Previous Article | Next Article ![]()
Journal of Bacteriology, August 1999, p. 4929-4936, Vol. 181, No. 16
Mikrobielle Genetik, Universität
Tübingen, D-72076 Tübingen, Germany
Received 26 April 1999/Accepted 9 June 1999
By transposon Tn917 mutagenesis, two mutants of
Staphylococcus xylosus were isolated that showed higher
levels of Carbon catabolite repression (CR) is
a ubiquitous regulatory process in microorganisms, whereby the
availability of a rapidly metabolizable carbon source inhibits
expression of genes encoding proteins mainly concerned with the
utilization of alternative carbon sources (47). The
mechanisms by which CR is achieved are best understood in
Escherichia coli and Bacillus subtilis (48). Studies on CR in Bacillus megaterium
(26), Lactobacillus pentosus (32),
Lactobacillus casei (36), Lactococcus
lactis (33), Listeria monocytogenes
(2), and Staphylococcus xylosus (12)
suggested common regulatory pathways in AT-rich gram-positive bacteria
that are distinct from those found in enteric bacteria (48).
CR in Bacillus and related organisms is mediated by the catabolite control protein A (CcpA) (23), which binds to
operator sites known as catabolite responsive elements (cre)
(25). Contradictory in vitro results have been reported
regarding the effector(s) stimulating the DNA-binding activity of CcpA
(16, 20, 27-29, 35, 42). One of the most important CcpA
effectors is a phosphorylated form of HPr, the phosphocarrier protein
of the phosphoenolpyruvate-dependent phosphotransferase system (PTS)
(41). Phosphorylation of HPr at a serine residue is carried
out by HPr kinase (19, 44), which appears to be the key
component in signal transduction leading to CR. In B. subtilis, CcpB and Crh, proteins that are similar to CcpA and HPr,
respectively, have been implicated in CR (7, 18), but the
significance of these findings for other AT-rich gram-positive
organisms is not clear at the moment.
Among metabolizable carbohydrates, glucose is preferred by a number of
bacteria. To ensure efficient glucose uptake, several glucose transport
systems are operative in many of these organisms. For example, studies
with PTS-deficient strains of B. subtilis, (10),
Streptococcus mutans (6, 9), Streptococcus
bovis (46), and Staphylococcus aureus
(45) indicated that glucose is internalized by PTS-dependent
as well as -independent mechanisms. Apart from a gene encoding a
hexose:H+ symporter from B. subtilis
(39), no other genes responsible for non-PTS glucose uptake
have been identified in these organisms.
We are interested in CR in the AT-rich gram-positive bacterium S. xylosus (49), a nonpathogenic Staphylococcus
that is involved in meat fermentations (22). By a transposon
mutagenesis aimed at isolating CR mutants of S. xylosus, a
gene was identified whose inactivation resulted in a reduction of
glucose-mediated CR. The inactivated gene was found to encode a non-PTS
glucose uptake protein.
Bacterial strains and plasmid vectors.
S. xylosus
strains used in this study are listed in Table
1. Cloning in E. coli was
performed by using DH5
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Identification of a Gene in Staphylococcus
xylosus Encoding a Novel Glucose Uptake Protein


![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-galactosidase activity in the presence of glucose than
the wild type. Both transposons integrated in a gene, designated
glcU, encoding a protein involved in glucose uptake in
S. xylosus, which is followed by a glucose dehydrogenase
gene (gdh). Glucose-mediated repression of
-galactosidase,
-glucosidase, and
-glucuronidase activities
was partially relieved in the mutant strains, while repression by
sucrose or fructose remained as strong as in the wild type. In addition
to the pleiotropic regulatory effect, integration of the transposons
into glcU reduced glucose dehydrogenase activity,
suggesting cotranscription of glcU and gdh.
Insertional inactivation of the gdh gene and deletion of
the glcU gene without affecting gdh expression
showed that loss of GlcU function is exclusively responsible for the
regulatory defect. Reduced glucose repression is most likely the
consequence of impaired glucose uptake in the glcU mutant
strains. With cloned glcU, an Escherichia coli
mutant deficient in glucose transport could grow with glucose as sole
carbon source, provided a functional glucose kinase was present.
Therefore, glucose is internalized by glcU in
nonphosphorylated form. A gene from Bacillus subtilis, ycxE, that is homologous to glcU, could
substitute for glcU in the E. coli glucose
growth experiments and restored glucose repression in the S. xylosus glcU mutants. Three more proteins with high levels of
similarity to GlcU and YcxE are currently in the databases. It appears
that these proteins constitute a novel family whose members are
involved in bacterial transport processes. GlcU and YcxE are the first
examples whose specificity, glucose, has been determined.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
[
80dlacZ
M15
(lacZYA-argF) recA1 endA1 hsdR17 supE44 thi-1
gyrA96 relA1 deoR]. Heterologous glcU and
ycxE expression was tested in E. coli ZSC112 [ptsG ptsM glkA] (8) by using the glucose
kinase (glkA)-containing plasmid pGRB144 (53).
B. subtilis 168 (trpC2) served to amplify ycxE. The partial S. xylosus genomic library was
constructed with pUC18. With the shuttle vectors pRB473 (5)
and pRB474 (13), cloning in S. xylosus and
complementation studies were carried out. Allelic replacements were
achieved with the aid of the temperature-sensitive shuttle plasmids
pBT1 and pBT2 and ermB fragments from Tn551
(4). Plasmid pTV1Ts (57) served for the
transposon mutagenesis.
TABLE 1.
