinant strains by the whole-cell lysate method
described elsewhere
(
9). LPS was separated by electrophoresis
on a sodium
dodecyl sulfate-12% polyacrylamide gel, transferred
onto a
nitrocellulose membrane (MSI), and analyzed by using serotype-specific
monoclonal antibodies and chemiluminescence detection (kit from
Boehringer Mannheim). The primary antibodies used were MASF-I
and
MASF-Y5, which are specific for serotype 1a and Y O antigen,
respectively (
3,
4) (Fig.
2).
The LPS of wild-type 1a strain
Y53 is recognized by MASF-I only; the
LPS of SFL124 is recognized
by MASF-Y5. The O antigen expressed by
SFL1243 is recognized by
both antibodies. This suggests that
orf3 alone mediates partial
conversion of the SFL1243 LPS,
which contains both Y-specific
(parental) and 1a-specific O antigens on
its surface. The LPS
of SFL1244, however, is recognized by MASF-I only,
indicating
that all three ORFs together mediate complete serotype
conversion.
The same results were obtained when Western immunoblotting
was
repeated with alkaline phosphatase detection (data not shown).
These results demonstrate that
orf1,
orf2, and
orf3 are directly
involved in serotype 1a O-antigen
modification.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 2.
Western immunoblot of LPS preparations. Membranes were
probed with MASF-Y5 or MASF-I as the primary antibody, and O antigens
were detected by chemiluminescence. SFL124 (serotype Y) and S. flexneri Y53 (serotype 1a) were used as controls. LPS prepared
from SFL1243 (SFL124 containing orf3) is recognized by both
Y- and 1a-specific monoclonal antibodies, whereas LPS from SFL1244
(SFL124 containing orf1, orf2, and
orf3) is recognized only by MASF-I.
|
|
The proteins encoded by
orf1 and
orf2 are highly
conserved among serotype-converting bacteriophages (Table
2). The Orf1
protein
is largely hydrophobic and contains four potential
transmembrane
regions. This protein exhibits ca. 45% identity to the
RfbI protein,
which is encoded within the
rfb locus of
S. flexneri and has an
undetermined function
(
20). Guan et al. (
6) proposed that
the Orf1
protein may play a role in the translocation of lipid-linked
glucose
across the cytoplasmic membrane. The Orf2 protein homologue
of SfII,
called Bgt, was reported to have homology to other bactoprenol
glucosyltransferases (
19). Functional analysis of the Bgt
homologue
in SfX, called GtrB, confirmed bactoprenol
glucosyltransferase
activity and showed that it catalyzes the formation
of the lipid
P-glucose precursor (
6). The Bgt proteins
contain a largely
hydrophilic N-terminal region and two potential
transmembrane
regions in the C terminus (
19). Based on its
homology and its
role in O-antigen modification,
orf2 has
been renamed
bgt. orf3 is unique to
S. flexneri
Y53 and encodes the serotype 1a-specific
glucosyltransferase, so it has
subsequently been renamed
gtrI.
Based on amino acid
sequence, the homology of GtrI to the other
Gtrs is less than 20%
(data not shown). Analysis of hydropathy
plots, however, suggests that
despite the differences in amino
acid sequence, the
glucosyltransferases have similar secondary
structures consisting of 10 or 11 putative transmembrane segments
(data not shown). The occurrence
of low-level nucleotide and amino
acid homology, yet similar secondary
structure, appears to be
a common phenomenon in proteins involved in
certain steps of LPS
and O-antigen synthesis (
25).
The results of the seroconversion experiments described here are
consistent with other studies with SFL124 in that the three-gene
cassette from SfV or SfX was also required for the complete conversion
of serotype Y to serotype 5a or X, respectively (
6,
11,
12).
Mavris et al. (
19), however, reported that only
bgt and
gtrII or
gtrX were required to
mediate complete conversion to serotype
2a or X, respectively, in
serotype Y strain PE577. Analysis of
various strains of different
serotypes indicated that more than
one copy of
bgt exists in
any one strain, including
E. coli, and
it was proposed that
the
bgt homologue in PE577 is not functional
(
19). SFL124 may not produce functional Orf1 and Bgt
proteins
and would therefore require both for complete serotype
conversion.
In the absence of these genes, host-encoded factors, such
as RfbI
and other proteins with homology to Bgt, may compensate for
their
absence but may not be as specific or efficient, thus resulting
in partial
conversion.
Characterization of the Y53 chromosome up- and downstream of the
serotype conversion genes.
