Previous Article | Next Article 
Journal of Bacteriology, August 1999, p. 4741-4745, Vol. 181, No. 16
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Identification of Two Mannoproteins Released from
Cell Walls of a Saccharomyces cerevisiae mnn1 mnn9 Double
Mutant by Reducing Agents
Ismaïl
Moukadiri,
Lahcen
Jaafar, and
Jesús
Zueco*
Sección Departamental de
Microbiología, Facultad de Farmacia, Universidad de
Valencia, Burjassot, Valencia, Spain
Received 5 February 1999/Accepted 24 May 1999
 |
ABSTRACT |
In this report, we present the identification of the main
polypeptides that are extracted from purified cell walls of a
Saccharomyces cerevisiae mnn1 mnn9 strain by reducing
agents. Treatment of the purified cell walls of this strain with
-mercaptoethanol releases several mannoproteins, of which three,
with apparent sizes of 120, 45, and 40 kDa, are the most abundant.
Analysis of the amino-terminal sequences revealed that the 120-kDa
mannoprotein is Bar1p, the protease involved in the so-called barrier
activity in yeast cells, and that the 45- and 40-kDa mannoproteins are
the Kex2-unprocessed and Kex2-processed forms of the gene product of
open reading frame (ORF) YJL158c, an ORF that belongs to
the PIR (protein with internal repeats) family of genes,
composed thus far of PIR1, PIR2/HSP150, and
PIR3. Accordingly we have named this gene PIR4,
and Pir4 denotes the 40-kDa Kex2-processed form of the mannoprotein. We
have characterized Pir4 and have shown the feasibility of using it as a
fusion partner for the targeting of recombinant proteins to the cell wall.
 |
INTRODUCTION |
The cell wall of Saccharomyces
cerevisiae represents some 30% of the total weight of the cell
and is made up of
-glucans, mannose-containing glycoproteins
(mannoproteins), and small amounts of chitin (9, 15). The
mannoproteins can be divided into three groups according to the
linkages that bind them to the structure of the cell wall: (i)
noncovalently bound, (ii) covalently bound to the structural glucan,
and (iii) disulfide bound to other proteins that are themselves
covalently bound to the structural glucan of the cell wall
(8). Our work has focused on the disulfide-bound mannoproteins, probably the least well known of the three groups mentioned above. Previous work (25) showed that treatment of whole yeast cells with a reducing agent releases four mannoproteins, with molecular masses of 38, 49, 68, and 88 kDa, and a highly polydisperse high-molecular-weight material. Additionally, in the case
of cells of sexual mating type a previously treated with
-factor, treatment with a reducing agent releases an O-glycosylated 22-kDa mannoprotein (25). This 22-kDa mannoprotein is one of the subunits of the a-agglutinin and is coded by the
AGA2 gene (6).
Extraction of whole cells with reducing agents can cause the release of
proteins that are not part of the cell wall, and for this reason we
chose to use purified cell walls, previously extracted with hot sodium
dodecyl sulfate (SDS), as starting material for the
-mercaptoethanol
extraction. Also, extraction of the wild-type strain releases
mannoproteins that are polydisperse when run in SDS-polyacrylamide gel
electrophoresis (PAGE). This polydispersity is due to the fact that
some of them are highly glycosylated proteins and thus very difficult
to characterize. To minimize this problem, we used both the wild-type
strain and an mnn1 mnn9 strain deficient in glycosylation
(2, 11). The results presented in this work consist of the
characterization of two mannoproteins released from the purified cell
walls of the mnn1 mnn9 strain by
-mercaptoethanol.
 |
MATERIALS AND METHODS |
Strains and media.
Escherichia coli DH5
was used
for the propagation of plasmids; it was grown in Luria broth
supplemented with 100 µg of ampicillin per ml when necessary. The
standard S. cerevisiae strains X2180-1A (MATa
SUC2 mal mel gal2 cup1) and BMA64-1A (MATa
ade2-1 can1-100 ura3-1 leu2-3,112 trp1-D 2 his3-11) were
used. All strains except the mnn1 mnn9 mutant were provided
by the Spanish Type Culture Collection; the mutant strain was provided
by Luis Miguel Hernandez (Universidad de Extremadura, Badajoz, Spain).
Yeast strains were grown in YPD (1% yeast extract, 2% Bacto Peptone, 2% glucose) or synthetic minimal medium SD (0.7% yeast nitrogen base
without amino acids, 2% glucose, and amino acids as required).
Reagents.
Agar, yeast extract, peptone, and yeast nitrogen
base were purchased from Difco Laboratories (Detroit, Mich.);
phenylmethylsulfonyl fluoride (PMSF) was from Boehringer Mannheim; DNA
restriction and modification enzymes were from Boehringer Mannheim, New
England Biolabs Inc. (Beverly, Mass.), and Amersham-Pharmacia
(Amersham, United Kingdom). The usual chemicals were purchased from
Sigma Chemical Co. (St. Louis, Mo.) and from Panreac (Barcelona,
Spain). Electrophoresis reagents were from Bio-Rad Laboratories.
