Previous Article | Next Article 
Journal of Bacteriology, September 1999, p. 5234-5241, Vol. 181, No. 17
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Analysis of BvgA Activation of the Pertactin Gene
Promoter in Bordetella pertussis
Susan M.
Kinnear,1
Philip E.
Boucher,2
Scott
Stibitz,2 and
Nicholas
H.
Carbonetti1,*
Department of Microbiology and Immunology,
University of Maryland School of Medicine, Baltimore, Maryland
21201,1 and Division of Bacterial
Products, Center for Biologics Evaluation and Research, Food and
Drug Administration, Bethesda, Maryland 208922
Received 29 March 1999/Accepted 25 June 1999
 |
ABSTRACT |
Bordetella pertussis, the causative agent of whooping
cough, regulates expression of its virulence factors via a
two-component signal transduction system encoded by the bvg
regulatory locus. It has been shown by activation kinetics that several
of the virulence factors are differentially regulated. fha
is transcribed at 10 min following an inducing signal, while
ptx is not transcribed until 2 to 4 h after the
inducing signal. We present data indicating that prn is
transcribed at 1 h, an intermediate time compared to those of
fha and ptx. We have identified
cis-acting sequences necessary for expression of
prn in B. pertussis by using
prn-lac fusions containing alterations in the sequence
upstream of the prn open reading frame. In vitro
transcription and DNase I footprinting analyses provided evidence to
support our hypothesis that BvgA binds to this sequence upstream of
prn to activate transcription from the promoter. Our
genetic data indicate that the region critical for prn
activation extends upstream to position
84. However, these data do
not support the location of the prn transcription start
site as previously published. We used a number of methods, including
prn-lac fusions, reverse transcriptase PCR, and 5' rapid amplification of cDNA ends, to localize and identify the
bvg-dependent 5' end of the prn transcript to
the cytosine at
125 with respect to the published start site.
 |
INTRODUCTION |
Bordetella pertussis, the
causative agent of whooping cough, alternates between a virulent
Bvg+ phase and an avirulent Bvg
phase in
response to environmental stimuli. A central regulatory locus called
bvg encodes the two-component signal transduction system
that mediates this phenotypic modulation. The two components involved
in the regulatory system are BvgS, a transmembrane sensor protein, and
BvgA, a transcriptional activator protein (1). BvgS
autophosphorylates at histidine-729, and after a series of sequential
intramolecular phosphorylations, the phosphate is relayed to BvgA
(29). The phosphorylated form of BvgA has increased affinity
for Bvg-activated promoters (4) and is responsible for the
transcriptional activation of bvg-regulated genes (21, 26, 29). Expression of bvg-activated genes can be
modulated in the laboratory by growth at a low temperature (25°C) or
in the presence of magnesium sulfate or nicotinic acid (16).
The BvgAS system coordinately regulates expression of several
virulence-associated factors of B. pertussis. These include adhesins such as filamentous hemagglutinin (Fha) and pertactin (Prn),
as well as toxins such as pertussis toxin (Ptx) and adenylate cyclase-hemolysin toxin (Cya). Not only is there regulation between the
phenotypic phases of B. pertussis, but a number of
bvg-activated genes have been shown to be differentially
regulated. A kinetic study has indicated that fha and
bvg are transcribed just 10 min after an inducing signal
(temperature shift) but that ptx and cya are not
transcribed until 2 to 4 h after the inducing signal, as measured
by S1 nuclease protection analysis (23). The induction of
ptx and cya transcription correlated with the
accumulation of intracellular BvgA (23). The phosphorylated
form of BvgA has been shown to directly activate the expression of
fha, bvg, ptx, and cya
(3, 15, 22, 26, 30). ptx requires higher levels
of phosphorylated BvgA for expression than fha does
(26). Gel retardation and DNase I footprinting analyses have
demonstrated that BvgA interacts directly with sequences upstream of
the inducible promoters for fha, bvg,
ptx, and cya (3, 15, 22, 26, 30). In
these upstream sequences, pairs of heptanucleotide inverted repeats
with the consensus sequence TTTC(C/T)TA have been identified and shown
by genetic and biochemical means to be important
cis-regulatory elements for promoter activity (14, 15,
19, 22). It is thought that the heptameric, inverted repeats are
the initial binding site for the transcriptional activator BvgA
(3). Genetic and DNase I protection data (3, 19)
support a model of ptx activation in which phosphorylated
BvgA binds to an upstream, high-affinity BvgA binding site. Cooperative
binding of BvgA dimers along the sequence between the primary binding
site and the promoter allows BvgA to interact with RNA polymerase
(RNAP) (3).
Prn is an outer membrane protein that is synthesized as a 93-kDa
precursor and then processed to 60- and 30-kDa forms. Prn contains an
Arg-Gly-Asp (RGD) domain and has putative roles in attachment to and
invasion of epithelial cells (11, 17). Prn has been shown to
be bvg regulated (7), but the
cis-acting DNA sequences necessary for prn
expression have not been characterized. Although a transcription start
site was identified by primer extension analysis (12), there
is no
70 consensus promoter at the appropriate region
upstream of this site in the prn sequence. Therefore, we
wanted to examine the region necessary for bvg activation of
prn. Our hypothesis was that BvgA binds to the sequence
upstream of prn and activates transcription from the
promoter, similar to other bvg-activated genes. In this
study, we attempt to characterize the important cis-regulatory sequences upstream of and within the
prn promoter by both genetic and biochemical means and we
identify the true bvg-dependent transcription start site of
prn.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
The bacterial
strains and plasmids used or created in this study are shown in Table
1. Escherichia coli strains
were grown on Luria-Bertani (LB) agar. B. pertussis strains
were grown on Bordet-Gengou (BG) agar (Difco) supplemented with 15%
sheep blood or in Stainer-Scholte liquid medium (25). The
following antibiotics were added to the concentrations indicated
(micrograms per milliliter) when necessary: ampicillin, 100;
chloramphenicol, 20; tetracycline, 10; gentamicin sulfate, 10;
kanamycin, 50; streptomycin, 400; and nalidixic acid, 20. Bacterial
conjugations were performed as described previously (13)
with E. coli S17.1 as the donor strain (24).
DNA manipulations and allelic exchange.
DNA manipulations
were carried out by standard molecular methods. Restriction sites were
engineered by using overlap extension PCR (5) and subcloned
into the appropriate plasmid. Sequence additions or replacements were
achieved by introduction of complementary oligonucleotides containing
the appropriate overhanging sticky ends. Constructs were introduced
into B. pertussis as plasmids by conjugation with the
mobilizable vector pNMD603, a variation of pLAFR2 (6), or
into the B. pertussis genome by allelic exchange using the
pJHC1 derivative of pSS1129 (27, 28), a mobilizable suicide
vector. To aid in the screening of conjugants after allelic exchange,
we constructed a recipient strain in which a kanamycin resistance gene
cassette replaced the prn region between the
EcoRI and NcoI sites (NMD615). Kanamycin
sensitivity was then used as an indicator of successful integration of
our engineered sequences, which were then confirmed by PCR analysis.
RT-PCR Analysis.
Total RNA was prepared from the Tohama I
and Tohama I
bvg strains by extraction with Trizol LS
reagent (Gibco BRL) and then treatment with RNase-free DNase I
(Boehringer Mannheim) to remove any contaminating DNA. Total RNA (2 µg for time course or 3 µg for prn start site mapping)
was used in reverse transcriptase (RT) reactions (all components from
Gibco, BRL) with SuperScript II RT and primed with random hexamers to
synthesize first-strand cDNA. Samples without the addition of RT were
also run to verify the absence of DNA contamination. After treatment
with RNase H (Gibco BRL), 10% (time course) or 5% (prn
start site mapping) of the first-strand reaction product was used as
the template in subsequent PCRs. Time course analysis PCR mixtures (50 µl) contained 100 pmol of the primers listed below, 1× PCR buffer, 1.5 mM MgCl2, 0.4 mM deoxynucleoside triphosphates, and 0.5 µl of Taq DNA polymerase (all components from Gibco BRL).
The reactions were run for 20 cycles of 94°C denaturation, 52°C
annealing, and 72°C extension in a thermal cycler. One hundred
picomoles of the primers shown below (see Fig. 6) paired with primer
651 (5'GGTCGGAGCCCTGGATA3') was used in the detection of
bvg-dependent prn transcripts. The PCR mixtures
also contained 42 µl of PCR Supermix (Gibco BRL) and 5% dimethyl
sulfoxide (DMSO) (Fisher Scientific), and the reactions were run for 25 cycles of 94°C denaturation, 65°C annealing, and 72°C extension