S. xylosus strains used
Growth media, DNA manipulations, and transformation. DNA manipulations, plasmid DNA isolation, Southern blot analysis, transformation of E. coli, and preparation of media and agar plates for bacterial growth were performed according to standard procedures. Plasmid DNA was introduced into S. xylosus by electroporation with glycine-treated electrocompetent cells (4). PCR was carried out with Vent polymerase (New England Biolabs) or rTth DNA Polymerase, XL (Perkin Elmer). S. xylosus was grown in B-medium consisting of 1% peptone, 0.5% yeast extract, 0.5% NaCl, and 0.1% K2HPO4. To test for catabolite repression, sugars were added to a final concentration of 25 mM.
Transposon mutagenesis.
Transposon mutagenesis with
Tn917 from pTV1Ts was performed as described previously
(14). The six mutants were identified as dark blue colonies
on agar plates supplemented with 100 µg of
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside
(X-Gal)/ml, erythromycin (2.5 µg/ml), and glucose (25 mM) after
incubation at 37°C for 24 h.
Primers used for PCR and primer extension. The following glcU-gdh-specific primers were used (the positions refer to the glcU-gdh sequence from accession no. Y14043): H10, CAGGGATCCCCACTATTACTCTC (142-155); H11, CAGGAATTCGCATGGTCATATCTC (1173-1187); H17, CAGGAATTCGTTATCCTTTACCGCCC (1998-2014); H19, CAGGGTACCGGTAAAGTAGTAGTTATCACAGG (1240-1262); H20, CAGAAGCTTGTTATCCTTTACCGCCCATAAATGC (1990-2014); H30, CAGAAGCTTCCACTATTACTCTC (142-155); H31, CAGGTCGACGCATGGTCATATCTC (1173-1187); H36, CAGGGATCCCACTCTCTATTTGTTTTTCTCCCC (269-292); and H37, GACAAGCTTCCTCCTGCATCAACTGACATTG. Primer H37 hybridized 1.5 kb upstream of glcU, where only partial DNA sequence is available. For the primer extension reaction, the following primer was applied: TCCCTCTAATCTGATTATAAGGACC (384-405).
To clone ycxE, the following primers deduced from the B. subtilis sequence D50453 (56) were used: BS1, CTAGCATGCACGCTCCTGAAAGC (position 123576-123593); BS2, CTCGTCGACTTTTGCCTGCTCCTTGCCG (position 124657-124677).Construction of glcU and ycxE expression plasmids. Plasmid pUD1, containing the glcU-gdh operon on a BamHI-EcoRI fragment, was constructed with primers H10-H17 and plasmid pRB473. Plasmid pGU1, containing glcU alone, was obtained by using primers H10-H11 and pRB473. Combination of glcU and glkA on plasmid pUK1 was achieved by cloning a HindIII-SalI fragment of glcU obtained with primer pair H30-H31 into pGRB144, the glkA-containing plasmid.
For combining ycxE from B. subtilis with glkA from S. xylosus, primers BS1 and BS2 were applied. Cloning of the amplified SphI-SalI ycxE fragment into pGRB144 yielded pYK1. The ycxE-glkA region was moved as a SphI-KpnI fragment into the vegII promoter-containing plasmid pRB474 to yield pYK2. The corresponding ycxE plasmids without glkA, pYE1 and pYE2, were obtained by deleting the SalI-KpnI glkA fragments from pYK1 and pYK2, respectively.Construction of a gdh deletion mutant.
The
construction of the gdh deletion plasmid, p
GDH, was
carried out in two steps. First, the BamHI-EcoRI
fragment from pGU1 was cloned into pEC3 (4) in front of the
ermB gene. The resulting plasmid was designated pEC-glcU.
Secondly, a gdh deletion derivative ('gdh) was
synthesized with primer pair H19-H20. In this
KpnI-HindIII fragment the first 15 bp of
gdh including translation initiation signals were deleted.
In a three-fragment cloning, the BamHI-KpnI glcU-ermB fragment, the 'gdh
KpnI-HindIII fragment, and the
BamHI-HindIII-cut plasmid pBT2 were combined
to yield p
GDH (glcU ermB 'gdh). Allelic replacement of
the wild-type gdh gene by ermB 'gdh was carried out as previously described (4). The resulting strain,
S. xylosus TX213 (ermB 'gdh), was taken for
further studies after the chromosomal organization of the glcU
ermB 'gdh region had been confirmed by Southern blot and PCR analyses.
Construction of a glcU deletion mutant.
The
construction of a glcU deletion plasmid started with the
cloning of an EcoRI-BamHI-gdh fragment
amplified by primers H16-H17 into vector pRB473. Into the resulting
plasmid, an H36-H37-amplified BamHI-HindIII
fragment containing about 1.3 kb upstream of glcU was
cloned, yielding plasmid p
glcU. The plasmid, which
contained DNA surrounding glcU, was introduced into
wild-type S. xylosus C2a. Spontaneous glcU
deletion from the chromosome by gene conversion was detected on B
medium agar plates containing X-Gal (100 µg/ml) and glucose (25 mM).
Three blue colonies indicating loss of glcU were cured from
p
glcU, and the chromosomal DNA was analyzed for loss of
glcU by PCR. One representative of these colonies was designated S. xylosus TX214 (
glcU) and was
taken for further studies.
Determination of enzyme activities in cell extracts.
For
determination of enzymatic activities in S. xylosus, cells
were grown in B medium or in B medium supplemented with 25 mM of the
appropriate carbon source to an optical density at 578 nm
(OD578) of 1.5. Crude extracts were prepared by disrupting the cells with glass beads (53), and determination of the
-galactosidase,
-glucuronidase, and
-glucosidase activities
was done as previously described (12). To assay the activity
of glucose dehydrogenase, S. xylosus cells were grown in B
medium with 25 mM of glucose to an OD578 of 2. Crude
extracts were prepared in 75 mM Tris-HCl, pH 8.0. The enzyme activity
was assayed spectrophotometrically by monitoring the increase of
absorbance at 340 nm, which is indicative of NADH production. The assay
was performed at 30°C in 75 mM Tris-HCl (pH 8.0), 0.1 M glucose, 2 mM
NAD, and 5 to 500 µg of cellular protein. Protein concentrations were
determined by the method of Bradford (3).