Nitrocellulose membranes and the enhanced chemiluminescence reagents
for developing Western immunoblots were from Amersham. Goat anti-rabbit
immunoglobulin G (IgG)-peroxidase, and
fluorescein-isothiocyanate-conjugated goat anti-rabbit IgG for
immunofluorescence labeling, were from Bio-Rad.
Isolation of cell wall mannoproteins.
Cell walls from
S. cerevisiae were purified and extracted with
-mercaptoethanol as follows. Cells in the early logarithmic phase
were harvested and washed twice in Tris-HCl (10 mM, pH 7.4), 1 mM in
PMSF (buffer A). The harvested biomass was resuspended in buffer A in a
proportion of 2 ml per g (wet weight), glass beads (0.45 mm in
diameter) were added to 50% of the final volume, and the cells were
broken by shaking four times for 30 s, with 1-min intervals, in a
CO2 refrigerated MSK homogenizer (Braun Melsungen AG,
Melsungen, Germany). Breakage was confirmed by phase-contrast microscopy, and the walls were washed six to eight times in buffer A. Removal of noncovalently bound proteins was achieved by boiling the
walls in buffer A containing 2% SDS (10 ml per g [wet weight] of
walls) for 10 min, followed by six to eight washes in buffer A. The
purified cell walls were finally resuspended in 10 mM ammonium acetate
buffer (pH 6.3) containing 2% (vol/vol)
-mercaptoethanol (5 ml per
g [wet weight] of walls) and incubated for 3 h at 30°C in an
orbital incubator at 200 rpm. The extract was separated from the cell
walls by centrifugation and concentrated by lyophilization.
Preparation of the polyclonal antibody against the
-mercaptoethanol extract from the mnn1 mnn9 strain.
Approximately 100 µg of the
-mercaptoethanol extract from the cell
walls of the S. cerevisiae mnn1 mnn9 strain was resuspended in 1 ml of 0.9% NaCl in 10 mM phosphate-buffered saline, pH 7.2 (PBS),
and mixed with an identical volume of complete Freund's adjuvant
(Difco). This emulsion was injected subcutaneously into the back of a
2-kg female New Zealand White rabbit. Boosts containing the same amount
of protein in PBS mixed with incomplete Freund's adjuvant were given
at intervals of 6 weeks. Fifteen days after the second boost, the
rabbit was exsanguinated; the blood was left to coagulate, the serum
components were separated by centrifugation and kept in aliquots of 250 µl at
20°C. Monospecific antibodies against the Pir4 polypeptide
were immunopurified as follows. A volume of 100-300 µl of the serum
was laid on the antigenic side of a strip of nitrocellulose containing
the band corresponding to Pir4, previously separated by SDS-PAGE and
transferred to nitrocellulose by Western blotting, and incubated with
gentle rocking for 2 h. After removal of the serum, the strip was
washed three times in Tris-buffered saline containing 0.05% Tween 20 (TBST), and the immunoabsorbed antibodies were eluted by laying 200 to
400 µl of 0.2 glycine (pH 2.4) on the nitrocellulose strip and
incubating the strip for 15 min. Finally, this solution, containing the
eluted immunopurified antibodies, was recovered, and the pH was
neutralized by adding an identical volume of cold 100 mM Tris base. The
affinity of the antibody was tested by Western blotting.
SDS-polyacrylamide gels and Western blot analysis.
Proteins
were separated by SDS-PAGE by the method of Laemmli (16) in
10 or 12% polyacrylamide gels. The proteins separated by SDS-PAGE were
either stained with Coomassie brilliant blue or transferred onto
Hybond-C nitrocellulose membranes as described by Towbin et al.
(34) and Burnette (5). Membranes were blocked overnight in TBST-5% nonfat milk. The blocked membranes were washed three times in TBST and incubated for 1 h in TBST containing the antibody at a dilution of 1:5,000. After three washes in TBST, the
membranes were incubated for 20 min in TBST containing goat anti-rabbit
IgG-peroxidase at a dilution of 1:12,000 and washed in TBST. Finally,
antibody binding was visualized on X-ray film by the enhanced
chemiluminescence method (Amersham).
Amino-terminal sequencing of polypeptides.
Proteins
separated by SDS-PAGE were transferred onto polyvinylidene fluoride
membranes (Immobilon-P; Millipore) as instructed by the manufacturer;
the membranes were then stained with Coomassie brilliant blue, and the
individual protein bands were excised. The amino-terminal sequences of
the proteins isolated in this way were determined by Edman degradation
in a Millipore ProSequencer 6600 automatic sequencer.