in a thermal cycler. The products were electrophoresed on a 2% agarose
gel, stained with ethidium bromide, and visualized with UV light.
Time course analysis.
Strain Tohama I was grown on
nitrocellulose filters on BG agar plates containing 50 mM
MgSO4 to modulate bvg activity. At time zero,
the filters were transferred to medium without MgSO4 to
induce bvg activity. Total RNA was prepared as described
above from cells at times 0, 30, 60, 240, and 480 min after induction. RT-PCR, with primers specific for sodB
(5'CTGCCTTACGCTCTGGATG3', antisense
5'GGACGGGCATTGCGGTAAT3'), fha
(5'CCTAAAACGAGCAGGCCG3', antisense
5'GAACTTGTTGTGCGAGAC3'), ptx
(5'ACCGCAAGAACAGGCTG3', antisense
5'GTCGATCGGCATGCTGTTC3'), and prn
(5'GCACCACGCTGGCCATG3', antisense
5'GACGACGTGACACTGCC3'), was used as described above to
determine promoter activation. To analyze the RT-PCR data, portions of
the RT-PCR samples were run on an agarose gel and stained with the
fluorescent dye Vistra Green (Amersham) and band intensities were
quantified by analysis on a FluorImager SI system using ImageQuant
software (Molecular Dynamics). The band intensities were normalized to
the sodB standard, a bvg-independent superoxide dismutase of B. pertussis (9).
DNA sequence and database analysis.
A 900-bp fragment
between the ClaI and SmaI sites upstream of the
prn open reading frame (ORF) was cloned into pSK-Bluescript (Stratagene). The resulting clone, pNMD601, was used to sequence both
strands of the prn sequence using a Sequenase kit (U.S.
Biochemicals). The sequence was analyzed by use of a Blast search of
the GenBank database. All of the additional constructs were sequenced
with an ABI automated sequencer to confirm deletions and replacements.
-Galactosidase (Lac) assays.
Filter Lac assays were used
as a quick screen for the plasmid-borne prn-lac fusion
strains as described previously (19). For quantitative
measure of
-galactosidase levels, strains were grown for 2 days on
agar medium and assayed three independent times as described previously
(19).
-Galactosidase levels were determined by the method
of Miller (20), and Lac units were determined by the formula
[(OD420
1.5 × OD550)/OD600] × 1,000, where
OD420, e.g., is the optical density at 420 nm
(19). Statistical differences were determined by Student's
t test.
DNase I footprinting and in vitro transcription analyses.
A
300-bp DNA fragment of the upstream prn sequence (
153 to
+147) was generated by PCR with oligonucleotides containing
BamHI and SalI restriction sites. This fragment
was cloned into either the pKS-Bluescript vector (Stratagene) to yield
pNMD633 or into the pTE103 transcription vector (10) to
yield pTE-PRN. Footprinting analysis was carried out as described
previously (2) with fragments generated from pNMD633.
Reaction mixtures contained 150 nM E. coli
70-saturated RNA polymerase (Pharmacia), 15 mM acetyl
phosphate (Ac~P), and BvgA at 0.58 or 1.2 µM. Reaction mixtures
were electrophoresed on a 6% polyacrylamide sequencing gel and exposed
for autoradiography in a PhosphorImager cassette. Transcription assays
were carried out as described previously (2). Reaction
mixtures contained 0.5 pmol of super-coiled pTE-PRN plasmid, 150 nM
E. coli
70-saturated RNA polymerase
(Pharmacia), or 1.4 µM purified Bordetella bronchiseptica
RNA polymerase and between 0 and 0.78 µM BvgA. Where indicated,
Ac~P was added at a final concentration of 15 mM. Reaction mixtures
were electrophoresed on a 6% sequencing gel and exposed to
autoradiography in a PhosphorImager cassette.
5' RACE analysis.
Total RNA was synthesized as described
above from the Tohama I and Tohama I
bvg strains of
B. pertussis. Using the 5' rapid amplification of cDNA ends
(RACE) system, version 2.0 (Gibco BRL), we synthesized first-strand
cDNA by using 50 ng of prn-specific antisense
oligonucleotide 654 (5'CCTTGATGGTGGTTCCGCTG3') to prime the
reactions. The higher temperature and volume protocol for first-strand
cDNA synthesis of transcripts with high GC content was followed. After
purification of the first-strand product, terminal deoxynucleotidyl
transferase was used to add homopolymeric C tails to the 3' ends of the
cDNA. This reaction was carried out on ice for 1 h, and the
mixture contained 20% DMSO. The tail provided an anchor for subsequent
nested priming. PCR amplification using prn-specific primer
651 (5'GGTCGGAGCCCTGGATA3') and the kit's abridged anchor
primer was performed for 35 cycles of 94°C denaturation, 60°C
annealing, and 72°C extension. The reaction mixtures contained 100 pmol of each primer, 5 µl of dC-tailed cDNA, 5% DMSO, 5 µl of 10×
PCR buffer, 3 µl of 25 mM MgCl2, 2 µl of 10 mM
deoxynucleoside triphosphate mix, 0.5 µl of Taq DNA polymerase (Gibco, BRL), and distilled water to 50 µl. After the PCR
products were purified by using Wizard PCR purification preps (Promega), 1 µl was used as a template in a second PCR using
prn-specific primer 652 (5'GCCTCGAGCTGGCGCTCACCGGTCTTGA3') containing an
XhoI site and the kit's abridged universal amplification
primer. The products were examined on a 2% agarose gel stained with
ethidium bromide. The same 5' RACE product was obtained from two
separate pools of total RNA. The product was then gel purified, cut
with XhoI and SpeI, and cloned into both
pBluescript SK and KS (Stratagene). Several clones were then sequenced
with an ABI automated sequencer.
 |
RESULTS |
Activation kinetics of prn.
It has been shown that
several bvg-activated genes are differentially regulated
(23). Therefore, we wanted to examine the activation
kinetics of prn to begin to characterize the effect of
bvg regulation on prn expression. To examine the
activation kinetics, we used an RT-PCR assay to detect transcripts of
several bvg-activated genes over the course of time after
induction of the Bvg system. B. pertussis Tohama I cells
were modulated on plates containing 50 mM MgSO4. At time
zero, cells were removed from the MgSO4-containing plates
to induce the Bvg system. Total RNA was prepared from the cells at 0, 30, 60, 240, and 480 min. RT-PCR, with primers specific for
sodB, fha, ptx, and prn,
was used to determine promoter activation (Fig.
1). The absence of transcription at time
zero and the increase in the level of transcription at later time
points strongly suggest the bvg dependence of these genes,
although fha transcription was routinely difficult to reduce to zero by MgSO4 modulation. The same kinetic patterns were
obtained when the band intensities were normalized to the
sodB standard and plotted. As shown in Fig. 1,
fha was activated early (30 min) after induction and
ptx was activated late (240 min), results similar to those
described previously (23). Transcription of prn
was reproducibly observed after 60 min, indicating a third, intermediate class of promoter activation (Fig. 1). prn
RT-PCR products from a variety of prn-specific primers were
consistently weaker than RT-PCR products from other
bvg-activated genes. This indicates that prn is
weakly transcribed and is consistent with the reduced levels of
-galactosidase activity we obtain from prn-lac fusions in
comparison to those obtained from fha- or ptx-lac fusions.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 1.
RT-PCR analysis of promoter activation kinetics. RT-PCR
was used to detect transcripts of sodB, fha,
ptx, and prn after induction of the Bvg system.
The time course of induction is shown on ethidium bromide-stained
agarose gels at 0, 30, 60, 240, and 480 min for the
bvg-dependent fha, ptx, and
prn promoters and the bvg-independent standard,
sodB. Results from a typical experiment are shown.
|
|
Characterization of the prn promoter-activating
sequence.
We hypothesized that the transcriptional activator BvgA
would interact with sequence upstream of prn to initiate
transcription, but we did not know the extent of sequence necessary for
prn activation. Initially, to identify the region upstream
of prn important for bvg activation, we made a
series of plasmid-borne prn-lac transcriptional fusions that
were introduced into B. pertussis Tohama I by conjugation. Results from
-galactosidase assays (data not shown) indicated that
the region 220 bp upstream of the prn ORF is important for bvg-dependent promoter activation but may not be sufficient
for full promoter activity.
Published sequence extends only as far as a
ClaI site 147 bp
upstream of the
prn ORF; therefore, we sequenced both
strands
of the DNA upstream of the
ClaI site to further
examine the region
of importance for
prn activation. The
sequence revealed part of
an ORF with codon usage typical of
B. pertussis. No strong homologies
to the predicted protein of this
ORF were identified by a search
of the databases; the strongest was a
segment of a
Moraxella bovis pilin gene inverting protein
(recombinase) with 41% identity and
63% similarity over 63 residues.
The 335-bp intergenic sequence
revealed long inverted repeats just
downstream of the upstream
ORF, a likely transcription terminator. An
unusually AT-rich (53%
compared to the 35% average for
B. pertussis) region of about
200 bp, from positions