While the organization of
attP, the O-antigen modification genes, and the orf4
orf5 region appears to have been conserved, the general
organization of the 5.8-kb HindIII fragment is unique in
that the phage DNA appears to be flanked by copies of IS600. To determine the nature and extent to which the phage DNA was interrupted, the sequence was extended up- and downstream.
The 5.8-kb
HindIII fragment in pNV462 was originally
subcloned from cosmid pNV394 (
1). Since it appeared that
duplicate
copies of IS
600 flanked the serotype conversion
genes, pNV394
could not be used as a template for primer walking.
Consequently,
restriction mapping and Southern hybridization were used
to identify
appropriate fragments that overlapped with the known
sequence.
A 5.8-kb
EcoRI fragment (1.2-kb overlap) and a
4.8-kb
SalI fragment
(2.9-kb overlap) were identified as
being up- and downstream of
the
gtr genes. These fragments
were cloned into pBluescript II
KS (Stratagene) to form pNV700 and
pNV710, respectively, which
were then introduced into
E. coli JM109, resulting in recombinant
strains B789 and B799,
respectively. The sequences of the fragments
were determined by primer
walking. In total, the sequences of
2,742 nt upstream and 2,012 nt
downstream of the
HindIII fragment
in pNV394 were
determined, and the results are summarized in Table
3 and Fig.
3.

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 3.
The organization of the O-antigen modification genes in
S. flexneri 1a. Arrows represent the direction of each IS.
The O-antigen modification gene cluster is shaded.
|
|
The phage genes in the Y53 chromosome are flanked by direct copies of
IS
600, referred to as IS
600u and
IS
600d, indicating
the up- and downstream copies,
respectively. The nucleotide sequences
of IS
600u and
IS
600d are 99.7% identical. Both copies are also
highly
homologous to IS
600 from
Shigella sonnei
(
18) and other
IS
600-related sequences (Table
3).
IS
600 insertion elements contain
two ORFs,
orfA
and
orfB, which encode proteins of 100 and 272
amino acids,
respectively (
18). The OrfA proteins of IS
600u
and IS
600d are identical, while the OrfB proteins differ by
one
amino acid. These proteins are nearly identical to the OrfA and
OrfB proteins of
S. sonnei. Each insertion sequence (IS)
element
is flanked by 29-bp imperfect inverted repeats which are also
conserved among IS
600 sequences. An additional insertion
element,
IS
629, is located 44 bp upstream of
IS
600u (Fig.
3). IS
629 is
composed of 1,306 nt
and has significant homology to several insertion
elements in the
genetic databases, and its highest degree of homology
is with
S. sonnei IS
629 (
18) (Table
3). Similar to
IS
629 of
S. sonnei, Y53 IS
629 is
predicted to contain two ORFs which are
present on the complementary
strand (Table
3). The protein encoded
by the putative
orfA
is 99% identical to that encoded by
S. sonnei.
A 4-bp
deletion beginning at nt 1082, however, resulted in a frameshift
mutation in the
orfB-encoded protein that resulted in
premature
termination and likely affected the function of this
insertion
element. The first 68 amino acids encoded by the 5' end of
orfB are nearly identical to the amino-terminal end of the
OrfB protein
of
S. sonnei. IS
600 and
IS
629 are frequently found in
Shigella and other
related bacteria, where they are often associated with
virulence
determinants (reviewed in reference
23). The
organization
of the multiple IS elements is similar to that of a
composite
transposon and suggests that this region of the Y53
chromosome
may be
mobile.
The sequence immediately upstream of IS
629 has significant
homology to the
dsdC gene of
E. coli K-12 (Table
3). This gene
encodes the
D-serine dehydratase (deaminase)
transcriptional activator
and is located at 53 min on the
E. coli chromosome (
2). The
protein homology in this
region is limited to the last 99 (out
of 120 total) amino acids of
DsdC, suggesting that the 5' end
of the gene was interrupted by
IS
629. This end of the insertion
element, however, encodes
20 amino acids in the same frame as
the partial protein. Furthermore,
putative transcriptional (

10)
and translational signals are located
upstream of the ATG start
codon in IS
629. This may suggest
that even though the insertion
element disrupted the
dsdC
gene, it may be possible for the gene
to be transcribed and translated
although the amino-terminal end
of the protein would differ from that
in
E. coli.
The region immediately downstream of IS
600d has significant
homology to the integrase genes (
int) of SfV, SfII, P22, and
other
bacteriophages (Table
3). This region contains an incomplete
ORF
encoding a partial protein of 323 amino acids, suggesting
that
IS
600d interrupted the 5' end of the
int' gene.