Immunofluorescence microscopy.
A small volume of
exponentially growing culture was harvested and washed twice in PBS.
The cells were resuspended in 50 µl of PBS containing the
monospecific antibody immunopurified against Pir4 diluted 1:25 and
incubated for 1 h at 37°C. After incubation, the cells were
washed three times in PBS, resuspended in 50 µl of PBS containing
fluorescein isothiocyanate-conjugated goat anti-rabbit IgG diluted
1:20, and incubated at 37°C for a further 2 h. After washing out
the unreacted antibody, cells were mounted on glass slides and examined
with a Zeiss Photomicroscope III.
Transformation of strains, DNA isolation, and sequencing.
Basic DNA manipulation and transformation in E. coli were
performed as described by Sambrook et al. (28). Yeast
transformation was carried out by the lithium acetate method
(12). Plasmid DNA from E. coli was prepared by
using a Flexi-Prep kit (Pharmacia), and DNA fragments were purified
from agarose gels by using a Sephaglass Band-Prep kit, also from
Pharmacia. Sequencing was performed by using Amplytaq polymerase with a
Dye Terminator kit (Perkin-Elmer) in an Applied Biosystems 373A
automatic sequencer.
Construction of the deletion cassette and confirmation of the
deletion mutant by PCR.
Replacement of the genomic copy of
PIR4 by the deletion cassette was performed by the one-step
transplacement method (26). A fragment of 882 bp containing
the PIR4 open reading frame (ORF) was generated by PCR using
Taq DNA polymerase and the oligonucleotides ATGCAATTCAAAAACGTCGCCCCAG (starting at the ATG of the ORF)
and GTGTATATTAAAGCTGCATGTG (located 195 bp downstream from
the TAA) as primers. This 882-bp fragment was subcloned in pGEMT
(Promega) to give plasmid pIMDB1. This plasmid was then digested with
BglII and EcoRI, and the 85-bp fragment released
was substituted by the KanMX4 marker digested from pFA6
(37) also with BglII and EcoRI to give
plasmid pIMDB2. Finally, a 2.1-kbp disruption cassette comprising most
of the PIR4 ORF interrupted by the KanMX4 marker was released from pIMDB2 by digestion with SalI and
purified, and approximately 1 µg was transformed into strains BMA64A
and FY1679. To confirm the replacement in the PIR4 locus,
stable Geneticin-resistant transformants of the viable haploid form
were analyzed by PCR using the oligonucleotides
GCATTCCATACGATTTCCACGG (located 351 bp upstream from the
ATG) and GTGTATATTAAAGGCTGCATGTG (located 195 bp downstream
from the TAA) as primers. The sequence of these oligonucleotides and
the length of the predicted PCR product were derived from the yeast
genome sequence.
Generation by PCR of the ORF and its regulatory sequences and
subcloning in YEplac112.
The PIR4 ORF was generated by
PCR using the oligonucleotides GCATTCCATACGATTTCCACGG
(located 351 bp upstream from the ATG) and
GTGTATATTAAAGGCTGCATGTG (located 195 bp downstream from the TAA) as primers. A DNA polymerase with 3'-5' proofreading activity (Vent polymerase; New England Biolabs) was used to improve fidelity. A
1,234-bp fragment that included the complete PIR4 ORF, 351 bp upstream from the ATG and 195 bp downstream from the stop codon, presumably containing the promoter and terminator sequences of PIR4, was obtained. This blunt-ended fragment was ligated to
SmaI-digested YEplac 112 (10) to give rise to
plasmid pIMDB3, which was transformed into the wild-type strain and the
disruptant strain obtained as described above, and the resulting
strains were then tested for Pir4 overexpression.
 |
RESULTS AND DISCUSSION |
Identification of the three main mannoproteins extracted from
purified cell walls of the S. cerevisiae mnn1 mnn9 strain
by treatment with
-mercaptoethanol.
SDS-PAGE analysis of the
-mercaptoethanol-extracted material from the purified cell walls of
the wild-type strain showed the presence of a 40-kDa (P40) band (Fig.
1, lane 1). Analysis of the same material
extracted from the mnn1 mnn9 strain showed the presence of
the P40 band and of two additional bands of 45 (P45) and 120 (P120) kDa
(lane 2). To identify the three bands isolated in the extracts, we
sequenced their amino termini and compared the sequences obtained with
those in the EMBL data bank.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 1.
