JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Forti, F.
Right arrow Articles by Ghisotti, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Forti, F.
Right arrow Articles by Ghisotti, D.

Journal of Bacteriology, September 1999, p. 5225-5233, Vol. 181, No. 17
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Translation of Two Nested Genes in Bacteriophage P4 Controls Immunity-Specific Transcription Termination

Francesca Forti,1 Simona Polo,1,dagger Kirk B. Lane,2,Dagger Erich W. Six,2 Gianpiero Sironi,1 Gianni Dehò,1 and Daniela Ghisotti1,*

Dipartimento di Genetica e di Biologia dei Microrganismi, Università di Milano, Milan, Italy,1 and Department of Microbiology, University of Iowa, Iowa City, Iowa 522422

Received 11 December 1998/Accepted 15 June 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

In phage P4, transcription of the left operon may occur from both the constitutive PLE promoter and the regulated PLL promoter, about 400 nucleotides upstream of PLE. A strong Rho-dependent termination site, timm, is located downstream of both promoters. When P4 immunity is expressed, transcription starting at PLE is efficiently terminated at timm, whereas transcription from PLL is immunity insensitive and reads through timm. We report the identification of two nested genes, kil and eta, located in the P4 left operon. The P4 kil gene, which encodes a 65-amino-acid polypeptide, is the first translated gene downstream of the PLE promoter, and its expression is controlled by P4 immunity. Overexpression of kil causes cell killing. This gene is the terminal part of a longer open reading frame, eta, which begins upstream of PLE. The eta gene is expressed when transcription starts from the PLL promoter. Three likely start codons predict a size between 197 and 199 amino acids for the Eta gene product. Both kil and eta overlap the timm site. By cloning kil upstream of a tRNA reporter gene, we demonstrated that translation of the kil region prevents premature transcription termination at timm. This suggests that P4 immunity might negatively control kil translation, thus enabling transcription termination at timm. Transcription starting from PLL proceeds through timm. Mutations that create nonsense codons in eta caused premature termination of transcription starting from PLL. Suppression of the nonsense mutation restored transcription readthrough at timm. Thus, termination of transcription from PLL is prevented by translation of eta.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Phage-plasmid P4 enjoys multiple ways of propagation in its host, Escherichia coli. If the bacterial cell harbors the genome of a helper phage, such as P2, P4 can perform the lytic cycle, relying on the morphogenetic functions of the helper for the construction of its capsid and tail and for cell lysis. In the absence of the helper, P4 can propagate as a multicopy plasmid. Both in the presence and in the absence of the helper phage, P4 can establish lysogenic conditions, integrating its genome in the bacterial chromosome and establishing the immune state (for a review, see reference 29).

Under lysogenic conditions, P4 prevents the expression of the lytic genes by a peculiar mechanism based on premature transcription termination (14, 19). The P4 left operon encodes both the immunity and the replication functions (Fig. 1). Early during infection, this operon is transcribed from the constitutive PLE promoter; within 15 min, the P4 immunity control is established and transcription from PLE is subject to strong premature termination at a Rho-dependent termination site, timm, located about 450 nucleotides (nt) downstream of the promoter (7, 38). Moreover, the transcripts are readily processed to <= 0.3-kb RNAs (immunity transcripts) (7, 17, 38). Thus, only the leader region of the operon is transcribed, and expression of the replication functions, located in the distal part of the operon, is prevented.


View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1.   Genetic map and transcription profile of the P4 essential left operon. The map of the nt 4500 to 9500 P4 genome is shown. The promoters and the timm transcription termination site are indicated. The transcripts synthesized early after infection, late in the lytic cycle, or under the plasmid conditions and in the immune state are indicated (11, 13, 14). CI indicates the small CI RNA, produced by processing (17).

The P4 immunity determinants are located in the leader region of the left operon (Fig. 1 and 2). The immunity factor, encoded by the cI gene, is a small RNA, the CI RNA, produced by processing of longer transcripts (17). A sequence internal to CI, seqB, shows complementarity to two sequences, seqA and seqC, located upstream and downstream of cI, respectively (the seqC sequence is split into seqC' and seqC") (38) (Fig. 2). The seqA and seqC sequences represent the target sites of the CI RNA. P4 immunity is controlled by RNA-RNA interactions between the CI RNA and the seqA and seqC sequences on the nascent transcript, causing premature transcription termination at timm (7, 38). How the CI RNA elicits transcription termination is still unexplained.


View larger version (47K):
[in this window]
[in a new window]
 
FIG. 2.   Sequence of the 5' region of the P4 left operon. The coding strand of the P4 nt 8126 to 9125 region and the amino acid sequence (in single-letter code) are shown. The transcription start points from PLL and PLE and the vis, eta, kil, and varepsilon  initiation codons are indicated. The stop codons are indicated by asterisks. The ribosome binding sites of vis and kil are underlined. The region encoding the CI RNA is boxed (the 3' end was modified as described in reference 16). The seqA, seqC', and seqC" regions are indicated by dots; the bases of the seqB region complementary to seqA and seqC are indicated by the upper and lower sets of dots, respectively. The positions of the mutations are indicated above the sequence. The indicated ash10 mutation is identical to the ash2, ash4, ash26, and ash28 mutations. The ash7 mutation was sequenced by Lane (26). The ash3, ash8, ash9, ash10, and cI405 mutations had been sequenced previously (28). All other ash mutations shown were sequenced as part of a thesis project (26) and of the work reported here. They include two mutations, ash7 and ash23, which do not suppress P4 virulence.

Mutations either in the cI gene or in the seqA and seqC target sequences may impair the immunity control. In these mutants, transcription from PLE is not subject to efficient termination at timm, thus leading to protracted expression of the replication genes and impairment of the ability of P4 to lysogenize the bacterial cell (17, 38).

In the plasmid state and late in the lytic cycle, expression of the replication functions encoded by the left operon is achieved by activating the late PLL promoter, located about 400 bp upstream of PLE (Fig. 1 and 2) (11, 13, 28, 39). This promoter is under the control of both positive (delta  gene product [11]) and negative (vis gene product [33]) P4-encoded regulators. Although transcription from PLL covers the timm region, it is not subject to premature termination. In particular, when P4 establishes the plasmid state, both the PLE and PLL promoters are active but only transcription from PLL can read through timm. Thus, the immunity control acts only on transcription starting at PLE (7, 14, 38). The P4 virulent mutant, P4 vir1, carries a promoter-up mutation in PLL (28) (Fig. 2) that enables it to bypass the immunity control by allowing early expression of the left operon from the mutated promoter (13).