The partial
ORF is transcribed in the same direction as the serotype
conversion
genes. A 46-nt sequence immediately downstream of
int' is highly
homologous to the
attP sites of
SfV and related bacteriophages
and is identical to the
attP
site located upstream of
orf1 (Table
2). The two
attP sites are separated by ca. 6.5 kb. When a temperate
phage integrates into the chromosome, the
attL and
attR sites
are separated by the entire phage genome, which
is ca. 40 kb for
S. flexneri phages. The
int and
glucosyltransferase genes, which
are adjacent on the phage genome, are
located at opposite ends
of the phage DNA once integrated into the
chromosome but are still
transcribed in the same direction. The
organization of the
attP sites, glucosyltransferase gene,
and
int' in the Y53 chromosome
is reminiscent of a lysogen,
although it appears that a large
portion of the phage genome was
deleted. It is possible that the
associated IS elements played a role
in the deletion when, for
example, the insertion of direct repeats of
IS
600 into both
orf5 and
int could
have resulted in the homologous recombination and
deletion of the
intervening phage DNA. Based on this analogy,
the
attP sites
upstream of
orf1 and downstream of
int' have been
renamed
attL and
attR, respectively, and they
define the boundaries
of the phage DNA in this area of the Y53
chromosome (Fig.
3).
The
attR sequence is identical to the 3' end of the
thrW tRNA gene. In fact, the DNA sequence downstream of and
including
attR is remarkably similar to the
thrW
proA region of the
E. coli chromosome (Table
3), which
is located at ca. 6 min (
2). Integration
of lysogenic phage
into the host chromosome frequently occurs
in tRNA genes. For example,
phage DLP12 is integrated into the
arginine-accepting tRNA in
E. coli (
17) and P22 and SfV insert
into the
threonine-accepting tRNA in
Salmonella and
S. flexneri,
respectively (
7,
15). The finding that the
cryptic Sf1 phage
integrated into the
thrW proA site is also
consistent with earlier
data suggesting that the
proAB locus
was the site of integration
of
S. flexneri seroconverting
phage (
21). It is of interest,
however, that the
dsdC gene upstream of
attL does not map adjacent
to the
proAB locus in the
E. coli chromosome.
While it is possible
that the organization of these genes in
S. flexneri is different
than that in
E. coli, it is also
tempting to speculate that the
IS elements may be involved in a
chromosomal rearrangement resulting
in the placement of these genes
adjacent to one
another.
The sequence analysis indicates that the organization of the 10.6-kb
region of the Y53 chromosome is unique and suggests that
the serotype
conversion genes were originally brought into the
host by a
bacteriophage. Several features of this region of the
Y53 chromosome
are also characteristic of pathogenicity islands,
which are distinct
chromosomal segments that contain clusters
of genes responsible for a
particular virulent phenotype (reviewed
in references
5 and
8). There are eight
criteria used to
define pathogenicity islands (
8), and the
10.6-kb region of
the Y53 chromosome exhibits many of these. A ca. 9-kb
region represents
a distinct genetic unit which is flanked by insertion
elements
on one end and a cryptic integrase gene and tRNA gene on the
other
end. The phage DNA contained within this unit has a dramatically
lower GC content than that in
S. flexneri (Tables
2 and
3).
The overall GC content of the region flanked by copies of
IS
600 is 40%, whereas the GC content of
Shigella
is 50% (
2). The
GC content of the flanking IS elements and
the
thrW proAB genes
is much closer to that expected for the
host. The O antigen has
been shown to be an important virulence factor
of
S. flexneri (
10). The O-antigen modification
genes, by generating antigenic
variation, enhance the virulence
properties of
S. flexneri since
the existence of several
serotypes means that the host has to
mount a specific immune response
to each one. The suggestion that
the maintenance of antigenic variation
is beneficial to
Shigella is also supported by the fact
that, in strain Y53, the genes in
the prophage region not directly
involved in O-antigen modification
have been either deleted or
inactivated by
ISs.
Organization and distribution of gtrI in natural
isolates of S. flexneri 1a.