SDS-PAGE (Coomassie blue-stained gel) of
-mercaptoethanol extracts from purified cell walls of S. cerevisiae wild-type (lane 1) and mnn1 mnn9 mutant
(lane 2) strains. M, size markers.
|
|
The amino-terminal sequence determined for P120 (LTNDGTGXLXFLLQHE)
was, except for the amino acids that could not be determined
(X),
identical to that encoded by the
BAR1 gene (
18),
a protease
produced by mating type
a S. cerevisiae cells that, by
degrading

-factor, is responsible for
the so-called barrier activity
that antagonizes

-factor activity. To
the best of our knowledge,
this is the first report of the association
of the
BAR1 gene product
to the cell wall through disulfide
bridges, since it had thus
far been considered to be secreted into the
medium (
1,
18,
19). The retention of Bar1p in the cell wall
may avoid the activity
dilution effect associated to its secretion; we
cannot, however,
discard the possibility that only a small part of
Bar1p is retained
or that this retention is merely transitory. MacKay
et al. (
18)
found 95% of the Bar1p activity in the culture
medium. We have
not performed activity assays, but it is reasonable to
assume
that the cell wall-associated protein is active since it has
been
reported that Bar1p is active in the early stages of the secretory
pathway (
1).
The amino-terminal sequences determined for both P45
(EGYTPGEPWSTLTPTGSISXGSSEYT) and P40 (DVISQIGDGQVQATSAATAQATDEQ)
were,
except for the amino acids that could not be determined (X),
identical
to different parts of the sequence coded by ORF
YJL158c. This
ORF codes for 227 amino acids of which 54 are
serine or threonine
and 6 are cysteine; it contains also a putative
signal peptide
whose cleavage site matches the amino-terminal sequence
of the
P45 polypeptide as well as a putative cleavage site for the Kex2
protease that matches the amino-terminal sequence of the P40
polypeptide.
These data suggest that both P40 and P45 polypeptides are
encoded
by ORF
YJL158c, P40 corresponding to the mature gene
product as
processed by Kex2, a hypothesis that was confirmed by
analyzing
the

-mercaptoethanol extracts of the cell walls of a
kex2-deficient
strain (data not shown).
YJL158c
is clearly related to the
PIR (protein with internal
repeats) family of genes (
27,
33):
it contains the
ISQIGDGQVQA repeat motif, albeit only once, and
its homology with
PIR2 is 55% overall; homology rises to 81% if
only the
last 80 carboxy-terminal amino acids are considered.
Accordingly we
propose the name
PIR4 for this ORF and Pir4 for
the
Kex2-processed,

-mercaptoethanol-extractable P40 polypeptide
encoded
by
it.
The protein encoded by
YJL158c has been also described as a
covalently linked cell wall protein (Ccw5p/Ccw11p) of 37 kDa that
can
be extracted by either laminarinase or mild alkali treatment
(
21). These results are, in principle, not easy to reconcile
with our own. We base our conclusion regarding the way in which
the
gene product of
YJL158c is bound to the cell wall on our
results;
a protein that is extracted by the simple action of reducing
agents
cannot be attached to the cell wall through any kind of covalent
linkages apart from, obviously, disulfide bridges. This conclusion
is
reinforced by the fact that Ccw5p/Ccw11p has recently been
identified
as Scw8p by Cappellaro et al. (
7), who describe
it as
dithiothreitol extractable. However, we cannot discard the
possibility
that the hypothetical cell wall protein to which Pir4
is bound through
disulfide bridges could itself be bound to the
structure of the cell
wall through the type of linkages described
by Mrsa et al.
(
21), or that part of Pir4 is bound directly
to the
structure of the cell wall through such linkages. In this
context,
Kapteyn et al. (
13) have recently shown that part of
Pir2/Hsp150, previously described as a secreted protein
(
27),
remains attached to the

-1,3 glucan of the cell
wall through
the linkage described by Mrsa et al. (
21);
moreover, we have
also detected a small amount of Pir2/Hsp150 in our

-mercaptoethanol
extracts (data not shown). A possible hypothesis
explaining all
of these seemingly contradictory results is that the
association
of the Pir proteins to the wall structure through disulfide
bridges
would, in some cases, be an intermediate and transient stage
before
secretion, in others an intermediate stage before linkage to

-1,3
glucan, and in some others the final localization of the mature
protein, each of these three possible localizations being, to
some
degree, interchangeable for each individual Pir cell wall
protein. This
hypothesis would explain why some Pir proteins are
extracted from the
cell wall, either with weak alkali or reducing
agents, and at the same
time secreted into the
medium.
Disruption and overexpression of PIR4 do not affect the
phenotype of the cells.
The possible role of Pir4 remains unclear.