P4 cI mutants form clear plaques (6, 8). They can also be isolated by selecting for the Ash phenotype, i.e., the ability to grow on a host lysogenic for P3, a P2-like helper phage (6, 28). Several P4 Ash- mutants have been sequenced and found to carry a base substitution in cI (6, 28) (Fig. 2). Conversely, the cI405 mutation is also found to exhibit the Ash- phenotype (28). The mutant phages are affected in lysogenization ability, and premature transcription termination at timm is not efficient; hence, the expression of the downstream genes of the operon is protracted (14, 28). This suggests that the Ash- phenotype might be correlated to overexpression of one or more genes of the left operon. A peculiar kind of P4 Ash- mutant is represented by the ash10 mutation, a base insertion in cI (28). This mutation suppresses the virulence conferred by the vir1 mutation, as shown by the inability of P4 vir1 ash10 to plate on a P4 P2 double lysogen (6, 28). A possible explanation for this phenotype is reported below.

Several P4 cI mutants (cI405, ash3, and ash7) kill the host after infection (8, 26, 27, 38). Cell death does not depend on P4 lytic growth, since it occurs in the absence of the P2 helper phage. Moreover, it is not observed when the infected cells are lysogenic for P4 or carry P4 in the plasmid condition (1). These observations led us to hypothesize the presence of a lethal function, which is normally under the control of P4 immunity and which is overexpressed in P4 cI mutants. The isolation of a P4 cI405 derivative, P4 cI405 kil1, which is unable to establish the immune lysogenic state but does not cause cell death after infection, supported this hypothesis (1). The kil1 mutation is recessive and linked to cI405.

In this paper, we describe two nested genes, kil and eta, whose coding sequences cover the timm region and demonstrate that their translation prevents transcription termination at timm. Moreover, the cI gene is also nested within the eta gene. Thus, the cI DNA segment encodes both the CI RNA and the amino acid residues in the middle of the Eta polypeptide.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Bacteria and phages. The bacterial strains used were the Escherichia coli C strains C-1a (prototrophic) (42), C-8 (polyauxotropic; str-1) (4), C-236 (C-8 lysogenic for P2 and P4) (44), C-283 (C-8 lysogenic for P3) (from the Six collection), C-295 (C-1a lysogenic for P2) (42), C-520 (supD) (48), C-5205 (polyauxotrophic; str-1 supD) (12), and C-5580 (C-520 lysogenic for P2 and P4) (this work) and the E. coli K-12 strain JM101 (50). The phages used were P2 (3); P3 (5); P4 (44); P4 ash7 (from the Six collection); P4 ash23 (27); P4 cI405 (8); P4 cI405 kil1 (1); P4 vir1 (30); P4 vir1 ash10 (28); P4 vir1 ash2 and P4 vir1 ash4 (from the Six collection); P4 vir1 ash28, P4 vir1 ash29, P4 vir1 ash31, P4 vir1 ash32, and P4 vir1 ash33 (reference 26 and this work), and P4 vis2 (from the Milan collection). The P4 genome coordinates are from the updated P4 DNA sequence (GenBank accession no. X51522 [20, 51]).

Plasmids. The plasmid vectors used were pUC8, pUC18, and pUC19 (49, 50) and pGM331, a pGZ119EH derivative carrying the tRNAGly reporter gene downstream of the ptac promoter (7). pGM216 was constructed by insertion of the nt 8130 to 8626 DNA fragment of P4 cI405 kil1 in the AccI-SmaI sites of the pUC19 vector. pGM236 carries the nt 6447 to 10657 P4 region cloned in the BamHI-NdeI sites of pUC18. pGM260 carries the P4 nt 9023 to 8657 region inserted into the SmaI site of the pUC8 vector. The resulting plasmid contains the plac promoter, the Shine-Dalgarno sequence and the first 11 codons of lacZ fused in frame with the third codon of vis, followed by eta fused with the terminal part of lacZ (see Fig. 5). pGM262 was derived from pGM260 by EcoRI digestion, filling in, and religation, thus creating a nonsense mutation in codon 6 of lacZ. pGM672, pGM673, and pGM674 are pGM331 derivatives in which the nt 8401 to 8130 region from P4+, P4 cI405 kil1, and P4 kil343, respectively, obtained by PCR amplification, has been cloned between ptac and the tRNAGly reporter gene.

Construction of kil-lacZ fusions. The lacZ gene of pUC19, lacking the first amino-terminal codons and the upstream ribosome binding site, was obtained by PCR amplification with three pairs of oligonucleotides (263 [TGCAGGATCCCTATGCGGCATCAGAGCAG] plus 264 [GTACGGATCCACTGGCCGTCGTTTTACAAC]; 263 plus 265 [GTACGGATCCCACTGGCCGTCGTTTTACAAC], and 263 plus 266 [TGCAGGATCCGCACTGGCCGTCGTTTTACAAC]). The amplified fragments differ from each other for 1 or 2 bp at the 5' end of the lacZ gene. The fragments were digested with BamHI and cloned in the BamHI site of pGM331. A set of three plasmids in which the lacZ reading frame is shifted by 1 or 2 bp was obtained. The P4 nt 8401 to 8342 DNA fragment was cloned in the above plasmids, and expression of beta -galactosidase activity was monitored by observing the colony color in the presence of 5-bromo-4-chloro-3-indolyl-beta -D-galactopyranoside (X-Gal) (40 µg/ml) and isopropyl-beta -D-thiogalactopyranoside (IPTG) (40 µg/ml).

Generation of the kil343 mutation. The kil343 mutation (a GC-to-CG mutation at nt 8343 [Fig. 2]) was obtained by PCR amplification of the P4 nt 8421 to 8130 region by using the "overlap extension" technique (22). The resulting DNA fragment was cloned in pUC18 and sequenced.

Isolation of the P4 Ash mutants that suppress P4 virulence. It has been reported (6, 28) that a P4 vir1 ash10 mutant, unlike P4 vir1, cannot be plated on a P2-P4 double lysogen (virulence suppression phenotype of the ash10 mutation). Based on the hypothesis that virulence suppression could be due to stop codons in eta, we searched for other virulence-suppressing P4 Ash- mutants, both spontaneous and hydroxylamine induced. The Ash- mutants were screened to identify those whose virulence-suppressing phenotype could be reversed by nonsense suppressors.