Measurements of glucose uptake. Uptake of glucose in S. xylosus was measured with whole cells grown in B-medium or B-medium supplemented with 25 mM of glucose. Staphylococcal cells were harvested at an OD578 of 1.5, washed in transport buffer (0.1 M morpholinepropanesulfonic acid, 0.5 mM MgSO4, 10 mM NaCl, pH 7.0), and resuspended in the same buffer to a final OD578 of 3.0. After addition of 200 µM [14C]glucose (6.2 mCi/mmol) to 1 ml of prewarmed (30°C) cells, 0.15-ml samples were taken at intervals, collected on membrane filters with a pore size of 0.45 µm, and washed with 5 ml of transport buffer. Filters were dried at 80°C for 1 h. The radioactivity was determined by liquid scintillation counting. Uptake rates are expressed in nanomoles of glucose per minute per milligram of cellular protein. The amount of protein was determined by the method of Bradford (3).
Uptake of glucose in E. coli was carried out accordingly with cells grown in Luria Bertani medium that were adjusted to an OD578 of 15.RNA preparation and primer extension analysis. Preparation of RNA and the primer extension reactions were done as described previously (1). The primer used in these experiments contained infrared dye IRD700 at the 5' end. Reverse transcripts were run on 8% polyacrylamide-urea gels and were detected with a Li-Cor DNA sequencer. The file containing the picture of that gel was imported into Photoshop and printed on glossy paper.
Nucleotide sequence accession number. The DNA sequence reported here is available from the EMBL database under accession no. Y14043.
| |
RESULTS |
|---|
|
|
|---|
Isolation of S. xylosus mutants altered in CR.
In
order to isolate CR mutants in S. xylosus, transposon
mutagenesis with Tn917 was performed. Expression of the
-galactosidase gene, which is subject to CR (1, 53),
served to monitor the appearance of mutants on agar plates containing
glucose and X-Gal. While wild-type cells stay light blue for about
48 h, CR mutants should develop a darker color. By using this
strategy, six blue colonies were isolated that harbored a copy of
Tn917 in their chromosome. The mutant strains were
designated S. xylosus TX207 to TX212.
Molecular characterization of the mutants. Southern blot analysis using a Tn917-specific probe revealed that the transposon integrated at five different locations within a common genomic region of about 1 kb. Determination of the orientation of Tn917 in the genome of the mutants yielded opposite orientations in TX211 and TX212 (Fig. 1). Therefore, these strains were taken as representatives for further analysis. Chromosomal DNA from the neighborhood of the transposon insertions in strains TX211 and TX212 including the Tn917 ermB gene was cloned in E. coli with the erythromycin resistance as selection marker. With the genomic DNA from the TX211-derived fragment as a hybridization probe, a 3.6-kb HindIII fragment was identified in the wild-type strain covering the region where the Tn917 insertions occurred in the mutants. After cloning the HindIII fragment in E. coli, a nucleotide sequence of 2.2 kb immediately adjacent to the transposon insertion sites was determined. In addition, the exact positions of the transposons in strains TX211 and TX212 were determined by DNA sequencing.
|
Nucleotide sequence of the mutated region. The nucleotide sequence is composed of 2,193 bp harboring two large open reading frames (Fig. 1). The first specifies a protein of 288 amino acids with a calculated molecular mass of 30.6 kDa. Structural predictions (24) and hydropathy analysis (31) suggested that the orf1-encoded protein constitutes an integral membrane protein. Since it turned out to encode a glucose uptake protein, the gene was designated glcU. Similarity searches in databases identified two proteins from B. subtilis and B. megaterium, which share 55 and 56% identical residues with GlcU, respectively. The function of both proteins, encoded by ycxE in B. subtilis (30, 56) and orf2 in B. megaterium (34), remains to be elucidated. In addition, two putative membrane proteins, one from Lactobacillus helveticus (AJ002481) and the other from Streptococcus pyogenes (U17382), whose functions have not been determined, show identities of 40 and 32%, respectively, with GlcU from S. xylosus.
The deduced product of the second gene, a protein of 263 amino acids with a molecular mass of 28.6 kDa, showed similarity to various bacterial dehydrogenases and reductases. Since the identity with glucose-1-dehydrogenases from B. megaterium and B. subtilis was especially striking (56% identity), the gene was designated gdh. Interestingly, two gdh genes in B. subtilis and B. megaterium are encoded downstream of the glcU homologs, ycxE and orf2, mentioned above (30, 34, 56). Therefore, the genetic organization of this locus is conserved among the two bacilli and S. xylosus.Activities of catabolic enzymes in the wild type and the
glcU mutant strains.
The isolation of the
glcU mutants TX211 and TX212 as blue colonies from X-Gal
agar plates containing glucose suggested that glucose-mediated
repression of
-galactosidase activity is altered. To determine
whether repression by other carbohydrates and repression of other
enzymes are also affected by the mutations, the
-galactosidase,
-glucuronidase, and
-glucosidase activities of the wild type and
the glcU mutant strains were compared in cultures containing glucose, fructose, sucrose, or no additional sugar. As shown in Table
2, inactivation of glcU
resulted in a partial loss of glucose repression of all tested enzymes
but left sucrose- or fructose-mediated repression at the wild-type
level. The effect was most pronounced for the
-galactosidase
activity, where the 17-fold repression in the wild type was reduced to
an only 3-fold reduction. It appears that loss of GlcU function in
S. xylosus partially relieves catabolic enzymes from glucose
repression.
|
Glucose dehydrogenase activity in the wild type and the
glcU mutant strains.