107 to +108,
was recognized to contain
numerous potential BvgA binding half sites
based on homology to
other
bvg-activated promoters. The
sequence data in combination
with the plasmid-borne
lac
fusion data strongly suggested that
the
bvg-activating
region for
prn lies in this sequence upstream
of the
prn ORF.
To further characterize the sequence necessary for
prn
activation, allelic exchange was used to introduce the
prn
upstream
region with sequence alterations into the chromosome of
B. pertussis Tohama I. Additional
EcoRI and
ClaI restriction sites were introduced
into a
BglI site upstream of the AT-rich region (Fig.
2). A series
of deletions and
replacements with unrelated sequence were constructed
and then fused to
a promoterless
lac gene at the
NcoI site 210
bp
into the
prn ORF (Fig.
2). The fusion constructs were then
introduced into the
B. pertussis chromosome by allelic
exchange,
and
prn promoter activity was measured by
quantitative

-galactosidase
assays.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of deletions and replacements upstream of the
chromosomal prn-lac transcriptional fusion on prn
promoter activity. A restriction map of the prn upstream
region (orf, upstream open reading frame) is shown at the
top (not drawn to scale). Constructs are shown on the left, and
promoter activities (103 Lac units) with standard deviation
bars are shown on the right. The gray bars represent -galactosidase
levels when the strains were grown under nonmodulating conditions, and
the black bars represent -galactosidase levels when the strains were
grown in the presence of 50 mM MgSO4. (A) NMD616, wild
type; (B) NMD618, strain containing additional EcoRI and
ClaI cloning sites inserted at the BglI site; (C)
NMD623, strain with deletion of sequence between engineered and
wild-type EcoRI sites; (D) NMD625, strain with replacement
of the EcoRI fragment deletion with unrelated sequence of
same size; (E) NMD630, strain with replacement of EcoRI
fragment deletion with a 16-bp wild-type sequence upstream from the
EcoRI site; (F) NMD631, strain with replacement of
EcoRI deletion with a 26-bp wild-type sequence upstream from
the EcoRI site.
|
|
Introduction of the additional cloning sites (in NMD618) did not
significantly alter the wild-type transcriptional activity
of the
prn-lac fusion (Fig.
2A and B). However, transcriptional
activity was completely eliminated by deletion of the sequence
between
the
EcoRI sites (NMD623) (Fig.
2C) as well as by the
deletion
of the sequence between the
ClaI sites (data not
shown). In addition,
replacement of the
EcoRI (NMD625) (Fig.
2D) and the
ClaI (data
not shown) deleted fragments with
unrelated sequences of the same
length eliminated promoter activity.
These data indicate that
full
prn transcriptional activity
requires a specific sequence
upstream of the
EcoRI
site.
To identify the 5' extent of the activating sequence for
prn, we annealed complementary olignucleotides of increasing
length
corresponding to the wild-type sequence and cloned them into the
EcoRI deletion construct, pNMD623 (Fig.
2E and F). The
changes
were introduced into the chromosome of
B. pertussis
by allelic
exchange, and
prn promoter activity was again
determined by