(i) Isolation of spontaneous mutants. Five independent lysates of P4 vir1 were plated (approximately 107 PFU) on C-283, a P3 lysogenic strain. The ash mutants appeared at a frequency of 10-6. Among such P4 vir1 ash mutants, some formed semiturbid plaques on the P2 lysogen C-295 and did not plate on the P2 P4 double lysogen C-236. Three independent mutants (P4 vir1 ash2, P4 vir1 ash4, and P4 vir1 ash28), unable to be plated on a P2-P4 double lysogen (virulence suppression phenotype), were isolated and sequenced. An insertion of a C at nt 8438 to 8442 was found in all three mutants; thus, the mutation was identical to ash10.

(ii) Hydroxylamine mutagenesis. A P4 vir1 stock at 2 × 1011 PFU/ml in 0.075 M MgCl2 was mixed with 1 volume of 2 M hydroxylamine and incubated at 37°C. Samples were removed after 4, 8, and 20 h, hydroxylamine was inactivated with 10% acetone, the phage surviving the mutagenic treatment was assayed, and P4 vir1 ash mutants were selected by plating on C-283. The frequency of ash mutants was increased from 10-6 to 10-4 by the mutagenic treatment. The ability of the P4 ash mutants to form plaques on C-236 was tested. The P4 vir1 ash mutants that exhibited virulence suppression were spotted on C-5580 to identify the amber mutants. Four independent mutants (P4 vir1 ash29, P4 vir1 ash31, P4 vir1 ash32, and P4 vir1 ash33) were isolated. Restriction analysis showed that all four mutations created a MaeI site in the nt 7041 to 8655 region. P4 vir1 ash29 was sequenced and found to carry a G-to-A transition at 8433. The ash29 mutation suppressed P4 virulence on a wild-type E. coli host, but did not do so on both supD and supF amber suppressor strains; on the other hand, the Ash- phenotype (ability to grow on a P3 lysogen) was not noticeably affected by the amber suppressor (data not shown).

Marker rescue. E. coli C-5205(P2) carrying pGM216, in which the P4 cI405 kil1 nt 8626 to 8130 region is cloned, was infected with P4+, and the phage produced was analyzed. The phages that formed clear plaques were tested for the ability to grow on P3 lysogens (Ash phenotype) and for causing cell death upon infection of C-1a (killing phenotype). P4 cI405 kills the infected cells and is Ash- (8, 28), whereas P4 cI405 kil1 does not kill the cells and is Ash+ (1). Of 31 clear plaques analyzed, 17 were Ash- and caused cell killing after infection (like P4 cI405) and were Ash+ and did not cause cell killing (like P4 cI405 kil1). Thus, both the cI405 mutation and the cI405 kil1 double mutations could be rescued from the 8626 to 8130 region at a similar frequency. P4 cI+ kil1 recombinants could not be identified.

Northern blot hybridization. RNA was extracted from E. coli and from P4-infected cells, fractionated on either 1.5% formamide-formaldehyde agarose or 10% polyacrylamide-urea denaturing gels, and transferred to Hybond N filter membranes (Amersham) as described previously (14). The 32P-labeled RNA probes PLE-t2 and PLL cover the P4 nt 8418 to 8774 and nt 8774 to 9023 regions, respectively, and were prepared and used for the hybridization as described previously (14). The oligonucleotide used for Northern analysis of tRNAGly expression (45) was 5'-end labeled with T4 polynucleotide kinase in the presence of [gamma -32P]ATP as described by Sambrook et al. (40). Hybridization was performed as described by Briani et al. (7).

Computer sequence analysis. For sequence analysis, we used several programs of the Wisconsin package versions 9 and 10, Genetics Computer Group (GCG), Madison, Wis., in particular Bestfit, Pepsort, Pileup, and FoldRNA. For database searches, we used the Blast programs (2).


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Identification of the P4 kil gene. Infection of E. coli with P4 cI405 leads to cell killing, whereas no death occurs after infection with either P4+ or P4 cI405 kil1 (1). In attempts to clone P4 cI405 DNA fragments in the pUC18 vector, we were unable to isolate viable transformants with plasmids carrying the nt 8774 to 8130 fragment, which includes the constitutive promoter PLE and the downstream 570 nt (Fig. 3). The same fragment derived from either P4+ or P4 cI405 kil1 could be readily cloned, as well as the smaller nt 8774 to 8418 fragment of P4 cI405. This suggested that the P4 nt 8774 to 8130 region encodes the function responsible for cell killing upon P4 cI405 infection.


View larger version (15K):
[in this window]
[in a new window]
 
FIG. 3.   Effect on cell viability of cloned P4 fragments. The map of the P4 region from kb 8.1 to 9.2 is shown. The genes are boxed. The seqA, seqB, and seqC inverted and direct repeats are indicated by arrows. The positions of the PLE and PLL transcription start points and of the timm terminator are indicated. The coordinates of the fragments derived from P4 wild type (wt), P4 cI405, P4 cI405 kil1, and P4 kil343 cloned in the pUC8 vector are indicated. Strain JM101 was transformed, and the viability of the clones carrying the above constructs was tested. +, viable; -, nonviable; -*, not obtained; nt, not tested. For the constructs lacking the PLE promoter, viability was measured in the presence of IPTG (40 µg/ml) to induce the plac promoter.

To map the putative kil gene, we cloned the nt 8626 to 8130 and nt 8470 to 8130 DNA fragments of P4+, P4 cI405, and P4 cI405 kil1, in which the PLE promoter region is deleted, downstream of the plac promoter. All fragments could be cloned under noninducing conditions. However, after induction of transcription from plac, the fragments derived from P4 cI405 caused cell death whereas the fragments derived from either P4+ or P4 cI405 kil1 did not. Moreover, the cloned kil+ nt 8421 to 8130 fragment caused cell killing after induction of plac whereas the kil1 did not (in such fragments, part of the immunity region including the cI405 locus is deleted [28]). Thus, we concluded that (i) the killing function is encoded within the nt 8421 to 8130 region; (ii) the kil1 mutation, which inactivates the killing function, maps in this region; and (iii) the cI405 mutation is not directly responsible for cell death but, rather, might alter the control of the lethal function.