The genetic organization of the
glcU-gdh region (Fig. 1) suggested that the two genes could
form an operon. Therefore, integration of Tn917 into
glcU should reduce gdh expression, perhaps
depending on the orientation of the transposon relative to the
gdh gene. As summarized in Table
3, Tn917 integration exerts a
strong polar effect on gdh expression. When Tn917
and glcU-gdh transcription proceed opposite to each other
(TX211), glucose dehydrogenase activity was 30-fold reduced compared to
that of the wild type. The same orientation of Tn917 and
glcU-gdh transcription (TX212) still resulted in a threefold
drop in glucose dehydrogenase activity. These results strongly indicate
that the gdh gene does not possess its own promoter and that
gdh expression is dependent on readthrough transcription
initiated beyond the transposon insertion sites. Therefore,
glcU and gdh most likely form an operon in
S. xylosus, a situation also encountered at the respective
locus, ycxE gdh, in B. subtilis (37,
43).
|
Catabolic enzyme activities in a glucose dehydrogenase-deficient
S. xylosus strain.
The virtually identical relief of
glucose-mediated repression of catabolic enzymes in the strains
S. xylosus TX211 and TX212, in which glucose dehydrogenase
activity differed about 10-fold (Table 3), suggested that the
regulatory phenotype in the mutant strains is the result of
glcU inactivation rather than of reduced gdh
expression. To rule out that lowered glucose dehydrogenase activity is
responsible for the phenotype, a gdh insertion mutant was
constructed as described in Materials and Methods. The resulting strain, designated S. xylosus TX213, was tested for
-galactosidase,
-glucuronidase, and
-glucosidase activities in
the presence and absence of glucose in the medium. As summarized in
Table 2, inactivation of the gdh gene did not result in a
relief of glucose-mediated repression of these activities.
Catabolic enzyme activities in a glcU deletion strain expressing wild-type levels of glucose dehydrogenase activity. To rule out the possibility that only the concomitant loss of GlcU and glucose dehydrogenase function affects regulation, a glcU deletion was introduced into the chromosome of S. xylosus as described in Materials and Methods. In the resulting strain, S. xylosus TX214, the glucose dehydrogenase activity was found to be at wild-type level (Table 3), showing that the glcU deletion was nonpolar on gdh expression. Subsequent assays of three catabolic enzyme activities yielded no difference from the S. xylosus TX211 and TX212 values (Table 2). Therefore, the partial loss of glucose repression observed in the transposon mutants is exclusively due to GlcU deficiency. Glucose dehydrogenase does not participate in this process. The regulatory phenotype in all glcU mutant strains could be complemented by cloned glcU on plasmid pGU1 (data not shown).
Glucose uptake in glcU mutant strains. Considering the structural prediction for GlcU to contain membrane-spanning segments and the glucose-dependent regulatory phenotype in the absence of GlcU function, we reasoned that GlcU could be a protein responsible for PTS-independent glucose uptake in S. xylosus. Therefore, transport of glucose and the nonmetabolizable analogue 2-deoxyglucose was examined in the wild type and the glcU mutant strains TX211, TX212, and TX214. Since glucose uptake was identical in all GlcU-deficient strains, the values for S. xylosus TX211 are shown as a representative example (Fig. 2A). With glucose as the substrate in the assays and cells grown in the absence of glucose, a clear reduction of the uptake rate was detectable in the glcU mutant strain. The high residual uptake activity is certainly due to the PTS and, perhaps, to additional glucose transport systems. Attempts are under way to isolate a PTS mutant of S. xylosus, in which GlcU function should be more pronounced. In contrast to glucose uptake, no difference in transport activity could be detected with 2-deoxyglucose as substrate (data not shown).
|
Complementation of an E. coli mutant deficient in glucose uptake. To provide additional evidence that GlcU is capable of taking up glucose, we tried to complement the glucose transport deficiency of the E. coli mutant strain ZSC112 (8). This strain carries mutations in ptsG and ptsM, which specify the major glucose permeases of E. coli, and a mutation in the glucose kinase gene glk. To enable ZSC112 to grow with glucose as the sole carbon source, genes mediating glucose transport and phosphorylation must be provided. With either glcU cloned on plasmid pGU1 or glkA cloned on plasmid pGRB144, ZSC112 could not grow in minimal medium containing glucose (Fig. 3A). When glcU was combined with the glucose kinase gene glkA from S. xylosus on plasmid pUK1, the strain grew well with glucose as carbon source (Fig. 3A). Therefore, glcU mediates glucose uptake in E. coli substantiating its participation in this process in S. xylosus. The dependency of the E. coli mutant on a functional glucose kinase, when GlcU is responsible for glucose uptake, demonstrates that glucose is internalized by GlcU in nonphosphorylated form.
|
|
Determination of the transcriptional start site of glcU. To determine the transcriptional start site of glcU, RNA was isolated from wild-type cells grown with or without glucose and primer extension reactions were carried out with a glcU-specific primer. As shown in Fig. 5, transcription start sites were located 66 bp upstream from the glcU start codon (Fig. 1). The reverse transcript was stronger in glucose-grown cells but was also detectable without the addition of glucose to the growth medium. Inspection of the DNA sequence around the promoter region revealed an inverted repeat located about 40 bp upstream of the glcU promoter. It remains to be determined whether this repeat serves as a site for glucose-specific regulation or as a terminator for upstream genes.
|
Identification of the glcU ortholog from B. subtilis.
As mentioned above, B. subtilis contains a
gene, designated ycxE (30), encoding a product
with high identity (55%) to GlcU in front of a glucose dehydrogenase
gene. We were therefore interested to determine whether ycxE
would also specify a glucose uptake protein. To that end, a
ycxE fragment was amplified from chromosomal B. subtilis DNA by PCR and cloned into the glkA-containing
plasmid pGRB144, yielding pYK1. Since the B. subtilis
ycxE-gdh operon has been described to be expressed from a promoter
recognized by the alternative sigma factor
G
(43), a promoter, vegII from B. subtilis, which is also active in E. coli
(40) was placed in front of ycxE to yield pYK2.