-galactosidase
assays. Transcriptional activity was
restored to near-wild-type
levels by the reintroduction of only 16 bp
upstream of the
EcoRI
site (NMD630) (Fig.
2E and F). These
data suggest that the
cis-regulatory
region necessary for
prn promoter activation extends from the
ClaI
site to just upstream of the
EcoRI site upstream of the
prn ORF (

68 to +6) (see Fig.
7) and that sequences around
the
EcoRI
site are crucial for
activation.
Biochemical analyses of BvgA interaction with the prn
promoter region.
Our genetic analyses identified the DNA sequence
necessary for bvg-dependent transcriptional activation from
the prn promoter. To test the hypothesis that BvgA is
directly involved as the transcriptional activator of prn,
we cloned a 300-bp DNA fragment containing prn-specific sequence from positions
153 to +147. The resulting clone, pTE-PRN, was used for in vitro transcription assays that were carried out as
described in Materials and Methods. No detectable transcript was
present with the vector alone (Fig. 3,
lane 1) or with unphosphorylated BvgA (Fig. 3, lanes 2 and 6),
providing evidence that transcription from the prn promoter
is directly BvgA dependent. An increasing level of transcription driven
from the prn promoter in pTE-PRN was detected with
increasing levels of phosphorylated BvgA when both E. coli
RNAP (Fig. 3, lanes 3 to 5) and B. bronchiseptica RNAP (Fig.
3, lanes 7 to 9) were used. Transcription from the prn
promoter required the phosphorylation of BvgA, similar to in vitro
transcription results from other bvg-activated promoters (26). Based on the relative migration of the transcript
compared to an RNA ladder, the location of the transcription start site was considerably farther upstream than that of the previously published
site (12).

View larger version (94K):
[in this window]
[in a new window]
|
FIG. 3.
BvgA-mediated in vitro transcription analysis of the
prn promoter. Transcription reaction mixtures contained 0.5 pmol of supercoiled pTE-PRN plasmid, 150 nM E. coli
70-saturated RNAP or 1.4 µM purified B. bronchiseptica RNAP, and between 0 and 0.78 µM BvgA. Where
indicated, Ac~P was added at a final concentration of 15 mM. Lanes: 3 and 7, 0.20 µM BvgA; 4 and 8, 0.39 µM BvgA; 2, 5, 6, and 9, 0.78 µM BvgA. Reaction mixtures were electrophoresed on a 6%
polyacrylamide sequencing gel and exposed for autoradiography in a
PhosphorImager cassette. The arrow indicates the prn
transcript.
|
|
In light of the requirement for phosphorylated BvgA for transcription
from the
prn promoter, we hypothesized that the DNA
sequence
that we had identified as necessary for
prn activation
by
our genetic analyses would correspond to the BvgA binding sequence.
To
test this, we used DNase I footprinting analysis with
prn
promoter
fragments and purified BvgA as described in Materials and
Methods.
The footprinting was performed on DNA fragments encompassing
the
same 300 bp upstream of the
prn ORF as in the in vitro
transcription
analysis, including the entire region that had been
identified
as important by the genetic analyses. Clear protection of a
region
encompassing nucleotides

94 to

52 was observed, while a
region
of weaker protection from nucleotides

51 to +22 was identified
(Fig.
4). Protection was dependent on
phosphorylation of BvgA
(Fig.
4, lane 2 versus lane 3), and the level
of protection increased
progressively upon the addition of a higher
concentration of phosphorylated
BvgA (Fig.
4, lane 4) and of
E. coli RNAP (Fig.
4, lane 5) in
the reaction mixtures. The region of
primary protection surrounds
the aforementioned
EcoRI site
at nucleotide