The nt 8626 to 8130 region of P4 cI405 kil1 was cloned in pGM216 (see Materials and Methods). Both the cI405 and the kil1 mutations were rescued after infection with P4+ of E. coli(P2) carrying this plasmid. By sequencing pGM216 we found, on the DNA strand shown in Fig. 2, in addition to the cI405 mutation (a C to T substitution at nt 8446), a deletion of a C in a series of five C's at nt 8345 to 8349 (Fig. 2 and data not shown). Thus, kil1 appears to be a frameshift mutation in an open reading frame (ORF) that starts upstream of nt 8345. To define the possible start codon and frame of translation, we created a fusion of the nt 8401 to 8342 P4 DNA fragment and the lacZ gene in the three possible frames (see Materials and Methods). In these constructs, expression of beta -galactosidase activity depends on translational control sequences present in the P4 fragment. Light blue colonies were found only in the construct, in which lacZ is in frame with the ATG codon at nt 8365 (Fig. 2). In P4, this ORF is preceded by a good potential ribosome binding site and encodes a 65-amino-acid polypeptide (orf65). The kil1 deletion causes a frameshift in codon 7 of orf65.

To confirm that orf65 encodes the killing function, we constructed by PCR mutagenesis a C-to-G base substitution at 8343 (kil343 [Fig. 2]), creating a stop codon (UAG) in codon 8 of the ORF. A plasmid carrying the nt 8421 to 8130 P4 region with the kil343 mutation did not cause cell killing when transcription of this region was induced from the plac promoter (Fig. 3). Thus, orf65 is the P4 kil gene.

Cell death caused by kil expression. To analyze the effects of kil expression on the viability of the bacterial host, a culture of strain C-1a was infected with P4 cI405 and the effects on cell growth were monitored. The turbidity of the culture increased exponentially for at least 5 h after the infection; however, microscopic observation of the infected cells showed that after 3 h about 45% of the cells appeared as filaments about 10 times the length of a normal E. coli cell and after 5 h, most cells were long, aggregated filaments (data not shown). All the macromolecular syntheses (DNA, RNA, and protein) of the host continued at a normal rate up to 3 h after infection, whereas a 50% decrease was observed after 5 h (data not shown). On the other hand, the fraction of cells surviving the infection, as measured by colony formation, was 0.2%. Unviable microcolonies containing filamentous cells were visible at low magnification.

Similarly, upon induction of transcription of the cloned kil gene, arrest of cell division and consequent filamentation were observed and the increase of the cell mass stopped after 3 h (data not shown); viable counts were less than 0.1% of the noninduced cells.

Translation of the kil gene interferes with transcription termination at timm. The Rho-dependent termination site timm is located within the kil gene (7), suggesting that translation of kil would interfere with transcription termination at timm. Thus, we tested whether kil translation and transcription termination were inversely correlated. We cloned a tRNAGly reporter gene downstream of the kil region and analyzed transcription beyond timm by monitoring tRNA production. Constructs carrying the wild-type kil gene (pGM672), the kil343 nonsense mutation (pGM674), or the kil1 frameshift mutation (pGM673) were obtained (Fig. 4). RNA was extracted from cultures of C-1a carrying the above plasmids at different time points after the addition of the IPTG inducer, and the presence of tRNAGly was monitored by Northern analysis (see Materials and Methods). Cell killing was also measured. We found that induction of wild-type kil expression (pGM672) leads to cell killing and tRNA production. In pGM674, the kil343 nonsense mutation not only prevented cell killing but also caused premature transcription termination at timm, as indicated by the lack of production of the reporter tRNA. In pGM673, the kil1 frameshift mutation, which does not generate a translational stop codon downstream, prevents cell killing but does not affect tRNA production. These results indicate that translation of the kil region, but not the presence of the Kil protein, is required for override of timm.


View larger version (15K):
[in this window]
[in a new window]
 
FIG. 4.   Correlation between kil translation and transcription termination at timm. (A) The nt 8130 to 8401 P4 region was cloned in the pGM331 vector, upstream of the tRNAGly reporter gene. (B) The DNA was derived from P4 wild type, P4 kil1 (frameshift) and P4 kil343 (nonsense) in pGM672, pGM673, and pGM674, respectively. Expression of the kil gene was monitored by measuring cell death in the presence of 40 µg of IPTG per ml, to induce transcription from ptac. The production of tRNAGly, measured by Northern blotting, is shown: RNA was extracted at the times indicated (in minutes) after the induction with IPTG, from C-1a cultures carrying the plasmids indicated, fractionated by electrophoresis on a 10% acrylamide gel, and hybridized to the tRNAGly specific oligonucleotide, 32P labelled at the 5' end.

The kil gene is the terminal segment of a longer ORF expressed from PLL. By sequence inspection, we found that the kil gene is the terminal part of a longer ORF that extends upstream of PLE (Fig. 2). This ORF could be translated when transcription starts from PLL. Four ATG codons are found upstream of PLE: one is at nt 8814, within vis, the first gene downstream of PLL, and three consecutive ATG codons partially overlap the stop codon of vis. No good ribosome binding sites are found immediately upstream of these ATG codons, suggesting that this ORF might be translationally coupled to vis.

To test whether the ORF would be translated, the P4 nt 9023 to 8659 region, carrying the vis gene and the 5'-terminal part of the downstream ORF, was cloned in pUC8, creating a fusion with the lacZ gene (pGM260) (Fig. 5). Strain JM101 transformed with the above plasmid formed blue colonies when plated on medium containing IPTG and X-Gal. A similar construct (pGM262), in which a stop codon upstream of the cloned fragment prevents vis translation, gave rise to white colonies. This indicates that translation is coupled to the upstream vis gene translation. The translational coupling favors the hypothesis that translation initiates at an ATG codon partially overlapped with the vis stop codon, thus encoding a 199-amino-acid protein. We named this gene eta (for "enables transcription antitermination" [see below]).


View larger version (11K):
[in this window]
[in a new window]
 
FIG. 5.   Translation of the P4 eta gene. A schematic representation of pGM260 and pGM262, in which the P4 nt 9023 to 8659 region is cloned, creating an eta-lacZ fusion, is shown. pGM262 contains a translational stop codon at the 5' end of vis. The plasmids were carried by JM101. The colors of the colonies grown in the presence of IPTG (40 µg/ml) and X-Gal (40 µg/ml) are reported.

Translation of eta prevents premature transcription termination at timm. Since eta covers the timm region, it might be supposed that its translation prevents transcription termination at this site. This might explain why transcription starting from PLL reads through timm. To verify the above hypothesis, we tested whether mutations that create a stop codon in eta induce premature termination of transcription starting from PLL. Two mutations of this type were tested: ash10, a base insertion at nt 8438 that creates a stop codon at 8414 (Fig. 2) (28), and ash29, a base substitution that creates an amber codon at 8433 (Fig. 2) (see Materials and Methods). It should be noted that both mutations are located in the segment of eta that contains the cI gene. Thus, the mutations not only affect eta translation but also produce a defective CI RNA.