Growth experiments with E. coli ZSC112 harboring plasmid
pYK1 or pYK2, showed that ycxE with its own promoter did not
enable the strain to grow efficiently with glucose as carbon source
(Fig. 3B, pYK1). Expression of ycxE driven by
vegII, however, resulted in growth (Fig. 3B, pYK2)
comparable to that mediated by S. xylosus glcU. Therefore,
the B. subtilis ycxE gene specifies, like glcU, a
glucose uptake protein.
-galactosidase,
-glucosidase, and
-glucuronidase activities were measured in cells grown in the presence or absence of glucose. While ycxE expressed from vegII on plasmid pYE2
restored glucose repression in the glcU mutant, plasmid pYE1
harboring ycxE only with its own promoter had no effect
(data not shown). Apparently, the
G-specific B. subtilis promoter of ycxE is not active in S. xylosus.
| |
DISCUSSION |
|---|
|
|
|---|
The screening for transposon-generated CR mutants in S. xylosus led to the identification of an operon encoding a glucose uptake protein, GlcU, and a glucose dehydrogenase. GlcU and the glucose kinase GlkA (53), constitute a glucose utilization system enabling S. xylosus to catabolize glucose independently from the PTS.
In B. subtilis and B. megaterium, operons are present containing a glcU homolog in front of a glucose dehydrogenase gene (34, 56). Growth experiments with the B. subtilis GlcU counterpart, YcxE, in E. coli demonstrated that the YcxE protein also mediates glucose uptake. Since the corresponding B. megaterium protein shows a high degree of identity (78%) to YcxE, it is reasonable to assume the same function for that protein. Therefore, the three genes, glcU from S. xylosus, ycxE from B. subtilis, and orf2 from B. megaterium constitute a novel group of orthologous genes encoding glucose uptake proteins.
The physiological roles of these proteins, however, appear to be
different in Bacillus and S. xylosus. The
Bacillus glcU ortholog and the following gdh gene
are transcribed 3 h after the onset of sporulation in the
forespore by
G-containing RNA polymerase
(37), and glucose dehydrogenase activity is detected in
forespores and in mature spores (17). Therefore, the
ycxE gene product may also be present in spores and could perhaps play a role in glucose uptake in the germination process (52, 54). It does not seem to contribute to glucose uptake during vegetative growth. On the other hand, GlcU serves in S. xylosus, additionally to the PTS, to take up glucose during
growth. Coexpression of glcU and gdh suggests
that GlcU also recruits glucose for glucose dehydrogenase. Production
of gluconate by that enzyme would open an alternative route to
obtaining energy from glucose. As this possibility did not influence
CR, glucose dehydrogenase may be more important under physiological
conditions that are different from those in our study.
Besides the glcU orthologs, two genes that are clearly homologous to glcU are currently in the databases (AJ002481 and U17382). Both are found in gram-positive bacteria, S. pyogenes and L. helveticus, respectively, and both specify membrane proteins consistent with a function in transport processes. Due to the limited similarity to GlcU (40 and 32%, respectively) it appears difficult to predict the substrate for these putative uptake proteins, and experimental data are currently not available. Therefore, the function of these two proteins remains to be determined. So far, the family of glcU-related genes consists of only five members. The rapid progress in whole genome sequencing will most likely reveal new homologs and may eventually answer the question whether this group of genes remains restricted to gram-positive bacteria.
While the participation of GlcU in glucose uptake of S. xylosus is clear, the mechanism by which GlcU allows glucose to enter the cells remains to be elucidated. The activity of GlcU in uptake assays could only be demonstrated when glucose was metabolizable. In S. xylosus, GlcU-mediated transport of 2-deoxyglucose was not detectable, and in E. coli uptake of glucose by GlcU was apparently dependent on a functional glucose kinase. These results are indicative of sugar uptake by facilitated diffusion. By this process, sugars are taken up without the consumption of energy, but the carbohydrates cannot be accumulated against a concentration gradient. In conventional, long-term uptake assays, the activity of facilitated diffusion systems is only detectable with metabolizable substrates and shows a pronounced dependence on the respective sugar kinases (11). The fast equilibration of external and internal sugar concentrations mediated by facilitators may be detected by short-term uptake assays. In addition, influx counterflow is observed in sugar-preloaded cells (11, 38, 55). Attempts to demonstrate that GlcU indeed constitutes a glucose facilitator have so far not been successful. Despite this failure, we still favor the idea that GlcU is one of the few bacterial examples of facilitated diffusion systems (38, 46, 50, 55). Clearly, more work will be needed to elucidate the mechanism of GlcU-mediated glucose uptake.
Inactivation of glcU in S. xylosus resulted in a
partial loss of glucose-mediated repression of
-glucosidase,
-glucuronidase, and
-galactosidase activities (Table 2). Since
repression of
-glucosidase expression in glucose-grown cells is
exclusively exerted by CcpA (12), GlcU is obviously required
for full glucose-mediated CcpA activity. To account for this
observation, we suggest the following. When GlcU is inactive, reduced
glucose uptake leads to diminished accumulation of glycolytic
intermediates and eventually to a less active HPr kinase. Consequently,
activation of CcpA by HPr-ser-P in the presence of glucose is reduced
but not totally lost. If one considers glucose-6-phosphate as an
alternative effector for CcpA (15, 20), the consequences for
CcpA activation in the absence of GlcU would be the same. In any case,
the influence of GlcU on glucose-mediated CR should depend on a
functional glucose kinase. And indeed, a glucose kinase mutant of
S. xylosus, which has been described previously
(53), has virtually the same regulatory phenotype as the
glcU mutant strain. The isolation and subsequent inactivation of the HPr kinase gene will be needed to distinguish the
in vivo significance of HPr-ser-P and glucose-6-phosphate as effectors
for CcpA in S. xylosus.
The question arises why our
-galactosidase expression screen to
detect mutants defective in CR appeared to be biased towards glcU or, as in a previous study, the glucose kinase gene
glkA (53), genes that both affect PTS-independent
glucose utilization. Initially, we expected to isolate the
ccpA and the HPr kinase gene. During the analysis of
ccpA, which had been detected by a PCR approach
(13), and the lactose operon (1), it became clear
that CR of the lac operon is not exclusively due to CcpA. Plating the ccpA mutant on
-galactosidase screening
plates resulted in small colonies that were less colored than the wild
type, instead of the expected dark blue clones. Apparently, the growth
defect of the ccpA mutant (13) prevented
detection of the regulatory phenotype. One is tempted to speculate that
the HPr kinase mutant may exhibit a similar growth defect. Another
surprise was the failure to detect PTS genes. Whether this observation
really indicates that non-PTS glucose transport dominates PTS-mediated
glucose transport under these conditions remains an interesting
question for future studies.
In conclusion, the current work has led to the identification of a novel group of proteins responsible for PTS-independent uptake of glucose and, most likely, other compounds. Detailed biochemical work will be necessary to elucidate the mechanism by which these proteins recognize and take up their substrates.
| |
ACKNOWLEDGMENTS |
|---|
We thank F. Götz, in whose laboratory the work has been carried out, for continuous interest and support and P. L. Hyunh for excellent technical assistance. We also thank G. Sprenger for helpful advice in uptake assays.
The work was supported by the European Community Biotech Programme (BIO2-CT92-0137) and by the Deutsche Forschungsgemeinschaft (Br 947/3-1).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Mikrobielle Genetik, Universität Tübingen, Auf der Morgenstelle 28, D-72076 Tübingen, Germany. Phone: 49-7071-2974635. Fax: 49-7071-294634. E-mail address: reinhold.brueckner{at}uni-tuebingen.de.
Present address: Hämatologikum, GSF-München, D-81377
Munich, Germany.
Present address: European Patent Office, D-80331 Munich, Germany.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Bassias, J., and R. Brückner.
1998.
Regulation of lactose utilization genes in Staphylococcus xylosus.
J. Bacteriol.
180:2273-2279 |
| 2. |
Behari, J., and P. Youngman.
1998.
A homolog of CcpA mediates catabolite control in Listeria monocytogenes but not carbon source regulation of virulence genes.
J. Bacteriol.
180:6316-6324 |
| 3. | Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[Medline]. |
| 4. | Brückner, R. 1997. Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS Microbiol. Lett. 151:1-8[Medline]. |
| 5. |
Brückner, R.,
E. Wagner, and F. Götz.
1993.
Characterization of a sucrase gene from Staphylococcus xylosus.
J. Bacteriol.
175:851-857 |
| 6. | Buckley, N. D., and I. R. Hamilton. 1994. Vesicles prepared from Streptococcus mutans demonstrate the presence of a second glucose transport system. Microbiology 140:2639-2648[Abstract]. |
| 7. |
Chauvaux, S.,
I. T. Paulsen, and M. H. Saier, Jr.
1998.
CcpB, a novel transcription factor implicated in catabolite repression in Bacillus subtilis.
J. Bacteriol.
180:491-497 |
| 8. |
Curtis, S. J., and W. Epstein.
1975.
Phosphorylation of D-glucose in Escherichia coli mutants defective in glucosephosphotransferase, mannosetransferase, and glucokinase.
J. Bacteriol.
122:1189-1199 |
| 9. |
Cvitkovitch, D. G.,
D. A. Boyd,
T. Thevenot, and I. R. Hamilton.
1995.
Glucose transport by a mutant of Streptococcus mutans unable to accumulate sugars via the phosphoenolpyruvate phosphotransferase system.
J. Bacteriol.
177:2251-2258 |
| 10. | Dahl, M. K. 1997. Enzyme IIglc contributes to trehalose metabolism in Bacillus subtilis. FEMS Microbiol. Lett. 148:233-238. |
| 11. | DiMarco, A. A., and A. H. Romano. 1985. D-Glucose transport system of Zymomonas mobilis. J. Bacteriol. 49:151-157. |
| 12. | Egeter, O., and R. Brückner. 1996. Catabolite repression mediated by the catabolite control protein CcpA in Staphylococcus xylosus. Mol. Microbiol. 21:739-749[Medline]. |
| 13. |
Egeter, O., and R. Brückner.
1995.
Characterization of a genetic locus essential for maltose-maltotriose utilization in Staphylococcus xylosus.
J. Bacteriol.
177:2408-2415 |
| 14. | Fiegler, H., and R. Brückner. 1997. Identification of the serine acetyltransferase gene of Staphylococcus xylosus. FEMS Microbiol. Lett. 148:181-187[Medline]. |
| 15. |
Fujita, Y., and Y. Miwa.
1994.
Catabolite repression of the Bacillus subtilis gnt operon mediated by the CcpA protein.
J. Bacteriol.
176:511-513 |
| 16. | Fujita, Y., Y. Miwa, A. Galinier, and J. Deutscher. 1995. Specific recognition of the Bacillus subtilis gnt cis-acting catabolite-responsive element by a protein complex formed between CcpA and seryl-phosphorylated HPr. Mol. Microbiol. 17:953-960[Medline]. |
| 17. |
Fujita, Y.,
R. Ramaley, and E. Freese.
1977.
Location and properties of glucose dehydrogenase in sporulating cells and spores of Bacillus subtilis.
J. Bacteriol.
132:282-293 |
| 18. |
Galinier, A.,
J. Haiech,
M. C. Kilhoffer,
M. Jaquinod,
J. Stülke,
J. Deutscher, and I. Martin-Verstraete.
1997.
The Bacillus subtilis crh gene encodes a HPr-like protein involved in carbon catabolite repression.
Proc. Natl. Acad. Sci. USA
94:8439-8444 |
| 19. |
Galinier, A.,
M. Kravanja,
R. Engelmann,
W. Hengstenberg,
M. C. Kilhoffer,
J. Deutscher, and J. Haiech.
1998.
New protein kinase and protein phosphatase families mediate signal transduction in bacterial catabolite repression.
Proc. Natl. Acad. Sci. USA
95:1823-1828 |
| 20. | Gösseringer, R., E. Küster, A. Galinier, J. Deutscher, and W. Hillen. 1997. Cooperative and non-cooperative DNA binding modes of catabolite control protein CcpA from Bacillus megaterium result from sensing two different signals. J. Mol. Biol. 266:665-676[Medline]. |
| 21. | Götz, F., J. Zabielski, L. Philipson, and M. Lindberg. 1983. DNA homology between the arsenate resistance plasmid pSX267 from Staphylococcus xylosus and the penicillinase plasmid pI258 from Staphylococcus aureus. Plasmid 9:126-137[Medline]. |
| 22. | Hammes, W. P. 1990. Bacterial starter cultures in food production. Food Biotechnol. 4:383-397. |
| 23. | Henkin, T. M., F. J. Grundy, W. L. Nicholson, and G. H. Chambliss. 1991. Catabolite repression of alpha-amylase gene expression in Bacillus subtilis involves a trans-acting gene product homologous to the Escherichia coli lacl and galR repressors. Mol. Microbiol. 5:575-584[Medline]. |
| 24. |
Hofmann, K., and W. Stoffel.
1993.
TMbase a database of membrane spanning segments.
Biol. Chem. Hoppe-Seyler
347:166.
|
| 25. | Hueck, C. J., W. Hillen, and M. H. Saier, Jr. 1994. Analysis of a cis-active sequence mediating catabolite repression in gram-positive bacteria. Res. Microbiol. 145:503-518[Medline]. |
| 26. | Hueck, C. J., A. Kraus, D. Schmiedel, and W. Hillen. 1995. Cloning, expression and functional analyses of the catabolite control protein CcpA from Bacillus megaterium. Mol. Microbiol. 16:855-864[Medline]. |
| 27. |
Kim, J. H., and G. H. Chambliss.
1997.
Contacts between Bacillus subtilis catabolite regulatory protein CcpA and amyO target site.
Nucleic Acids Res.
25:3490-3496 |
| 28. |
Kim, J. H.,
Z. T. Guvener,
J. Y. Cho,
K. C. Chung, and G. H. Chambliss.
1995.
Specificity of DNA binding activity of the Bacillus subtilis catabolite control protein CcpA.
J. Bacteriol.
177:5129-5134 |
| 29. |
Kim, J. H.,
M. I. Voskuil, and G. H. Chambliss.
1998.
NADP, corepressor for the Bacillus catabolite control protein ccpA.
Proc. Natl. Acad. Sci. USA
95:9590-9595 |
| 30. | Kunst, F., N. Ogasawara, I. Moszer, A. M. Albertini, G. Alloni, V. Azevedo, M. G. Bertero, P. Bessieres, A. Bolotin, S. Borchert, R. Borriss, L. Boursier, A. Brans, M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B. Caldwell, V. Capuano, N. M. Carter, S. K. Choi, J. J. Codani, I. F. Connerton, A. Danchin, et al. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249-256[Medline]. |
| 31. | Kyte, J., and R. F. Doolittle. 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157:105-132[Medline]. |
| 32. |
Lokman, B. C.,
M. Heerikhuisen,
R. J. Leer,
A. van den Broek,
Y. Borsboom,
S. Chaillou,
P. W. Postma, and P. H. Pouwels.
1997.
Regulation of expression of the Lactobacillus pentosus xylAB operon.
J. Bacteriol.
179:5391-5397 |
| 33. | Luesink, J. L., R. E. M. A. van Herpen, B. P. Grossiord, O. P. Kuipers, and d. V. W. M. 1998. Transcriptional activation of the glycolytic las operon and catabolite repression of the gal operon in Lactococcus lactis are mediated by the catabolite control protein CcpA. Mol. Microbiol. 30:789-798[Medline]. |
| 34. | Mitamura, T., R. V. Ebora, T. Nakai, Y. Makino, S. Negoro, I. Urabe, and H. Okada. 1990. Structure of isoenzyme genes of glucose dehydrogenase from Bacillus megaterium IAM1030. J. Ferment. Bioeng. 70:363-369. |
| 35. | Miwa, Y., K. Nagura, S. Eguchi, H. Fukuda, J. Deutscher, and Y. Fujita. 1997. Catabolite repression of the Bacillus subtilis gnt operon exerted by two catabolite-responsive elements. Mol. Microbiol. 23:1203-1213[Medline]. |
| 36. |
Monedero, V.,
M. J. Gosalbes, and G. Pérez-Martínez.
1997.
Catabolite repression in Lactobacillus casei ATCC 393 is mediated by CcpA.
J. Bacteriol.
179:6657-6664 |
| 37. |
Nakatani, Y.,
W. Nicholson,
W. L. Neitzke,
P. Setlow, and E. Freese.
1988.
Sigma-G RNA polymerase controls forespore-specific expression of the glucose dehydrogenase operon in Bacillus subtilis.
Nucleic Acids Res.