68 (see Fig.
7) and
is thus consistent with our genetic
analysis. The area of secondary
protection extended to just downstream
of the
ClaI site, approximately
100 bp upstream of the
published transcription start site.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 4.
DNase I footprinting analysis of the prn
promoter. Protection reaction mixtures, where indicated, contained 150 nM E. coli 70-saturated RNAP, 15 mM Ac~P,
and BvgA at 0.58 (lane 3) or 1.2 (lanes 2, 4, and 5) µM. Reaction
mixtures were electrophoresed on a 6% acrylamide sequencing gel and
exposed for autoradiography in a PhosphorImager cassette. The black
rectangle represents the region of primary protection by BvgA from
positions 94 to 52, and the open rectangle represents the region of
secondary protection by BvgA from 51 to +22.
|
|
Identification of the bvg-dependent transcription start
site of prn.
The results of our genetic and biochemical
analyses brought into question the accuracy of the published
transcription start site. In addition, our attempts to repeat the
primer extension analysis resulted in the same extension product as
that published previously (12), but this product was
obtained not only from the wild-type but also from the Tohama I
bvg and modulated B. pertussis strains (data
not shown). This would indicate that transcription initiating at this
site is not bvg dependent, which is not consistent with it
being the relevant prn transcription start site.
Although we used a number of different primers, repeated attempts at
primer extension to identify an additional
prn transcript
were unsuccessful, possibly due to the low level of
prn
transcript
and the high GC content of
B. pertussis nucleic
acids. Therefore,
we used a variety of alternative methods in an
attempt to identify
the
bvg-dependent
prn
transcription start site. We first used
a series of
prn-lac
transcriptional fusions (Fig.
5) to
localize
the region that resulted in
bvg-dependent
transcriptional activity
from the
prn promoter. We created
constructs in which sequences
were deleted from the
NcoI
site at the
prn-lac fusion to a number
of
NcoI or
NsiI sites engineered in the upstream sequence. By
determining which deletions abolished transcriptional activity,
we
would be able to localize the
prn promoter. The deletions
were
introduced to the chromosome of
B. pertussis Tohama I,
and the
resulting strains were used in

-galactosidase assays to
determine
prn promoter activity. NMD637 and NMD638 retained
bvg-dependent
transcriptional activity (Fig.
5B and C). The
maintenance of activity
in these strains provides genetic evidence that
the published
start site (
12) is incorrect and that the true
transcription
start site is located further upstream. Sequence was also
deleted
up to nucleotides

9 (NMD643) and

21 (NMD642). Both
deletions
abolished
prn transcriptional activity (Fig.
5D
and E) and, in
combination with the aforementioned deletions, localized
the
prn transcription start site to a region of 30 bp
flanking the
ClaI
site.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of sequential deletion of the sequence upstream
of the prn ORF on prn promoter activity.
Alterations are shown on the left, and promoter activities
(103 Lac units) with standard deviation bars are shown on
the right. The gray bars represent -galactosidase levels when the
strains were grown under nonmodulating conditions, and the black bars
represent -galactosidase levels when the strains were grown in the
presence of 50 mM MgSO4. (A) NMD616, wild type; (B) NMD637,
strain with deletion from lac fusion junction to position
+61; (C) NMD638, strain with deletion from lac fusion
junction to position +22; (D) NMD643, strain with deletion from
lac fusion junction to position 8; (E) NMD642, strain with
deletion from lac fusion junction to position 23. The
putative 10 sequence and +1 are indicated in bold, and the
ClaI site is italicized.
|
|
To identify the 5' end of the
prn transcript, we used a
series of sequential 5' primers corresponding to sequence in this
region in an RT-PCR analysis to establish the point at which we
were no
longer able to generate a PCR product. The 5' primers
are shown in Fig.
6 and were all paired for PCRs with an
oligonucleotide
complementary to the sequence 172 bp into the
prn ORF. Total RNA
was isolated from
B. pertussis
Tohama I and used in first-strand
cDNA synthesis reactions with random
hexamers. The cDNA was used
as a template for PCR, and the results are
shown in Fig.
6. This
analysis localized the start of the transcript to
the sequence
between primers 669 and 666 or between bp

12 and +8
(Fig.
6).
This result is consistent with our previous genetic and
biochemical
data and further supports the conclusion that the published
transcription
start site is erroneous.

View larger version (7K):
[in this window]
[in a new window]
|
FIG. 6.
Schematic of prn promoter sequence and
oligonucleotides used in RT-PCR analysis. Sequential oligonucleotide
primers were paired with an antisense primer in the prn ORF
in PCRs with total B. pertussis cDNA used as a template to
determine the 5' extent of the prn transcript. PCR product
results are shown to the right of the respective oligonucleotide
primers. +, strong band; +/ , faint band; , absence of PCR product.
The putative 35 and 10 sequences and +1 are indicated in bold.
|
|
Finally, we used a variation of the 5' RACE technique to identify the
precise
prn transcription start site. This technique
allowed
us to use the power of PCR amplification to overcome the
difficulties
associated with the low level of
prn transcript.
We were
also able to adapt the protocol to overcome problems associated
with
the high GC content of
B. pertussis. The same 5' RACE
products
were obtained from two separate pools of total RNA isolated
from
strain Tohama I, but the product was not evident when RNA from
the
Tohama I
bvg strain, a Bvg

strain of
B. pertussis, was used. The use of primers containing
XhoI and
SpeI sites facilitated the cloning of
the PCR products,
and six clones were sequenced to determine the
terminal nucleotide.
The sequence indicated that the transcription
start site for
prn is the cytosine located 125 bp upstream
of the published transcription
start site (Fig.
7). This result is consistent with both
the RT-PCR
analysis and the chromosomal
prn-lac fusion data.
A putative

10
promoter sequence of GAGAAT is located 7 bp
upstream of this +1.
Twenty base pairs upstream of this

10 sequence
there is a potential

35 sequence of TTGCTT (Fig.
7).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 7.
Schematic diagram of the sequence upstream of
prn. The end of an ORF with codon usage typical of B. pertussis is followed by 335 bp of intergenic sequence and the
start of the prn ORF. A putative transcription terminator
for the upstream ORF is depicted by inverted arrows. Relevant
restriction sites are indicated in italics, and the reported
transcription start site (12) is indicated in bold and
marked by #. The region of primary DNase I protection by BvgA (from
positions 94 to 52) is outlined with a solid line, while the region
of weak, secondary protection by BvgA (from positions 51 to +22) is
outlined with a dashed line. DNase I-hypersensitive sites in the
presence of BvgA are noted with an asterisk. The transcription start
site identified in this paper is indicated in bold and marked as +1,
and the numbering is in reference to this start site. Putative 10 and
35 promoter sequences are in boldface type and labeled. A putative
primary BvgA binding site is indicated in lowercase letters.
|
|
 |
DISCUSSION |
In this study, we have provided preliminary evidence that the
kinetics of prn promoter activation in B. pertussis are intermediate between the early fha
promoter and late ptx promoter. We have also identified
cis-acting sequences that contribute to prn
promoter activation in B. pertussis and have identified a
bvg-dependent transcription start site. We have provided in
vivo genetic data and in vitro biochemical data that together support
the hypothesis that BvgA binds to the sequence upstream of
prn and activates transcription from the promoter, similar
to its activity at other bvg-activated genes.
Thus far, two classes of bvg-activated promoters, based on
their temporal activation after an inducing signal, had been
identified: the early class represented by fha and
bvg and the late class represented by ptx and
cya (23). Our activation kinetics data indicate
that prn promoter activation occurs at a time between that
of fha and ptx and therefore would suggest that a
third, intermediate class of bvg-activated promoter exists.
Our classification is not to be confused with a Bvg-intermediate (BvgI)
phase of B. bronchiseptica, which was shown to occur in
response to semimodulating conditions (8). Although
differences in the promoters of these genes are thought to be
responsible for the differences in activation kinetics, the role that
differential regulation of virulence factors plays in B. pertussis pathogenesis is unknown. It is possible that the
differential regulation that we are characterizing in vitro may reflect
the necessity of the Bvg regulon to be sensitive to small changes in
microenvironments to provide modulating signals that control gene
expression during the course of infection. Our data from both genetic
and biochemical analyses did not support the location of the
prn transcription start site as published. Our analysis
identifies the bvg-dependent prn transcription
start site as the cytosine located 125 bp upstream from the previously reported start site. A putative
10 promoter sequence based on similarity to
70 promoters is located 7 bp upstream of
this start site, in good agreement with the consensus spacing of 6 to 8 bp (18). The putative
10 and
35 sequences of this
prn promoter have 4 of 6 and 3 of 6 nucleotides,
respectively, matching the consensus
70 promoter
sequences (18). However, these sequences are separated by 20 bp, which is longer than the consensus 17-bp distance
(18) but similar to the 21-bp distance of the
bvg-activated ptx promoter (19). This
may contribute to the requirement of this promoter for BvgA activation.
The presence of these putative promoter sequences at the
appropriate position upstream of the transcription start site provides
additional support for our experimental data. The location of the
prn transcription start site reveals a relatively long
(159-nucleotide) leader sequence in the prn transcript, a feature that has not been observed in other well-characterized bvg-activated promoters. Partial deletion of the leader
sequence did not appear to have an effect on transcription levels of
our prn-lac fusion (Fig. 5), but the deletion of almost the
entire leader sequence reduced transcriptional activity by almost 45% (Fig. 5C). This would indicate that the leader sequence, or at least
part of it, is necessary for full prn transcriptional
activity. It is possible that the leader sequence plays a role in the
differential regulation of the prn promoter. We are
currently examining the effect that leader sequence alterations and
other changes have on the activation kinetics of prn.
Our data from the genetic analyses of the sequence upstream of
prn strongly suggest that the sequence critical for
prn activation extends upstream to position
84. Our
initial prn-lac fusions indicated that the sequence up to
68 was important, but possibly not sufficient, for full
prn transcription. Our subsequent transcriptional fusions
determined that the additional sequence from
84 to
68 is crucial
for transcriptional activity.
Our data from the biochemical analyses of the prn promoter
corroborate this genetic data. In vitro transcription analysis from the
prn promoter demonstrated that prn transcription
is directly BvgA dependent. DNase I protection analysis demonstrated
that BvgA binds to the sequence upstream of prn, in the
region identified by the genetic data as necessary for transcription
from the prn promoter. Both assays indicate that
phosphorylation of BvgA is required for its binding to the
prn sequence and subsequent transcription activation. This
result is similar to that seen with other bvg-activated promoters (2, 3, 26). Within the region of strongest
protection by BvgA, a possible tandem inverted heptanucleotide repeat
sequence with homology to similar sequences implicated as primary BvgA binding sites at other BvgA-activated promoters is present between
74
and
60, surrounding the EcoRI site (Fig. 7). The
hypothesis that this represents the primary BvgA binding site at the
prn promoter is supported by our deletion and replacement
data (Fig. 2).
The potential inverted repeat BvgA binding site of prn has 9 of 14 bp of the consensus BvgA binding site. The primary binding sites
of fha and ptx have 14 of 14 and 10 of 14 bp of
the consensus BvgA binding site, respectively. However, the
ptx half sites are separated by 10 bp and the sequence is
located more than 50 bp further upstream of the transcription start
site than it is in the fha-activating region. The distance
of the putative primary BvgA binding site upstream from the
prn promoter is similar to that at the fha
promoter. The affinity of BvgA for the primary binding sites may
therefore be a major contributing factor to the kinetics of activation
of these promoters. Our footprinting data indicate the presence of a
secondary BvgA binding region downstream of the primary site upon
addition of higher concentrations of phosphorylated BvgA (Fig. 4).
However, there is overlap of this secondary BvgA binding (in the
absence of RNAP) with the core promoter sequences, although addition of
RNAP to the footprinting reaction mixtures resulted in a visible
increase in protection in this region (Fig. 4). The possible
competition between BvgA and RNAP binding to this region at higher BvgA
concentrations may be an artifact of the in vitro analysis, or it may
contribute to the relatively low level of prn transcription
in B. pertussis. DNase I protection analysis and genetic
data support a model of cooperative BvgA binding at the ptx
promoter (3, 19). The data from this study suggest the
possibility that the same phenomenon occurs at the prn
promoter but with consequent transcription inhibition rather than
activation as at the ptx promoter. We are currently investigating these and other aspects of prn promoter activation.
 |
ACKNOWLEDGMENTS |
We thank Alla Romashko for technical assistance and Wei Dong,
Ryan Marques, and Ulrike McNamara for helpful discussions. We are also
grateful to Jean Manch-Citron for her advice regarding the use of the
5' RACE technique to map a transcription start site.
This work was supported by NIH grant AI32946.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: University Of
Maryland School of Medicine, Department of Microbiology and Immunology, BRB 13-009, 655 W. Baltimore St., Baltimore, MD 21201-1559. Phone: (410) 706-7677. Fax: (410) 706-2129. E-mail:
ncarbone{at}umaryland.edu.
 |
REFERENCES |
| 1.
|
Arico, B.,
J. F. Miller,
C. R. Roy,
S. Stibitz,
D. Monack,
S. Falkow,
R. Gross, and R. Rappuoli.
1989.
Sequences required for expression of Bordetella pertussis virulence factors share homology with prokaryotic signal transduction proteins.
Proc. Natl. Acad. Sci. USA
86:6671-6675[Abstract/Free Full Text].
|
| 2.
|
Boucher, P. E.,
K. Murakami,
A. Ishihama, and S. Stibitz.
1997.
Nature of DNA binding and RNA polymerase interaction of the Bordetella pertussis BvgA transcriptional activator at the fha promoter.
J. Bacteriol.
179:1755-1763[Abstract/Free Full Text].
|
| 3.
|
Boucher, P. E., and S. Stibitz.
1995.
Synergistic binding of RNA polymerase and BvgA phosphate to the pertussis toxin promoter of Bordetella pertussis.
J. Bacteriol.
177:6486-6491[Abstract/Free Full Text].
|
| 4.
|
Boucher, P. E.,
F. D. Menozzi, and C. Locht.
1994.
The modular architecture of bacterial response regulators: insights into the activation mechanism of the BvgA transactivator of Bordetella pertussis.
J. Mol. Biol.
241:363-377[Medline].
|
| 5.
|
Carbonetti, N. H.,
T. J. Irish,
C. H. Chen,
C. B. O'Connell,
G. A. Hadley,
U. McNamara,
R. G. Tuskan, and G. K. Lewis.
1999.
Intracellular delivery of a cytolytic T-lymphocyte epitope peptide by pertussis toxin to major histocompatability complex class I without involvement of the cytosolic class I antigen processing pathway.
Infect. Immun.
67:602-607[Abstract/Free Full Text].
|
| 6.
|
Carbonetti, N. H.,
T. M. Fuchs,
A. A. Patamawenu,
T. J. Irish,
H. Deppisch, and R. Gross.
1994.
Effect of mutations causing overexpression of RNA polymerase subunit on regulation of virulence factors in Bordetella pertussis.
J. Bacteriol.
176:7267-7273[Abstract/Free Full Text].
|
| 7.
|
Charles, I. G.,
G. Dougan,
D. Pickard,
S. Chatfield,
M. Smith,
P. Novotny,
P. Morrissey, and N. F. Fairweather.
1989.
Molecular cloning and characterization of protective outer membrane protein P.69 from Bordetella pertussis.
Proc. Natl. Acad. Sci. USA
86:3554-3558[Abstract/Free Full Text].
|
| 8.
|
Cotter, P. A., and J. F. Miller.
1997.
A mutation in the Bordetella bronchiseptica bvgS gene results in reduced virulence and increased resistance to starvation, and identifies a new class of Bvg-regulated antigens.
Mol. Microbiol.
24:671-685[Medline].
|
| 9.
|
DeShazer, D.,
J. D. Bannan,
M. J. Moran, and R. L. Friedman.
1994.
Characterization of the gene encoding superoxide dismutase of Bordetella pertussis and construction of a SOD-deficient mutant.
Gene
142:85-89[Medline].
|
| 10.
|
Elliott, T., and E. P. Geiduscheck.
1984.
Defining a bacteriophage T4 late promoter: absence of a " 35" region.
Cell
36:211-219[Medline].
|
| 11.
|
Everest, P.,
J. Li,
G. Douce,
I. Charles,
J. De Azavedo,
S. Chatfield,
G. Dougan, and M. Roberts.
1996.
Role of the Bordetella pertussis P.69/pertactin protein and the P.69/pertactin RGD motif in the adherence to and invasion of mammalian cells.
Microbiology
142:3261-3268[Abstract/Free Full Text].
|
| 12.
|
Graeff-Wohlleben, H.,
H. Deppisch, and R. Gross.
1995.
Global regulatory mechanisms affect virulence gene expression in Bordetella pertussis.
Mol. Gen. Genet.
247:86-94[Medline].
|
| 13.
|
Gross, R., and R. Rappuoli.
1988.
Positive regulation of pertussis toxin expression.
Proc. Natl. Acad. Sci. USA
85:3913-3917[Abstract/Free Full Text].
|
| 14.
|
Karimova, G., and A. Ullmann.
1997.
Characterization of DNA binding sites for the BvgA protein of Bordetella pertussis.
J. Bacteriol.
179:3790-3792[Abstract/Free Full Text].
|
| 15.
|
Karimova, G.,
J. Bellalou, and A. Ullmann.
1996.
Phosphorylation-dependent binding of BvgA to the upstream region of the cyaA gene of Bordetella pertussis.
Mol. Microbiol.
20:489-496[Medline].
|
| 15a.
|
Kasuga, T.,
Y. Nakase,
K. Ukishima, and K. Takatsu.
1954.
Studies on Haemophilus pertussis. Relation between the phase of bacilli and the progress of the whooping-cough.
Kitasato Arch. Exp. Med.
27:57-62[Medline].
|
| 16.
|
Lacey, B. W.
1960.
Antigenic modulation of Bordetella pertussis.
J. Hyg.
58:57-93.
|
| 17.
|
Leininger, E.,
M. Roberts,
J. G. Kenimer,
I. G. Charles,
N. Fairweather,
P. Novotny, and M. J. Brennan.
1991.
Pertactin, an Arg-Gly-Asp-containing Bordetella pertussis surface protein that promotes adherence to mammalian cells.
Proc. Natl. Acad. Sci. USA
88:345-349[Abstract/Free Full Text].
|
| 18.
|
Lisser, S., and H. Margalit.
1993.
Compilation of E. coli mRNA promoter sequences.
Nucleic Acids Res.
21:1507-1516[Abstract/Free Full Text].
|
| 19.
|
Marques, R. R., and N. H. Carbonetti.
1997.
Genetic analysis of pertussis toxin promoter activation in Bordetella pertussis.
Mol. Microbiol.
24:1215-1224[Medline].
|
| 20.
|
Miller, J.
1992.
A short course in bacterial genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 21.
|
Roy, C.,
J. Miller, and S. Falkow.
1990.
Autogenous regulation of the Bordetella pertussis bvgABC operon.
Proc. Natl. Acad. Sci. USA
87:3763-3767[Abstract/Free Full Text].
|
| 22.
|
Roy, C. R., and S. Falkow.
1991.
Identification of Bordetella pertussis regulatory sequences required for transcriptional activation of the fhaB gene and autoregulation of the bvgAS operon.
J. Bacteriol.
173:2385-2392[Abstract/Free Full Text].
|
| 23.
|
Scarlato, V.,
B. Arico,
A. Prugnola, and R. Rappuoli.
1991.
Sequential activation and environmental regulation of virulence genes in Bordetella pertussis.
EMBO J.
10:3971-3975[Medline].
|
| 24.
|
Simon, R.,
U. Priefer, and A. Pühler.
1983.
A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria.
Bio/Technology
1:784-791.
|
| 25.
|
Stainer, D. W., and M. J. Scholte.
1970.
A simple chemically defined medium for the production of phase I Bordetella pertussis.
J. Gen. Microbiol.
63:211-220[Abstract/Free Full Text].
|
| 26.
|
Steffen, P.,
S. Goyard, and A. Ullmann.
1996.
Phosphorylated BvgA is sufficient for transcriptional activation of virulence-regulated genes in Bordetella pertussis.
EMBO J.
15:102-109[Medline].
|
| 27.
|
Stibitz, S., and M.-S. Yang.
1991.
Subcellular location and immunological detection of proteins encoded by the vir locus of Bordetella pertussis.
J. Bacteriol.
173:4288-4296[Abstract/Free Full Text].
|
| 28.
|
Stibitz, S.,
W. Black, and S. Falkow.
1986.
The construction of a cloning vector designed for gene replacement in Bordetella pertussis.
Gene
50:133-140[Medline].
|
| 29.
|
Uhl, M. A., and J. F. Miller.
1994.
Autophosphorylation and phosphotransfer in the Bordetella pertussis bvgAS signal transduction cascade.
Proc. Natl. Acad. Sci. USA
91:1163-1167[Abstract/Free Full Text].
|
| 30.
|
Zu, T.,
R. Manetti,
R. Rappuoli, and V. Scarlato.
1996.
Differential binding of BvgA to two classes of virulence genes of Bordetella pertussis directs promoter selectivity by RNA polymerase.
Mol. Microbiol.
21:557-565[Medline].
|
Journal of Bacteriology, September 1999, p. 5234-5241, Vol. 181, No. 17
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nicholson, T. L., Buboltz, A. M., Harvill, E. T., Brockmeier, S. L.
(2009). Microarray and Functional Analysis of Growth Phase-Dependent Gene Regulation in Bordetella bronchiseptica. Infect. Immun.
77: 4221-4231
[Abstract]
[Full Text]
-
Sukumar, N., Mishra, M., Sloan, G. P., Ogi, T., Deora, R.
(2007). Differential Bvg Phase-Dependent Regulation and Combinatorial Role in Pathogenesis of Two Bordetella Paralogs, BipA and BcfA. J. Bacteriol.
189: 3695-3704
[Abstract]
[Full Text]
-
Donato, G. M., Hsia, H.-L. J., Green, C. S., Hewlett, E. L.
(2005). Adenylate Cyclase Toxin (ACT) from Bordetella hinzii: Characterization and Differences from ACT of Bordetella pertussis. J. Bacteriol.
187: 7579-7588
[Abstract]
[Full Text]
-
Pflock, M., Kennard, S., Delany, I., Scarlato, V., Beier, D.
(2005). Acid-Induced Activation of the Urease Promoters Is Mediated Directly by the ArsRS Two-Component System of Helicobacter pylori. Infect. Immun.
73: 6437-6445
[Abstract]
[Full Text]
-
Mishra, M., Deora, R.
(2005). Mode of Action of the Bordetella BvgA Protein: Transcriptional Activation and Repression of the Bordetella bronchiseptica bipA Promoter. J. Bacteriol.
187: 6290-6299
[Abstract]
[Full Text]
-
Stenson, T. H., Allen, A. G., al-Meer, J. A., Maskell, D., Peppler, M. S.
(2005). Bordetella pertussis risA, but Not risS, Is Required for Maximal Expression of Bvg-Repressed Genes. Infect. Immun.
73: 5995-6004
[Abstract]
[Full Text]
-
Mishra, M., Parise, G., Jackson, K. D., Wozniak, D. J., Deora, R.
(2005). The BvgAS Signal Transduction System Regulates Biofilm Development in Bordetella. J. Bacteriol.
187: 1474-1484
[Abstract]
[Full Text]
-
Carbonetti, N. H., Artamonova, G. V., Andreasen, C., Dudley, E., Mays, R. M., Worthington, Z. E. V.
(2004). Suppression of Serum Antibody Responses by Pertussis Toxin after Respiratory Tract Colonization by Bordetella pertussis and Identification of an Immunodominant Lipoprotein. Infect. Immun.
72: 3350-3358
[Abstract]
[Full Text]
-
Merkel, T. J., Boucher, P. E., Stibitz, S., Grippe, V. K.
(2003). Analysis of bvgR Expression in Bordetella pertussis. J. Bacteriol.
185: 6902-6912
[Abstract]
[Full Text]
-
Carbonetti, N. H., Artamonova, G. V., Mays, R. M., Worthington, Z. E. V.
(2003). Pertussis Toxin Plays an Early Role in Respiratory Tract Colonization by Bordetella pertussis. Infect. Immun.
71: 6358-6366
[Abstract]
[Full Text]
-
Deora, R.
(2002). Differential Regulation of the Bordetella bipA Gene: Distinct Roles for Different BvgA Binding Sites. J. Bacteriol.
184: 6942-6951
[Abstract]
[Full Text]
-
Bogdan, J. A., Nazario-Larrieu, J., Sarwar, J., Alexander, P., Blake, M. S.
(2001). Bordetella pertussis Autoregulates Pertussis Toxin Production through the Metabolism of Cysteine. Infect. Immun.
69: 6823-6830
[Abstract]
[Full Text]
-
Kinnear, S. M., Marques, R. R., Carbonetti, N. H.
(2001). Differential Regulation of Bvg-Activated Virulence Factors Plays a Role in Bordetella pertussis Pathogenicity. Infect. Immun.
69: 1983-1993
[Abstract]
[Full Text]
-
Henderson, I. R., Nataro, J. P.
(2001). Virulence Functions of Autotransporter Proteins. Infect. Immun.
69: 1231-1243
[Full Text]
-
Carbonetti, N. H., Romashko, A., Irish, T. J.
(2000). Overexpression of the RNA Polymerase Alpha Subunit Reduces Transcription of Bvg-Activated Virulence Genes in Bordetella pertussis. J. Bacteriol.
182: 529-531
[Abstract]
[Full Text]