We used Northern blotting to analyze the transcripts synthesized by P4 vir1 ash10 and P4 vir1 ash29 after infection of strain C-1a (Fig. 6A and data not shown). The phages carried the vir1 promoter-up mutation to increase the amount of transcription starting from PLL (13). The RNAs were hybridized with the PLE-t2 probe, which covers the PLE proximal region and identifies transcripts starting from both PLE and PLL. The same filters were hybridized with the PLL riboprobe, specific for transcripts from PLL. Comparing the transcription pattern of the mutants with that of P4 vir1, the major effect of the mutations was the lack of the 4.5- and 1.7-kb RNAs starting from PLL and the appearance of new RNA species of about 0.5 to 0.7 kb synthesized from PLL. These data suggest that the ash29 and ash10 mutations cause premature termination of transcription from PLL.


View larger version (54K):
[in this window]
[in a new window]
 
FIG. 6.   Transcription of the P4 left operon in P4 mutants. The P4 infecting phage is indicated at the top. RNA extracted from P4-infected cells at the times indicated (in minutes) after infection was fractionated in 1.5% agarose and hybridized to the riboprobe PLE-t2 (P4 nt 8418 to 8774 region) or PLL (P4 nt 8774 to 9023 region), as indicated (see Materials and Methods). The size of P4 transcripts is indicated on the left in kilobases. (A and C) Infection of C-1a. (B) Infection of C-520 (supD).

Upon P4 vir1 ash29 infection of the C-520 strain, which carries the supD amber suppressor, the synthesis of the 4.5- and 1.7-kb transcripts was restored (Fig. 6B). Thus, suppression of the amber stop codon in eta prevents premature termination of transcription from PLL. On the other hand, after infection with the mutant phages of both the sup+ and the supD hosts, the 4.1- and 1.3-kb transcripts starting from PLE persisted for a long time, suggesting that transcription from this promoter is not efficiently terminated at timm. These results indicate that the ash29 and ash10 mutations alter the P4 immune response. This latter phenotype is not suppressed by supD.

Polar effect of a mutation in the P4 vis gene. Since translation of eta appears coupled to vis, we supposed that mutations which stop vis translation might also cause premature termination of transcription from PLL. A frameshift mutation, vis2 (2-bp insertions at nt 8904 [Fig. 2] [9]), creates a stop codon in vis at nt 8861. The transcriptional profile of P4 vis2 after infection of C-1a was analyzed by Northern blotting (Fig. 6C). The PLE transcripts were normally synthesized, but almost all the RNA synthesized from PLL was 0.5 to 0.7 kb long. Thus, as expected, the vis2 mutation causes premature termination of transcription from PLL. It must be noted that the overall amount of transcription from PLL was increased in P4 vis2 compared to P4 wild type, which is consistent with the lack of the Vis repressor (33).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

P4 kil and eta genes. We have identified two nested genes, kil and eta. The start codon of kil lies within, and is in frame with, the eta coding sequence; thus, the Kil protein is identical to the C-terminal part of Eta. Both genes are located in the P4 left operon proximal to the PLL promoter. However, the kil region is transcribed both from PLE and PLL whereas eta, whose start codon is upstream of PLE, is expressed only from PLL.

The kil gene maps at nt 8365 to 8169 and is preceded by a good Shine-Dalgarno sequence. It encodes a 65-amino-acid polypeptide (7,322 Da) with a calculated pI of 11.87, which causes cell death when overexpressed.

The kil1 frameshift mutation creates a fusion with the downstream varepsilon  reading frame. Accordingly, a protein of approximately 17.5 kDa, which might represent the kil1-varepsilon fusion protein, was observed in cells infected with P4 cI405 kil1 but not in cells infected with P4 cI405 or P4+ (1).

Expression of the kil gene from PLE is controlled by P4 immunity. This is shown by the following findings: (i) host killing after P4 infection was observed when the phage carried a mutation which affects the immunity system (1, 8, 38), (ii) cell killing upon P4 cI405 infection did not occur in a P4 lysogenic host (1), and (iii) the presence of a wild-type immunity region upstream of a cloned kil gene impaired expression of the killing function, whereas the presence of either the cI405 mutation or a deletion of the immunity region upstream of kil led to kil expression. The killing function is also controlled in the plasmid state, since P4 cI405 can propagate as a multicopy plasmid without severely affecting cell viability (1).

The eta gene can be expressed only from PLL. The start codon of eta has not been defined exactly, since several possible ATG codons are present in frame upstream of PLE (Fig. 2). Accordingly, the Eta protein is expected to be 197 to 199 amino acids long. It appears that eta translation is not efficiently initiated per se, probably for the lack of a good ribosome binding site, and it is coupled to translation of the upstream vis gene. In fact, if translation of a cloned vis gene is prevented, eta is not expressed.

In the plasmid condition and after infection with P4 vir1, when transcription starts at the upstream promoter PLL (13), the kil region is transcribed as the distal part of eta. Nevertheless, cell killing is not observed in such conditions. This suggests that eta translation prevents translation of the kil gene; alternatively, or in addition, the Eta protein might counteract the lethal effect of Kil.

The translational stop within eta caused by the ash29 and ash10 mutations appears not to interfere with P4 production in lytic infection. In fact, the P4 vir1 and P4 vir1 ash29 burst sizes in C-295 infection were quite similar (153 and 138 PFU/infected cell, respectively [43]). Hence, a complete Eta protein appears not to be essential for P4 propagation. That the N-terminal segment of Eta, still present in the truncated forms produced by the ash29 or ash10 mutants, might contribute a function for P4 production remains a possibility.

Control of transcription termination at timm by translation of kil. When the kil-timm region is cloned on a plasmid, the presence of the kil343 nonsense mutation causes premature termination of transcription at timm whereas the kil1 frameshift mutation, which does not create stop codons in the kil region, does not affect transcription. This rules out a direct role of the Kil protein in antitermination and suggests that translation of the kil region per se inhibits transcription termination at timm.

These data lend further support to the hypothesis that P4 immunity may induce premature transcription termination of the transcripts starting from PLE by impeding kil translation (7, 38): interaction of the CI RNA with the complementary target sequences on the nascent transcript might prevent initiation of kil translation, thus inducing Rho-dependent transcription termination at timm. Consistent with this hypothesis, the Shine-Dalgarno sequence and the ATG codon of kil fall within the seqC" target sequence, complementary to seqB in the CI RNA (Fig. 2).