17:999-1017 |
| 38. | Parker, C., W. O. Barnell, J. L. Snoep, L. O. Ingram, and T. Conway. 1995. Characterization of the Zymomonas mobilis glucose facilitator gene product (glf) in recombinant Escherichia coli: examination of transport mechanism, kinetics and the role of glucokinase in glucose transport. Mol. Microbiol. 15:795-802[Medline]. |
| 39. |
Paulsen, I. T.,
S. Chauvaux,
P. Choi, and M. H. Saier, Jr.
1998.
Characterization of glucose-specific catabolite-resistant mutants of Bacillus subtilis: identification of a novel hexose:H+ symporter.
J. Bacteriol.
180:498-504 |
| 40. | Peschke, U., V. Beuck, H. Bujard, R. Gentz, and S. Le Grice. 1985. Efficient utilization of Escherichia coli transcriptional signals in Bacillus subtilis. J. Mol. Biol. 186:547-555[Medline]. |
| 41. | Postma, P. W., J. W. Lengeler, and G. R. Jacobson. 1993. Phosphoenolpyruvate: carbohydrate phosphotransferase systems of bacteria. Microbiol. Rev. 6:543-594. |
| 42. | Ramseier, T. M., J. Reizer, E. Küster, W. Hillen, and M. H. Saier. 1995. In vitro binding of the CcpA protein of Bacillus megaterium to cis-acting catabolite responsive elements (CREs) of gram-positive bacteria. FEMS Microbiol. Lett. 129:207-213[Medline]. |
| 43. |
Rather, P. N., and C. P. Moran, Jr.
1988.
Compartment-specific transcription in Bacillus subtilis: identification of the promoter for gdh.
J. Bacteriol.
170:5086-5092 |
| 44. | Reizer, J., C. Hoischen, F. Titgemeyer, C. Rivolta, R. Rabus, J. Stülke, D. Karamata, M. H. J. Saier, and W. Hillen. 1998. A novel protein kinase that controls carbon catabolite repression in bacteria. Mol. Microbiol. 27:1157-1169[Medline]. |
| 45. | Reizer, J., S. L. Sutrina, M. H. Saier, G. C. Stewart, A. Peterkofsky, and P. Reddy. 1989. Mechanistic and physiological consequences of HPr(ser) phosphorylation on the activities of the phosphoenolpyruvate:sugar phosphotransferase system in gram-positive bacteria: studies with site-specific mutants of HPr. EMBO J. 8:2111-2120[Medline]. |
| 46. |
Russell, J. B.
1990.
Low-affinity, high-capacity system of glucose transport in the ruminal bacterium Streptococcus bovis: evidence for a mechanism of facilitated diffusion.
Appl. Environ. Microbiol.
56:3304-3307 |
| 47. | Saier, M. H., Jr. 1991. A multiplicity of potential carbon catabolite repression mechanisms in prokaryotic and eukaryotic microorganisms. New Biol. 3:1137-1147[Medline]. |
| 48. | Saier, M. H., Jr., S. Chauvaux, J. Deutscher, J. Reizer, and J. J. Ye. 1995. Protein phosphorylation and regulation of carbon metabolism in gram-negative versus gram-positive bacteria. Trends Biochem. Sci. 20:267-271[Medline]. |
| 49. | Schleifer, K. H., and W. E. Kloos. 1975. Isolation and characterization from human skin. I. Amended descriptions of Staphylococcus epidermidis and Staphylococcus saprophyticus and description of three new species: Staphylococcus cohnii, Staphylococcus haemolyticus and Staphylococcus xylosus. J. Syst. Bacteriol. 174:3042-3048. |
| 50. |
Sweet, G.,
C. Gandor,
R. Voegele,
N. Wittekindt,
J. Beuerle,
V. Truniger,
E. C. Lin, and W. Boos.
1990.
Glycerol facilitator of Escherichia coli: cloning of glpF and identification of the glpF product.
J. Bacteriol.
172:424-430 |
| 51. |
Teusink, B.,
J. A. Diderich,
H. V. Westerhof,
K. van Dam, and M. C. Walsh.
1998.
Intracellular glucose concentration in derepressed yeast cells consuming glucose is high enough to reduce the glucose transport rate by 50%.
J. Bacteriol.
180:556-562 |
| 52. |
Vary, J. C., and H. O. Halvorson.
1968.
Initiation of bacterial spore germination.
J. Bacteriol.
95:1327-1334 |
| 53. |
Wagner, E.,
S. Marcandier,
O. Egeter,
J. Deutscher,
F. Götz, and R. Brückner.
1995.
Glucose kinase-dependent catabolite repression in Staphylococcus xylosus.
J. Bacteriol.
177:6144-6152 |
| 54. |
Wax, R., and E. Freese.
1968.
Initiation of the germination of Bacillus subtilis spores by a combination of compounds in place of L-alanine.
J. Bacteriol.
95:433-438 |
| 55. |
Weisser, P.,
R. Krämer,
H. Sahm, and G. A. Sprenger.
1995.
Functional expression of the glucose transporter of Zymomonas mobilis leads to restoration of glucose and fructose uptake in Escherichia coli mutants and provides evidence for its facilitator action.
J. Bacteriol.
177:3351-3354 |
| 56. | Yamane, K., M. Kumano, and K. Kurita. 1996. The 25 degrees-36 degrees region of the Bacillus subtilis chromosome: determination of the sequence of a 146 kb segment and identification of 113 genes. Microbiology 142:3047-3056[Abstract]. |
| 57. | Youngman, P., H. Poth, B. Green, K. York, G. Olmedo, and K. Smith. 1989. Methods for genetic manipulation, cloning, and functional analysis of sporulation genes in Bacillus subtilis, p. 65-87. In I. Smith, A. Slepecky, and P. Setlow (ed.), Regulation of procaryotic development. American Society for Microbiology, Washington, D.C. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||