It belongs to the Pir family of proteins, which includes the heat
shock-inducible Hsp150 (27), but it is not heat shock
inducible (reference 21 and our results), and does
not seem to be involved in the recovery of the cells following heat
shock. YJL158c/PIR4 has also been named CIS3, as
it is a multicopy suppressor of cik1 (20), a mutation that affects microtubule-based processes, causing a delay at
mitosis with formation of a large bud and lysis at 37°C. However, the
multicopy suppression effect of YJL158c could simply consist in a limitation of the lysis effect through a reinforcement of the
surface of the growing bud (19a). To investigate the
possible role of Pir4 in the cell wall, we first disrupted the
PIR4 gene and then overexpressed it in S. cerevisiae cells. The construction made to test the effect of
overexpression on the phenotype was based on the PIR4 gene
amplified by PCR, subcloned in YEplac112 (10), and
transformed in S. cerevisiae cells. Disruption of the gene
was performed with a disruption cassette that included the
KanMX4 gene as a marker (38). Analysis of the
extracts of the strains revealed that both the disrupted wild-type
(Fig. 2, lane 2) and mnn1 mnn9
(lane 6) strains lacked the P40 and the P40 and P45 polypeptides
respectively, while the extract of the wild-type strain transformed
with a multicopy plasmid harboring the PIR4 gene showed a
corresponding increase in the level of the P40 polypeptide (lane 3).
These results confirm that the PIR4 gene encodes both P40
and P45 and that the disruption and overexpression constructions were
correct. However, neither disruption of the gene nor its overexpression
affected the viability or morphology of the cells, their ability to
recover from heat shock (tested as described in reference
24), their mating efficiency (tested as described in
reference 31), their sensitivity to the killer toxin
(tested as described in reference 4), or their
sensitivity to calcofluor white, Congo red, or Zymolyase (tested as
described in reference 36), agents that interfere
with the synthesis of the cell wall or degrade it (data not shown);
consequently, the possible role of Pir4 in the structure or in the
synthesis of the cell wall remains unsolved.

View larger version (86K):
[in this window]
[in a new window]
|
FIG. 2.
Western immunoblot of -mercaptoethanol extracts from
the wild-type strain (lanes 1 and 4), disrupted
PIR4::KanMX4 strain (lane 2), wild-type
strain transformed with a multicopy plasmid containing PIR4
(lane 3), mnn1 mnn9 strain (lane 5), and mnn1
mnn9 strain containing the
PIR4::KanMX4 disruption (lane 6),
probed with a polyclonal antibody raised against the
-mercaptoethanol extract from the mnn1 mnn9 strain.
|
|
Pir4 is localized predominantly on the surface of growing
buds.
As an alternative approach to studying the role of Pir4, we
examined the possible localization of Pir4 on the cell surface by using
a polyclonal antibody, immunopurified against Pir4, in an indirect
immunofluorescence technique. The results (Fig.
3) show that Pir4 is localized in the
growing buds and not in the older mother cells. This result, together
with the recently published results of Spellman et al. (32),
who, by using a microarray hybridization technique, identify
PIR4 as a cell cycle-regulated gene that is expressed during
the G2 phase, suggest a role of Pir4 in the synthesis of
the newly formed wall of the growing bud, albeit a nonessential one,
since disruption of the PIR4 gene does not affect the
viability of the cells.

View larger version (115K):
[in this window]
[in a new window]
|
FIG. 3.
Indirect immunofluorescence, using a polyclonal antibody
immunopurified against Pir4, on S. cerevisiae cells. (A and
C) Phase contrast; (B and D) fluorescence. (A and B) Wild-type cells;
(C and D) cells from the disrupted
PIR4::KanMX4 strain. Arrows point to
the labeled growing buds.
|
|
Pir4 can be used as a carrier for the targeting of recombinant
proteins to the cell wall.
Targeting of recombinant proteins to
the cell wall of S. cerevisiae can be used, among other
things, for the immobilization of enzymes on the surface of yeast
cells, for the inclusion of proteins that would facilitate the
immobilization of the yeast cells to some solid matrix, or for the
modification of the agglutinability properties of the cells. To date,
glycosylphosphatidylinositol-anchored cell wall proteins have been used
for the targeting of different enzymes to the surface of yeast cells
(22, 23, 29, 30, 35, 37), and a disulfide-bound protein, the
ligand/recognition peptide of the a-agglutinin Aga2p, has
been used as a carrier to present a library of antibody fragments on
the cell surface (3, 14). The feasibility of using Pir4 as a
carrier for the targeting of recombinant proteins to the cell wall was
tested by creating a fusion between the PIR4 gene and a
portion of the gene coding for Staphylococcus aureus protein
A (17). Staphylococcal protein A can be easily detected due
to its reactivity with the Fc fraction of the IgGs of many species. The
fusion was made by subcloning a PCR generated fragment containing two
Fc binding domains of protein A flanked by BglII sites in
the naturally occurring BglII site in PIR4
previously subcloned in YEplac112. As shown in Fig.