Control of transcription termination at timm by translation of eta. Transcription starting from PLL proceeds through timm, covering the downstream part of the operon (13, 38). Our data indicate that this is due to translation of eta, whose start codon is upstream of PLE, and is not under P4 immunity control. Indeed, mutations that stop eta translation caused premature termination of transcription starting at PLL, and suppression of the P4 ash29 amber mutation in a supD host restored transcription through timm. Premature transcription termination was also caused by nonsense mutations in the upstream vis gene, to which eta appears translationally coupled.

Premature transcription termination from PLL generates 500 to 700-nt RNAs. The PLL promoter is located about 850 nt upstream of timm. It is likely that the PLL transcripts terminated at timm are subsequently processed, similarly to the PLE transcripts that are terminated at timm and processed to 0.1- to 0.3-kb RNAs (14, 38).

When eta translation is blocked by a nonsense mutation upstream of kil, the kil gene is not translated, as deduced from the absence of killing and from the occurrence of premature transcription termination. This suggests that, in the mutants, the transcripts starting from PLL might be under the control of P4 immunity and might terminate prematurely at timm. Thus, antitermination of transcription from PLL in wild-type P4 appears to be due to the presence of ribosomes that might inhibit both the RNA-RNA interactions between CI RNA and the target sequences that control P4 immunity and transcription termination at the Rho-dependent terminator timm.

This also can explain the virulence suppression phenotype exhibited by some ash mutations. The virulence of P4 vir1 results from a promoter-up mutation in PLL that makes transcription from this promoter independent of positive regulators (13, 28). Since transcription from PLL is not controlled by P4 immunity, the virulent phages can grow on P4 lysogenic hosts. The ash10 and ash29 mutations, which suppress P4 virulence, interrupt eta translation, thus causing premature termination of transcription at timm and impairing P4 growth in an immune host.

It should be noted that the ash29 and ash10 mutations affect two P4 genes, eta and cI (Fig. 2), and confer two phenotypic traits: virulence suppression and Ash- (i.e., the ability to exploit a P3 prophage as helper). The former depends on the translational stop in eta, as discussed above, whereas the latter appears to be a consequence of the change in the CI RNA: in fact, for P4 ash mutants, transcription starting at PLE is not efficiently terminated at timm, leading to protracted expression of the downstream genes of the operon. In P4 ash29, the nonsense mutation for eta is suppressed in a supD or supF host, as expected, whereas the mutational change for the CI RNA is not suppressed, as demonstrated by the persistence of the 4.1- and 1.3-kb transcripts at late times after infection. Accordingly, the Ash- phenotype of P4 vir1 ash29 persists in a supD or supF host (data not shown). These data suggest that the Ash- phenotype is correlated with overexpression of one or more genes of the P4 left operon. A possible candidate is the P4 varepsilon  gene product, which is required for derepression of P2 prophage (18, 31). It might be hypothesized that greater production of the varepsilon  protein may be required to derepress a P3 prophage.

Possible role of Kil and Eta. Overexpression of kil both in P4 cI405 infection and from a plasmid leads to cell filamentation, inhibition of macromolecular syntheses, and production of nonviable microcolonies, suggesting that the Kil protein may interfere with cell division.

The kil gene is the first P4 gene expressed after infection, and its expression, regulated by several mechanisms, is confined to the early phase, preceding the onset of the immune system control. Under these conditions, kil expression is not harmful to the host; hence, the lethal effect appears to be a consequence of deregulation.

A possible role of kil in P4 biology could be to transiently inhibit cell division at early times after infection, thus enabling replication of the phage genome before the cell divides. This might increase the chance that the P4 genome will be inherited, either as an integrated prophage or as a multicopy plasmid, when inhibition of division will be relieved. Moreover, in the presence of P2, the lytic cycle may be more efficient, since inhibition of division may provide both an increased cell size and a higher dosage of helper prophage genomes.

Our results indicate that not only is expression of kil controlled by multiple mechanisms in the different developmental phases of P4 but also kil itself is part of the mechanism controlling the P4 life cycle.

Immediately after infection of a sensitive host, kil can be transcribed from PLE as the first gene of the operon essential for P4 replication. Translation of kil may not be efficient, since both readthrough and prematurely terminated transcripts are produced. As soon as the mature CI RNA is produced, not only may translation of kil be inhibited, according to our model, but also its transcription may be inhibited, due to termination at timm. These events appear to be central to the establishment of prophage immunity (7, 38).

However, both in the lytic cycle and under the plasmid conditions, P4 must bypass the transcription termination mechanism controlled by the immunity to express the replication genes, but at the same time it must avoid the expression of the lethal kil function. These two conflicting demands are met by translation of the eta gene.

Blast database searches (2) found several matches for the eta/kil region, at both the DNA and protein sequence levels. Some of them have been previously reported (15, 21, 47). Figure 7 shows a multiple alignment of the matching protein sequences. The close relative of P4, Phi R73 (23, 47), contains a sequence very similar to the whole Eta sequence. Other less extensive sequence matches were found for the bacteriophage N15 cA/gene 32 region (21) and for the Shigella flexneri prophage-related sequences SFS and, in particular, SFW, which encodes p179 (15). For N15, it was demonstrated that expression of a 57-amino-acid polypeptide, homologous to Kil, causes cell death (34), whereas no effect on cell growth was observed by expressing the less homologous region of SFW (15). All these genes are nested in a longer ORF, which, if translated, might play a role similar to P4 eta.


View larger version (56K):
[in this window]
[in a new window]
 
FIG. 7.   Multiple sequence alignment for P4 Eta/Kil and homologs. Multiple alignment by the GCG Pileup program for the translated DNA sequences of P4 Eta/Kil, Phi R73 Eta/Kil (23, 47) (GenBank accession no. M64113), N15 cA/gene 32 region (21) (AF064539 and U63086), S. flexneri SFWp179 (15) (Z23101), ColIb-P9 (41) (AB021078), and R64 (24, 25) (AB027308) is shown. Conserved amino acids are in capitals. In P4 and Phi R73, the first amino acid of the Kil protein is in boldface type, and in the N15 sequence, the first amino acid of the peptide that causes cell killing when expressed is in boldface type (28). The region corresponding to the P4 cI gene is overlined.

Shorter though statistically significant matches were found for the eta region immediately upstream of kil with segments of two closely related Incl1 plasmids, ColIb-P9 (41) and R64 (24, 25). Interestingly, these two plasmids, as well as N15, encode primases that are related to that of P4 (32, 46), suggesting evolutionary connections.