The presence of multiple
insertion elements flanking the putative O-antigen-modification genes
gives the entire region a composite transposon-like structure,
suggesting that this region of the Y53 chromosome may be mobile. Based
on the restriction map of the 5.8-kb HindIII fragment, a
Southern hybridization experiment was designed to investigate the
distribution and organization of the serotype conversion loci in other
serotype 1a strains. Chromosomal DNA from three natural isolates of
S. flexneri 1a was prepared by the procedure outlined by
Bastin et al. (1) and was digested with restriction enzymes.
Chromosomal fragments were separated by electrophoresis and subjected
to Southern hybridization. The radiolabelled gtrI gene was
chosen as a probe because it is specific for S. flexneri 1a.
EcoRI and HindIII were chosen because EcoRI cuts within orf1, hence allowing the
determination of the number of copies of the gtrI locus
present in the genome, whereas HindIII cuts within
IS600, which should reveal the organization of the O-antigen
modification gene clusters in different strains. One EcoRI
fragment hybridized with the probe in all three strains, suggesting
that only one copy of gtrI was present (Fig.
4). In addition, all three strains tested
contained a 5.8-kb HindIII fragment that hybridized to
gtrI, which suggests that the composite transposon-like
organization of the O-antigen modification genes was conserved in the
strains analyzed.

View larger version (112K):
[in this window]
[in a new window]
|
FIG. 4.
Determination of copy number and organization of
gtrI in wild-type S. flexneri 1a strains. The
chromosomal DNA from the strains indicated was digested with
EcoRI and HindIII and subjected to Southern
hybridization with 32P-labelled gtrI as a probe.
The molecular weight marker was EcoRI-digested SPP1
bacteriophage DNA (Progen).
|
|
Conclusions.
The genes encoding type I antigen specificity in
S. flexneri serotype 1a have been characterized and their
functions in serotype conversion were confirmed. The general
organization of the region encoding 1a O antigen has numerous unique
characteristics, which raises a number of questions regarding the
evolution of serotype conversion genes in Shigella and
stresses their importance in virulence.
Nucleotide sequence accession number.
The nucleotide sequence
of the complete 10.6-kb region of the S. flexneri Y53
chromosome has been deposited in the GenBank database under accession
no. AF139596.
 |
ACKNOWLEDGMENTS |
We thank N. Carlin for the monoclonal antibodies and A. Lindberg
for the Shigella strains.
This project was supported by a grant from the National Health and
Medical Research Council of Australia.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Biochemistry and Molecular Biology, Faculty of Science, The Australian National University, Canberra, ACT 0200, Australia. Phone: 61 2 6249 2666. Fax: 61 2 6249 0313. E-mail:
Naresh.Verma{at}anu.edu.au.
Present address: Immunobiology Section, Therapeutic Goods
Administration Laboratories, Woden, ACT, Australia.
 |
REFERENCES |
| 1.
|
Bastin, D. A.,
A. Lord, and N. K. Verma.
1997.
Cloning and analysis of the glucosyl transferase gene encoding type I antigen in Shigella flexneri.
FEMS Microbiol. Lett.
156:133-139[Medline].
|
| 2.
|
Blattner, F. R.,
G. Plunkett III,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of E. coli K-12.
Science
277:1453-1474[Abstract/Free Full Text].
|
| 3.
|
Carlin, N. I. A., and A. A. Lindberg.
1986.
Monoclonal antibodies specific for Shigella flexneri lipopolysaccharides: clones binding to type I and type III:6,7,8 antigens, group 6 antigen, and a core epitope.
Infect. Immun.
53:103-109[Abstract/Free Full Text].
|
| 4.
|
Carlin, N. I. A., and A. A. Lindberg.
1987.
Monoclonal antibodies specific for Shigella flexneri lipopolysaccharides: clones binding to type IV, V, and VI antigens, group 3,4 antigen, and an epitope common to all Shigella flexneri and Shigella dysenteriae type 1 strains.
Infect. Immun.
55:1412-1420[Abstract/Free Full Text].
|
| 5.
|
Groisman, E. A., and H. Ochman.
1996.
Pathogenicity islands: bacterial evolution in quantum leaps.
Cell
87:791-794[Medline].
|
| 6.
|
Guan, S.,
D. A. Bastin, and N. K. Verma.
1999.
Functional analysis of the O antigen glucosylation gene cluster of Shigella flexneri bacteriophage SfX.
Microbiology
145:1263-1273[Abstract/Free Full Text].
|
| 7.
|
Guan, S., and N. K. Verma.
1998.
Serotype conversion of a S. flexneri candidate vaccine strain via a novel site-specific chromosome-integration system.
FEMS Microbiol. Lett.