4, the resulting recombinant fusion
protein was correctly targeted to the cell wall and could be released
from this structure by extraction with
-mercaptoethanol,
demonstrating that the insertion of a recombinant protein of moderate
size in the amino acid sequence of Pir4 does not affect its ability to
be correctly retained in the cell wall, consequently opening the way
for its use as a fusion partner for the targeting of other proteins of
interest to the yeast cell wall.

View larger version (94K):
[in this window]
[in a new window]
|
FIG. 4.
Western immunoblot of the -mercaptoethanol extracts
of the wild-type strain (lanes 2 and 4) and disrupted
PIR4::KanMX4 strain harboring a
PIR4-protein A gene fusion in a multicopy plasmid (lane 1 and 3), probed with a polyclonal antibody raised against
-mercaptoethanol extracts from the mnn1 mnn9 strain (B)
and with serum of a nonimmunized rabbit (A). M, size markers.
|
|
 |
ACKNOWLEDGMENTS |
We thank Frans Klis (Department of Molecular Cell Biology,
BioCentrum Amsterdam, University of Amsterdam, Amsterdam, The
Netherlands) for critical reading of the manuscript.
This work was supported by grant PM96-0019 from the Secretaría
de Estado de Universidades, Investigación y Desarrollo. I.M. was
supported by a fellowship from the Ministère de l'Education Nationale du Maroc. L.J. was supported by a fellowship from
Colegio Mayor La Coma.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Sección
Departamental de Microbiología, Facultad de Farmacia,
Universidad de Valencia, Avda. Vicente Andres Estelles s/n,
46100-Burjassot, Valencia, Spain. Phone: 34-963864299. Fax:
34-963864682. E-mail: jesus.zueco{at}uv.es.
 |
REFERENCES |
| 1.
|
Ballensiefen, W., and H. D. Schmitt.
1997.
Periplasmic Bar1 protease of Saccharomyces cerevisiae is active before reaching its extracellular destination.
Eur. J. Biochem.
247:142-147[Medline].
|
| 2.
|
Ballou, C. E.
1990.
Isolation, characterization and properties of Saccharomyces cerevisiae mnn mutants with non-conditional glycosylation defects.
Methods Enzymol.
185:440-470[Medline].
|
| 3.
|
Boder, E. T., and K. D. Wittrup.
1997.
Yeast surface display for screening combinatorial polypeptide libraries.
Nat. Biotechnol.
15:553-557[Medline].
|
| 4.
|
Brown, J. L.,
T. Roemer,
M. Lussier,
A. M. Sdicu, and H. Bussey.
1994.
The K1 killer toxin: molecular and genetic applications to secretion and cell surface assembly, p. 217-231.
In
J. R. Johnston (ed.), Molecular genetics of yeast: a practical approach. IRL Press, Oxford University Press, Oxford, United Kingdom.
|
| 5.
|
Burnette, W. N.
1981.
Western blotting: electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A.
Anal. Biochem.
112:195-203[Medline].
|
| 6.
|
Cappellaro, C.,
K. Hauser,
V. Mrsa,
M. Watzele,
G. Watzele,
C. Gruber, and W. Tanner.
1991.
Saccharomyces cerevisiae a-agglutinin and -agglutinin. Characterization of their molecular interaction.
EMBO. J.
10:4081-4088[Medline].
|
| 7.
|
Cappellaro, C.,
V. Mrsa, and W. Tanner.
1998.
New potential cell wall glucanases of Saccharomyces cerevisiae and their involvement in mating.
J. Bacteriol.
180:5030-5037[Abstract/Free Full Text].
|
| 8.
|
De Nobel, H., and P. N. Lipke.
1994.
Is there a role for GPIs in yeast cell-wall assembly?
Trends Cell Biol.
4:42-46.
[Medline] |
| 9.
|
Fleet, G. H.
1991.
Cell walls, p. 199-277.
In
A. H. Rose, and J. S. Harrison (ed.), The yeasts, 2nd ed., vol. 14. Yeast organelles. Academic Press, London, United Kingdom.
|
| 10.
|
Gietz, R., and A. Sugino.
1988.
New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites.
Gene
74:527-534[Medline].
|
| 11.
|
Hernandez, L. M.,
L. Ballou,
E. Alvarado,
B. L. Gillece-Castro,
A. L. Burlingame, and C. E. Ballou.
1989.
A new Saccharomyces cerevisiae mnn mutant N-linked oligosaccharide structure.
J. Biol. Chem.
246:11846-11856.
|
| 12.
|
Ito, H.,
Y. Fukuda,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168[Abstract/Free Full Text].
|
| 13.
|
Kapteyn, J. C.,
P. Van Egmond,
E. Slevi,
H. Van Den Ende,
M. Makarow, and F. M. Klis.
1999.
The contribution of the O-glycosylated protein Pir2/Hsp150 to the construction of the yeast cell wall in wild-type cells and 1,6-glucan-deficient mutants.
Mol. Microbiol.
31:1835-1844[Medline].
|
| 14.
|
Kieke, M. C.,
B. K. Cho,
E. T. Boder,
D. M. Kranz, and K. D. Wittrup.
1997.
Isolation of anti-T cell receptor scFv mutants by yeast surface display.
Protein Eng.
10:1303-1310[Abstract/Free Full Text].
|
| 15.
|
Klis, F. M.
1994.
Review: cell wall assembly in yeast.
Yeast
10:851-869[Medline].
|
| 16.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[Medline].
|
| 17.
|
Lowenadler, B.,
B. Nilsson,
L. Abrahmsen,
T. Moks,
L. Ljungqvist,
E. Holmgren,
S. Paleus,
S. Josephson,
L. Philipson, and M. Uhlen.
1986.
Production of specific antibodies against protein A fusions.
EMBO J.
5:2393-2398[Medline].
|
| 18.
|
MacKay, V. L.,
S. Welch,
M. Y. Insley,
T. R. Manney,
J. Holly,
G. C. Saari, and M. L. Parker.
1988.
The Saccharomyces cerevisiae BAR1 gene encodes an exported protein with homology to pepsin.
Proc. Natl. Acad. Sci. USA
85:55-59[Abstract/Free Full Text].
|
| 19.
|
MacKay, V. L.,
J. Armstrong,
C. Yip,
S. Welch,
K. Walker,
S. Osborn,
P. Sheppard, and J. Forstrom.
1991.
Characterization of the Bar proteinase, an extracellular enzyme from the yeast Saccharomyces cerevisiae.
Adv. Exp. Med. Biol.
306:161-172[Medline].
|
| 19a.
| Manning, B. Personal communication.
|
| 20.
|
Manning, B. D.,
R. Padmanabha, and M. Snider.
1997.
The Rho-GEF Rom2 localizes to sites of polarized cell growth and participates in cytoskeletal functions in Saccharomyces cerevisiae.
Mol. Biol. Cell
8:1829-1844[Abstract/Free Full Text].
|
| 21.
|
Mrsa, V.,
T. Seidl,
M. Gentzsch, and W. Tanner.
1997.
Specific labelling of cell wall proteins by biotinylation. Identification of four covalently linked O-mannosylated proteins of Saccharomyces cerevisiae.
Yeast
13:1145-1154[Medline].
|
| 22.
|
Murai, T.,
M. Ueda,
M. Yamamura,
H. Atomi,
Y. Shibasaki,
N. Kamasawa,
M. Osumi,
T. Amachi, and A. Tanaka.
1997.
Construction of a starch-utilizing yeast by cell surface engineering.
Appl. Environ. Microbiol.
63:1362-1366[Abstract].
|
| 23.
|
Murai, T.,
M. Ueda,
H. Atomi,
Y. Shibasaki,
N. Kamasawa,
M. Osumi,
T. Kawaguchi,
M. Arai, and A. Tanaka.
1997.
Genetic immobilization of cellulase on the cell surface of Saccharomyces cerevisiae.
Appl. Microbiol. Biotechnol.
48:499-503[Medline].
|
| 24.
|
Navarro-García, F.,
M. Sanchez,
J. Pla, and C. Nombela.
1995.
Functional characterization of the MKC1 gene of Candida albicans, which encodes a mitogen-activated protein kinase homolog related to cell integrity.
Mol. Cell. Biol.
15:2197-2206[Abstract].
|
| 25.
|
Orlean, P.,
H. Ammer,
M. Watzele, and W. Tanner.
1986.
Synthesis of an O-glycosylated cell surface protein induce by alpha factor.
Proc. Natl. Acad. Sci. USA
83:6263-6266[Abstract/Free Full Text].
|
| 26.
|
Rothstein, R.
1983.
One-step gene disruption in yeast.
Methods Enzymol.
101:202-211[Medline].
|
| 27.
|
Russo, P.,
N. Kalkkinen,
H. Sareneva,
J. Paakkola, and M. Makarow.
1992.
A heat shock gene from Saccharomyces cerevisiae encoding a secretory glycoprotein.
Proc. Natl. Acad. Sci. USA
89:3671-3675[Abstract/Free Full Text].
|
| 28.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 29.
|
Schreuder, M. P.,
S. Brekelmans,
H. Van den Ende, and F. M. Klis.
1993.
Targeting of a heterologous protein to the cell wall of Saccharomyces cerevisiae.
Yeast
9:399-409[Medline].
|
| 30.
|
Schreuder, M. P.,
A. T. A. Mooren,
H. Y. Toschka,
C. T. Verrips, and F. M. Klis.
1996.
Immobilizing enzymes on the surface of yeast cells.
Trends Biotechnol.
14:115-120[Medline].
|
| 31.
|
Sherman, F.,
G. R. Fink, and J. B. Hicks.
1986.
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 32.
|
Spellman, P. T.,
G. Sherlock,
M. Q. Zhang,
V. R. Iyer,
K. Anders,
M. B. Eisen,
P. Q. Brown,
D. Botstein, and B. Futcher.
1998.
Comprehensive identification of cell cycle-regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization.
Mol. Biol. Cell
9:3273-3297[Abstract/Free Full Text].
|
| 33.
|
Toh-e, A.,
S. Yasunaga,
H. Nisogi,
K. Tanaka,
T. Oguchi, and Y. Matsui.
1993.
Three yeast genes, PIR1, PIR2 and PIR3, containing internal tandem repeats are related to each other, and PIR1 and PIR2 are required for tolerance to heat shock.
Yeast
9:481-494[Medline].
|
| 34.
|
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 35.
|
Van Berkel, M. A. A.,
L. H. P. Caro,
R. C. Montijn, and F. M. Klis.
1994.
Glucosylation of chimeric proteins in the cell wall of Saccharomyces cerevisiae.
FEBS Lett.
349:135-138[Medline].
|
| 36.
|
Van der Vaart, J. M.,
H. P. Caro,
J. W. Chai Man,
F. M. Klis, and C. T. Verrips.
1995.
Identification of three mannoproteins in the cell wall of Saccharomyces cerevisiae.
J. Bacteriol.
177:3104-3110[Abstract/Free Full Text].
|
| 37.
|
van der Vaart, J. M.,
R. te Biesebeke,
J. W. Chapman,
H. Y. Toschka,
F. M. Klis, and T. Verrips.
1997.
Comparison of cell wall proteins of Saccharomyces cerevisiae as anchors for cell surface expression of heterologous proteins.
Appl. Environ. Microbiol.
63:615-620[Abstract].
|
| 38.
|
Wach, A.,
A. Brachar,
R. Pohlmann, and P. Philipsen.
1994.
New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae.
Yeast
10:1793-1808[Medline].
|
Journal of Bacteriology, August 1999, p. 4741-4745, Vol. 181, No. 16
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Smits, G. J., Schenkman, L. R., Brul, S., Pringle, J. R., Klis, F. M.
(2006). Role of Cell Cycle-regulated Expression in the Localized Incorporation of Cell Wall Proteins in Yeast. Mol. Biol. Cell
17: 3267-3280
[Abstract]
[Full Text]
-
Lesage, G., Bussey, H.
(2006). Cell Wall Assembly in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev.
70: 317-343
[Abstract]
[Full Text]
-
Ecker, M., Deutzmann, R., Lehle, L., Mrsa, V., Tanner, W.
(2006). Pir Proteins of Saccharomyces cerevisiae Are Attached to beta-1,3-Glucan by a New Protein-Carbohydrate Linkage. J. Biol. Chem.
281: 11523-11529
[Abstract]
[Full Text]
-
Sumita, T., Yoko-o, T., Shimma, Y.-i., Jigami, Y.
(2005). Comparison of Cell Wall Localization among Pir Family Proteins and Functional Dissection of the Region Required for Cell Wall Binding and Bud Scar Recruitment of Pir1p. Eukaryot Cell
4: 1872-1881
[Abstract]
[Full Text]
-
Martinez, A. I., Castillo, L., Garcera, A., Elorza, M. V., Valentin, E., Sentandreu, R.
(2004). Role of Pir1 in the construction of the Candida albicans cell wall. Microbiology
150: 3151-3161
[Abstract]
[Full Text]
-
Jaafar, L., Zueco, J.
(2004). Characterization of a glycosylphosphatidylinositol-bound cell-wall protein (GPI-CWP) in Yarrowia lipolytica. Microbiology
150: 53-60
[Abstract]
[Full Text]
-
Abe, H., Shimma, Y.-i., Jigami, Y.
(2003). In vitro oligosaccharide synthesis using intact yeast cells that display glycosyltransferases at the cell surface through cell wall-anchored protein Pir. Glycobiology
13: 87-95
[Abstract]
[Full Text]
-
Roelants, F. M., Torrance, P. D., Bezman, N., Thorner, J.
(2002). Pkh1 and Pkh2 Differentially Phosphorylate and Activate Ypk1 and Ykr2 and Define Protein Kinase Modules Required for Maintenance of Cell Wall Integrity. Mol. Biol. Cell
13: 3005-3028
[Abstract]
[Full Text]
-
Cabib, E., Roh, D.-H., Schmidt, M., Crotti, L. B., Varma, A.
(2001). The Yeast Cell Wall and Septum as Paradigms of Cell Growth and Morphogenesis. J. Biol. Chem.
276: 19679-19682
[Full Text]