It should be noted that in P4, Phi R73, and N15, a gene encoding a small RNA is nested within the ORF extending upstream of kil (17, 28, 37). Such small RNAs exhibit remarkable sequence homology that may impose constraints on the codons in the overlapping reading frames. Thus, the alignment for amino acid sequences derived from such a region (overlined in Fig. 7) might not necessarily have a functional relevance at the translational level. This might be especially true for the IncI1 plasmid sequences, for which no evidence for their translation has been reported. We have analyzed by FoldRNA the RNA sequences corresponding to the P4 cI region in ColIb-P9, R64, and SFW and found predicted secondary structures identical to that of P4 CI RNA (data not shown). It would be interesting to analyze whether these elements also express a small regulatory RNA.

Genes that kill the host when overexpressed have been reported for other phages, such as icd for P1 (36), kil for lambda  (35), and kil for the defective prophage Rac (10). In all these cases, inhibition of cell division appears to be responsible for cell death. Even though P4 Kil shares with other Kil proteins a small size (<100 amino acids) and a positive net charge, no relevant homology could be found between the above proteins with the BestFit program of the GCG software package. This suggests that for these bacteriophages the mechanism underlying inhibition of cell division might have evolved independently.

P4 vis2 mutant and the control of PLL. The vis gene encodes the PLL repressor. The Vis protein binds immediately downstream of PLL and blocks transcription of the left operon from this promoter (33). Thus, the Vis protein negatively autoregulates its own expression. The P4 vis2 mutant synthesizes a truncated Vis protein, which lacks the helix-turn-helix DNA binding motif. Accordingly, transcription from PLL is greatly increased. It should be noted that the vis2 mutation does not influence the timing of PLL activation. Thus, P4 vis2 differs from P4 vir1 in that in the latter, the promoter-up mutation makes transcription independent of activators (13) but still repressible by the Vis protein, whereas in P4 vis2, delta -dependent activation of PLL is not repressed. Although in P4 vis2 the negative control on the PLL promoter is absent, no overexpression of the left operon genes is observed, due to the polar effect of the vis2 mutation on eta.


    ACKNOWLEDGMENTS

We are grateful to Nikolai Ravin for helpful discussions and for communicating unpublished results.

This work has been supported by a Target Project on Genetic Engineering grant from the Consiglio Nazionale delle Ricerche, Rome, Italy, and by grants from the Ministero dell'Università e della Ricerca Scientifica e Tecnologica, Rome, Italy, and grant AI04043 of the National Institutes of Health (to E.W.S.).


    FOOTNOTES

* Corresponding author. Mailing address: Dipartimento di Genetica e di Biologia dei Microrganismi, Università di Milano, Via Celoria 26, 20133 Milan, Italy. Phone: (39.2)2660.5217. Fax: (39.02)266.4551. E-mail: ghisotti{at}mailserver.csi.unimi.it.

dagger Present address: Istituto Europeo di Oncologia, Milan, Italy.