166:79-87[Medline].
|
| 8.
|
Hacker, J.,
G. Blum-Oehler,
I. Muhldorfer, and H. Tschape.
1997.
Pathogenicity islands of virulent bacteria: structure function and impact on microbial evolution.
Mol. Microbiol.
23:1089-1097[Medline].
|
| 9.
|
Hitchcock, P. J., and T. M. Brown.
1983.
Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels.
J. Bacteriol.
154:269-277[Abstract/Free Full Text].
|
| 10.
|
Hong, M., and S. M. Payne.
1997.
Effect of mutations in S. flexneri chromosomal and plasmid-encoded lipopolysaccharide genes on invasion and serum resistance.
Mol. Microbiol.
24:779-791[Medline].
|
| 11.
|
Huan, P. T.,
D. A. Bastin,
B. L. Whittle,
A. A. Lindberg, and N. K. Verma.
1997.
Molecular characterization of the genes involved in O-antigen modification, attachment, integration and excision in Shigella flexneri bacteriophage SfV.
Gene
195:217-227[Medline].
|
| 12.
|
Huan, P. T.,
B. L. Whittle,
D. A. Bastin,
A. A. Lindberg, and N. K. Verma.
1997.
Shigella flexneri type-specific antigen V: cloning, sequencing and characterization of the glucosyl transferase gene of temperate bacteriophage SfV.
Gene
195:207-216[Medline].
|
| 13.
|
Karnell, A.,
B. A. Stocker,
S. Katakura,
F. P. Reinholt, and A. A. Lindberg.
1992.
Live oral auxotrophic Shigella flexneri SFL124 vaccine with a deleted aroD gene: characterization and monkey protection studies.
Vaccine
10:389-394[Medline].
|
| 14.
|
Karnell, A.,
H. Sweiha, and A. A. Lindberg.
1992.
Auxotrophic live oral Shigella flexneri vaccine protects monkeys against challenge with S. flexneri of different serotypes.
Vaccine
10:167-174[Medline].
|
| 15.
|
Leong, J. M.,
S. Nunes-Dueby,
C. F. Lesser,
P. Youderian,
M. M. Susskind, and A. Landy.
1985.
The phi-80 and P22 attachment sites: primary structure and interaction with E. coli integration host factor.
J. Biol. Chem.
260:4468-4477[Abstract/Free Full Text].
|
| 16.
|
Lindberg, A. A.,
A. Karnell,
B. A. Stocker,
S. Katakura,
H. Sweiha, and F. P. Reinholt.
1988.
Development of an auxotrophic oral live Shigella flexneri vaccine.
Vaccine
6:146-150[Medline].
|
| 17.
|
Lindsey, D. F.,
D. A. Mullin, and J. R. Walker.
1989.
Characterization of the cryptic lambdoid prophage DLP12 of Escherichia coli and overlap of the DLP12 integrase gene with the tRNA gene argU.
J. Bacteriol.
171:6197-6205[Abstract/Free Full Text].
|
| 18.
|
Matsutani, S.,
H. Ohtsubo,
Y. Maeda, and E. Ohtsubo.
1987.
Isolation and characterisation of IS elements repeated in the bacterial chromosome.
J. Mol. Biol.
196:445-455[Medline].
|
| 19.
|
Mavris, M.,
P. A. Manning, and R. Morona.
1997.
Mechanism of bacteriophage SfII-mediated serotype conversion in Shigella flexneri.
Mol. Microbiol.
26:939-950[Medline].
|
| 20.
|
Morona, R.,
M. Mavris,
A. Fallarino, and P. A. Manning.
1994.
Characterization of the rfc region of Shigella flexneri.
J. Bacteriol.
176:733-747[Abstract/Free Full Text].
|
| 21.
|
Petrovskaya, V. G., and T. A. Licheva.
1982.
A provisional chromosome map of Shigella and the regions related to pathogenicity.
Acta Microbiol. Acad. Sci. Hung.
29:41-53[Medline].
|
| 22.
|
Phalipon, A.,
M. Kaufmann,
P. Michetti,
J. M. Cavaillon,
M. Huerre,
P. Sansonetti, and J. P. Kraehenbuhl.
1995.
Monoclonal immunoglobulin A antibody directed against serotype-specific epitope of Shigella flexneri lipopolysaccharide protects against murine experimental shigellosis.
J. Exp. Med.
182:769-778[Abstract/Free Full Text].
|
| 23.
|
Rajakumar, K.,
C. Sasakawa, and B. Adler.
1997.
Use of a novel approach, termed island probing, identifies the Shigella flexneri she pathogenicity island which encodes a homolog of the immunoglobulin A protease-like family of proteins.
Infect. Immun.
65:4606-4614[Abstract].
|
| 24.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 25.
|
Schnaitman, C. A., and J. D. Klena.
1993.
Genetics of lipopolysaccharide biosynthesis in enteric bacteria.
Microbiol. Rev.
57:655-682[Abstract/Free Full Text].
|
| 26.
|
Simmons, D. A., and E. Romanowska.
1987.
Structure and biology of Shigella flexneri O antigens.
J. Med. Microbiol.
23:289-302[Free Full Text].
|
| 27.
|
Verma, N. K.,
J. M. Brandt,
D. J. Verma, and A. A. Lindberg.
1991.
Molecular characterization of the O-acetyl transferase gene of converting bacteriophage Sf6 that adds group antigen 6 to Shigella flexneri.
Mol. Microbiol.
5:71-75[Medline].
|
| 28.
|
Verma, N. K.,
D. J. Verma,
P. T. Huan, and A. A. Lindberg.
1993.
Cloning and sequencing of the glucosyl transferase-encoding gene from converting bacteriophage X (SfX) of Shigella flexneri.
Gene
129:99-101[Medline].
|
| 29.
|
World Health Organization.
1991.
Research priorities for diarrhoeal disease vaccines: memorandum from a WHO meeting.
Bull. W. H. O.
69:667-676[Medline].
|
| 30.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[Medline].
|
Journal of Bacteriology, August 1999, p. 4711-4718, Vol. 181, No. 15
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kaluzny, K., Abeyrathne, P. D., Lam, J. S.
(2007). Coexistence of Two Distinct Versions of O-Antigen Polymerase, Wzy-Alpha and Wzy-Beta, in Pseudomonas aeruginosa Serogroup O2 and Their Contributions to Cell Surface Diversity. J. Bacteriol.
189: 4141-4152
[Abstract]
[Full Text]
-
Zhou, S., Kile, A., Bechner, M., Place, M., Kvikstad, E., Deng, W., Wei, J., Severin, J., Runnheim, R., Churas, C., Forrest, D., Dimalanta, E. T., Lamers, C., Burland, V., Blattner, F. R., Schwartz, D. C.
(2004). Single-Molecule Approach to Bacterial Genomic Comparisons via Optical Mapping. J. Bacteriol.
186: 7773-7782
[Abstract]
[Full Text]
-
Markine-Goriaynoff, N., Gillet, L., Van Etten, J. L., Korres, H., Verma, N., Vanderplasschen, A.
(2004). Glycosyltransferases encoded by viruses. J. Gen. Virol.
85: 2741-2754
[Abstract]
[Full Text]
-
Korres, H., Verma, N. K.
(2004). Topological Analysis of Glucosyltransferase GtrV of Shigella flexneri by a Dual Reporter System and Identification of a Unique Reentrant Loop. J. Biol. Chem.
279: 22469-22476
[Abstract]
[Full Text]
-
Parreira, V. R., Gyles, C. L.
(2003). A Novel Pathogenicity Island Integrated Adjacent to the thrW tRNA Gene of Avian Pathogenic Escherichia coli Encodes a Vacuolating Autotransporter Toxin. Infect. Immun.
71: 5087-5096
[Abstract]
[Full Text]
-
Allison, G. E., Angeles, D., Tran-Dinh, N., Verma, N. K.
(2002). Complete Genomic Sequence of SfV, a Serotype-Converting Temperate Bacteriophage of Shigellaflexneri. J. Bacteriol.
184: 1974-1987
[Abstract]
[Full Text]
-
Brooks, B. W., Robertson, R. H., Lutze-Wallace, C. L., Pfahler, W.
(2001). Identification, Characterization, and Variation in Expression of Two Serologically Distinct O-Antigen Epitopes in Lipopolysaccharides of Campylobacter fetus Serotype A Strains. Infect. Immun.
69: 7596-7602
[Abstract]
[Full Text]
-
Adams, M. M., Allison, G. E., Verma, N. K.
(2001). Type IV O antigen modification genes in the genome of Shigella flexneri NCTC 8296. Microbiology
147: 851-860
[Abstract]
[Full Text]
-
Byl, C. V., Kropinski, A. M.
(2000). Sequence of the Genome of Salmonella Bacteriophage P22. J. Bacteriol.
182: 6472-6481
[Abstract]
[Full Text]