Dagger Present address: Division of Allergy, Pulmonary and Critical Care Medicine, Vanderbilt University, Nashville, TN 37232.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Alano, P., G. Dehò, G. Sironi, and S. Zangrossi. 1986. Regulation of the plasmid state of the genetic element P4. Mol. Gen. Genet. 203:445-450[Medline].
2. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-Blast: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402[Abstract/Free Full Text].
3. Bertani, G. 1951. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 62:293-300[Free Full Text].
4. Bertani, G., and E. W. Six. 1958. Inheritance of prophage P2 in bacterial crosses. Virology 6:357-381[Medline].
5. Bertani, L. E., and G. Bertani. 1971. Genetics of P2 and related phages. Adv. Genet. 16:199-236[Medline].
6. Bertani, L. E., and E. W. Six. 1988. The P2-like phages and their parasite P4, p. 73-143. In R. Calendar (ed.), The bacteriophages, vol. 2. Plenum Publishing Corp., New York, N.Y.
7. Briani, F., S. Zangrossi, D. Ghisotti, and G. Dehò. 1996. A rho-dependent transcription termination site regulated by bacteriophage P4 RNA immunity factor. Virology 223:57-67[Medline].
8. Calendar, R., E. Ljungquist, G. Dehò, D. C. Usher, R. Goldstein, P. Youderian, G. Sironi, and E. W. Six. 1981. Lysogenisation by satellite phage P4. Virology 113:20-38[Medline].
9. Calì, S., and D. Ghisotti. Unpublished data.
10. Conter, A., J.-P. Bouché, and M. Dassain. 1996. Identification of a new inhibitor of essential division gene ftsZ as the kil gene of defective prophage Rac. J. Bacteriol. 178:5100-5104[Abstract/Free Full Text].
11. Dale, E. C., G. E. Christie, and R. Calendar. 1986. Organization and expression of the satellite bacteriophage P4 late gene cluster and the sequence of the polarity suppression gene. J. Mol. Biol. 192:793-803[Medline].
12. Dehò, G. 1983. Circular genetic map of satellite bacteriophage P4. Virology 126:267-278[Medline].
13. Dehò, G., S. Zangrossi, D. Ghisotti, and G. Sironi. 1988. Alternative promoters in the development of bacteriophage plasmid P4. J. Virol. 62:1697-1704[Abstract/Free Full Text].
14. Dehò, G., S. Zangrossi, P. Sabbattini, G. Sironi, and D. Ghisotti. 1992. Bacteriophage P4 immunity controlled by small RNAs via transcription termination. Mol. Microbiol. 6:3415-3425[Medline].
15. Faubladier, M., and J.-P. Bouché. 1994. Division inhibition gene dicF of Escherichia coli reveals a widespread group of prophage sequences in bacterial genomes. J. Bacteriol. 176:1150-1156[Abstract/Free Full Text].
16. Forti, F., and D. Ghisotti. Unpublished data.
17. Forti, F., P. Sabbattini, G. Sironi, S. Zangrossi, G. Dehò, and D. Ghisotti. 1995. Immunity determinant of phage-plasmid P4 is a short processed RNA. J. Mol. Biol. 249:869-878[Medline].
18. Geisselsoder, J., P. Youderian, G. Dehò, M. Chidambaram, R. N. Goldstein, and E. Ljungquist. 1981. Mutants of satellite virus P4 that cannot derepress their P2 helper. J. Mol. Biol. 148:1-19[Medline].
19. Ghisotti, D., R. Chiaramonte, F. Forti, S. Zangrossi, G. Sironi, and G. Dehò. 1992. Genetic analysis of the immunity region of phage-plasmid P4. Mol. Microbiol. 6:3405-3413[Medline].
20. Halling, C., R. Calendar, G. E. Christie, E. C. Dale, G. Dehò, S. Finkel, J. Flensburg, D. Ghisotti, M. L. Kahn, K. B. Lane, et al. 1990. DNA sequence of satellite bacteriophage P4. Nucleic Acids Res. 18:1649[Free Full Text].
21. Hendrix, R. W., V. K. Ravin, S. R. Casjens, M. E. Ford, N. V. Ravin, and I. K. Smirnov. 1998. Bacteriophage N15, complete genome. GenBank accession no. AF064539.
22. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site directed mutagenesis by overlap extension using the polimerase chain reaction. Gene 77:51-59[Medline].
23. Inouye, S., M. G. Sunshine, E. W. Six, and M. Inouye. 1991. Retronphage Phi R73: an E. coli phage that contains a retroelement and integrates into a tRNA gene. Science 252:969-971[Abstract/Free Full Text].
24. Kim, S.-R., and T. Komano. 1997. The plasmid R64 thin pilus identified as a type IV pilus. J. Bacteriol. 179:3594-3603[Abstract/Free Full Text].
25. Kim, S.-R., N. Funayama, and T. Komano. 1993. Nucleotide sequence and characterization of the traABCD region of IncIl plasmid R64. J. Bacteriol. 175:5035-5042[Abstract/Free Full Text].
26. Lane, K. B. 1985. Studies of vir1-suppressing mutations in bacteriophage P4. M.S. thesis. University of Iowa, Iowa City.
27. Lin, C. S. 1983. Genetic and molecular studies of bacteriophage P4: ash mutants and DNA sequence between genes psu and alpha , Ph.D. thesis. University of Iowa, Iowa City.
28. Lin, C. S. 1984. Nucleotide sequence of the essential region of bacteriophage P4. Nucleic Acids Res. 12:8667-8684[Abstract/Free Full Text].
29. Lindqvist, B. H., G. Dehò, and R. Calendar. 1993. Mechanisms of genome propagation and helper exploitation by satellite phage P4. Microbiol. Rev. 57:683-702[Abstract/Free Full Text].
30. Lindqvist, B. H., and E. W. Six. 1971. Replication of bacteriophage P4 DNA in a nonlysogenic host. Virology 43:1-7[Medline].
31. Liu, T., S. K. Renberg, and E. Haggård-Ljungquist. 1997. Derepression of prophage P2 by satellite phage P4: cloning of the P4 varepsilon  gene and identification of its product. J. Virol. 71:4502-4508[Abstract].
32. Lobocka, M. B., A. N. Svarchevsky, V. N. Rybchin, and M. B. Yarmolinsky. 1996. Characterization of the primary immunity region of the Escherichia coli linear plasmid prophage N15. J. Bacteriol. 178:2902-2910[Abstract/Free Full Text].
33. Polo, S., T. Sturniolo, G. Dehò, and D. Ghisotti. 1996. Identification of a phage-coded DNA-binding protein that regulates transcription from late promoters in bacteriophage P4. J. Mol. Biol. 257:745-755[Medline].
34. Ravin, N. V. Personal communication.
35. Reisinger, G. R., A. Rietsch, W. Lubitz, and U. Blasi. 1993. Lambda kil-mediated lysis requires the phage context. Virology 193:1033-1036[Medline].
36. Riedel, H.-D., J. Heinrich, and H. Schuster. 1993. Cloning, expression, and characterization of the icd gene in the immI operon of bacteriophage P1. J. Bacteriol. 175:2833-2838[Abstract/Free Full Text].
37. Sabbattini, P., E. W. Six, S. Zangrossi, F. Briani, D. Ghisotti, and G. Dehò. 1996. Immunity specificity determinants in the P4-like retronphage Phi R73. Virology 216:386-396.
38. Sabbattini, P., F. Forti, D. Ghisotti, and G. Dehò. 1995. Control of transcription termination by an RNA factor in bacteriophage P4 immunity: identification of the target sites. J. Bacteriol. 177:1425-1434[Abstract/Free Full Text].
39. Saha, S., E. Haggard-Ljundquist, and K. Nordstrom. 1989. Activation of prophage P4 by the Cox protein on the two phage genomes. Proc. Natl. Acad. Sci. USA 86:3973-3977[Abstract/Free Full Text].
40. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
41. Sampei, G., and K. Mizobuchi. 1999. Organization and diversification of plasmid genomes: complete nucleotide sequence of the ColIb-P9 genome. GenBank accession no. AB021078.
42. Sasaki, I., and G. Bertani. 1965. Growth abnormalities in Hfr derivatives of Escherichia coli strain C. J. Gen. Microbiol. 40:365-376[Medline].
43. Six, E. W. Unpublished data.
44. Six, E. W., and C. A. C. Klug. 1973. Bacteriophage P4: a satellite virus depending on a helper such as prophage P2. Virology 51:327-344[Medline].
45. Sloan, S., and R. A. Weisberg. 1993. Use of a gene encoding a suppressor tRNA as a reporter of transcription: analyzing the action of the Nun protein of bacteriophage HK022. Proc. Natl. Acad. Sci. USA 90:9842-9846[Abstract/Free Full Text].
46. Strack, B., M. Lessl, R. Calendar, and E. Lanka. 1992. A common sequence motif -E-G-Y-A-T-A- identified within the primase domains of plasmid-encoded I- and P-type DNA primases and the alpha  protein of the E. coli satellite phage P4. J. Biol. Chem. 267:13062-13072[Abstract/Free Full Text].
47. Sun, J., M. Inouye, and S. Inouye. 1991. Association of a retroelement with a P4-like cryptic prophage (retronphage Phi R73) integrated into the selenocystyl tRNA gene of Escherichia coli. J. Bacteriol. 173:4171-4181[Abstract/Free Full Text].
48. Sunshine, M. G., M. Thorn, W. Gibbs, and R. Calendar. 1971. P2 phage amber mutants: characterization by use of a polarity suppressor. Virology 46:691-702[Medline].
49. Vieira, J., and J. Messing. 1982. The pUC plasmids and M13mp7 derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19:259-268[Medline].
50. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of M13mp18 and pUC19 vectors. Gene 33:103-109[Medline].
51. Ziermann, R., E. W. Six, B. Julien, and R. Calendar. 1993. Bacteriophage P4, p. 1.70-1.74. In S. J. O'Brien (ed.), Genetic maps. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.


Journal of Bacteriology, September 1999, p. 5225-5233, Vol. 181, No. 17
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar