Previous Article | Next Article ![]()
Journal of Bacteriology, September 1999, p. 5317-5329, Vol. 181, No. 17
Department of Biology, University of Utah,
Salt Lake City, Utah 84112
Received 7 April 1999/Accepted 18 June 1999
The eut operon of Salmonella typhimurium
encodes proteins involved in the cobalamin-dependent degradation of
ethanolamine. Previous genetic analysis revealed six eut
genes that are needed for aerobic use of ethanolamine; one
(eutR), encodes a positive regulator which mediates
induction of the operon by vitamin B12 plus ethanolamine.
The DNA sequence of the eut operon included 17 genes,
suggesting a more complex pathway than that revealed genetically. We
have correlated an open reading frame in the sequence with each of the
previously identified genes. Nonpolar insertion and deletion mutations
made with the Tn10-derived transposable element T-POP
showed that at least 10 of the 11 previously undetected eut
genes have no Eut phenotype under the conditions tested. Of the
dispensable eut genes, five encode apparent homologues of proteins that serve (in other organisms) as shell proteins of the
carboxysome. This bacterial organelle, found in photosynthetic and
sulfur-oxidizing bacteria, may contribute to CO2 fixation by concentrating CO2 and excluding oxygen. The presence of
these homologues in the eut operon of
Salmonella suggests that CO2 fixation may be a
feature of ethanolamine catabolism in Salmonella.
Under aerobic conditions,
Salmonella typhimurium can use ethanolamine as a sole source
of carbon, nitrogen, and energy (44, 47). However, this
growth depends on exogenous cobalamin, a required cofactor that
Salmonella cannot synthesize in the presence of oxygen.
Under anaerobic conditions, vitamin B12 is made, but Salmonella cannot use ethanolamine as a carbon or energy
source, even with the alternative electron acceptor nitrate or
fumarate. Recently this paradox has been resolved by the finding that
the anaerobic electron acceptor tetrathionate allows
Salmonella to use endogenous B12 to support
anaerobic degradation of ethanolamine as a sole source of nitrogen,
carbon, and energy (12). Anaerobic use of ethanolamine may
be important to Salmonella, since this carbon source is a
constituent of an abundant class of lipids which would be provided to
anaerobic gut inhabitants as part of the host's dietary intake.
The initial genetic analysis of the eut operon was done with
mutants defective in aerobic degradation of ethanolamine on medium including cobalamin. A large set of mutations were sorted into six
complementation groups (eutABCDER) and ordered by deletion mapping (44, 45). More recent genetic tests have identified a seventh complementation group, eutT (54, 67).
The standard reactions in ethanolamine utilization are diagrammed in
Fig. 1, with proposed roles for several
Eut proteins. One previously identified gene, eutR, encodes
a positive regulatory protein which mediates induction of the operon by
ethanolamine plus cobalamin (46, 53). Two genes
(eutBC) encode subunits of the cobalamin-dependent
ethanolamine ammonia lyase (27, 45), which converts
ethanolamine to acetaldehyde and ammonia (13, 50). The
eutE gene encodes the second enzyme in the pathway, acetaldehyde dehydrogenase, which forms acetyl-coenzyme A (CoA) (45). As expected, bacteria with mutations in this gene can use ethanolamine as a source of nitrogen but not carbon [a
Eut(N+ C
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The 17-Gene Ethanolamine (eut) Operon of
Salmonella typhimurium Encodes Five Homologues of
Carboxysome Shell Proteins

and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) phenotype]. The EutT enzyme
appears to be an adenosyl transferase, converting CNB12 to
AdoB12, and the EutA protein appears to protect the lyase
(EutBC) from inhibition by CNB12 (54). We
propose below that the eutG gene encodes an alcohol
dehydrogenase. No function has been assigned to the eutD
gene, whose mutants have a Eut(N+ C
)
phenotype.

View larger version (28K):
[in a new window]
FIG. 1.
Suggested pathway for metabolism of ethanolamine. Gene
assignments are based on direct assays (EutBCE and CobA), on mutant
phenotypes (EutA, EutT, Ack, Pta, and glyoxylate shunt), or on sequence
similarity (EutG). The homologues of carboxysome shell proteins suggest
the possibility of CO2 fixation, which has not been
demonstrated. In the diagram, the outer boundary is the cell membrane;
the role of carboxysomes in this pathway is unknown.
We report here the complete DNA sequence of the eut operon and adjacent regions, including about 7 kb of new sequence and several corrections of previously reported data. Previously sequenced parts of the operon include the eutB and eutC genes (27) and a nonoverlapping 8-kb fragment (60). Surprisingly, the operon includes 17 open reading frames, suggesting that 11 eut genes escaped detection by the initial genetic analysis. Here we correlate the genetic and physical maps of the operon and analyze available information on the function of each of the 17 genes. Using insertions of a new transposon (T-POP) and derived deletion mutations, we provide evidence that at least 10 of the 11 extra genes are not needed for aerobic ethanolamine metabolism. Five of the extra eut genes encode homologues of three families of proteins that serve in other prokaryotes as shell proteins of the carboxysome, an organelle which stimulates CO2 fixation and has been suggested to concentrate CO2 (3, 25, 29, 57). We propose that a similar organelle forms in Salmonella and supports catabolism of ethanolamine by a route that involves CO2 fixation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains. All strains used in this study are derivatives of S. typhimurium; in view of the large number of strains used, strain numbers are listed only in data tables and in the text. Isolation of all zfa insertions (near the eut operon) and all eut mutations with allele numbers below 205 was described previously (44-46). Transposon Tn10dTc is a transposition-defective derivative of transposon Tn10 (68). The T-POP transposon, derived from Tn10dTc, directs tetracycline-inducible promoters into genes adjacent to its insertion site (42). MudA and MudJ elements are transposition-defective derivatives of phage Mu (15, 16). MudP and MudQ (MudP22 elements) have the ends of phage Mu but include a chloramphenicol resistance determinant and a P22 prophage that cannot excise when induced but packages a limited region of the chromosome adjacent to the MudP or -Q insertion site (70). Strains carrying MudP or MudQ insertions near the eut operon were induced in order to obtain template DNA for sequencing the eut operon.
Media, chemicals, and enzymes. The rich medium was Luria-Bertani broth. The carbon-free minimal medium was NCE (5), and the carbon- and nitrogen-free minimal medium was NCN (43). Ethanolamine hydrochloride (3) at 0.4% was used as a carbon source in the last two media. MacConkey agar base (Difco) was used as a colorimetric indicator of acid production and was prepared according to the manufacturer's specifications.
When used, antibiotics were present at the following concentrations: ampicillin, 50 µg/ml; tetracycline, 20 µg/ml (selection) or 2 µg/ml (T-POP transcription); chlortetracycline, 10 µg/ml (T-POP transcription); kanamycin, 50 µg/ml; and chloramphenicol, 20 µg/ml. Chlortetracycline was activated by autoclaving it with the medium. The chromogenic
-galactosidase substrate X-Gal
(5-bromo-4-chloro-3-indolyl-
-D-galactoside; Diagnostic
Chemicals) was used at a final concentration of 0.01%. Cyanocobalamin
(CN-B12; Sigma) was used at a final concentration of 200 nM.
Crystalline bovine serum, Ficoll (type 400), and cresol red were from
Sigma. Premixed deoxynucleoside triphosphates were from Pharmacia.
Isotopically labelled nucleotides (32P and 33P)
were from Dupont, New England Nuclear. Hexadecyltrimethylammonium bromide (CTAB) was from Aldrich. Taq polymerase was
purchased from Promega, TaqStart antibody was from Clontech, and
proteinase K was from Gibco-BRL.
Genetic techniques. Transduction crosses were mediated by the high-frequency generalized transducing phage P22 HT105/1 int-201 (51). Transductants were freed of phage by streaking them on green indicator plates (17). Cells were cross-streaked with the P22 clear plaque mutant H5 to verify phage sensitivity.
Selecting insertions of T-POP in the eut operon. The T-POP derivative of transposon Tn10 directs tetracycline-induced promoters out of each end (42). In this cross, the donor (TT18797) carried the T-POP insertion on an Escherichia coli F', plasmid; the lack of homology prevents recombination between the transduced T-POP region and the recipient chromosome. For some crosses, the recipient (TT17428) carried a standard Tn10 transposase (plasmid pZT380); in other cases, the recipient (TT17437) expressed a mutant form of IS10 transposase (plasmid pNK2881) that allows transposition with relaxed target site specificity (4). Selected tetracycline-resistant clones inherited T-POP by transposition into random sites in the chromosome. A large collection (>10,000) of random-insertion clones were pooled to create the T-POP pool.
Transducing phage prepared on the T-POP pool were used to transduce a recipient that carried a eutR::MudJ insertion; the lacZ gene of this recipient is not expressed, since it lacks the EutR protein required for operon induction. Clones were sought which formed red (Lac+) colonies on MacConkey agar-lactose-tetracycline plates (due to the T-POP promoter) and white colonies without tetracycline (when the T-POP promoter is repressed).Making deletion mutations by using insertions of T-POP.
Phenotypically Eut
insertion mutants were subjected to
selection for aerobic growth on ethanolamine plus vitamin
B12. Some surviving clones carried a deletion that removed
the inserted material and extended into adjacent regions of the
eut operon that are not essential to the Eut+
phenotype. Four different in-frame Eut+ deletions that lie
between the promoter and the eutR gene were isolated; each
was made from a different parental eut insertion.
Preparation of chromosomal DNA. Crude template DNA for rapid PCR mapping was prepared by resuspending a 50-µl cell pellet of an overnight culture in Tris-EDTA (TE) buffer, holding it at 95°C for 3 min, spinning out cell debris, and using the supernatant directly. These preparations lost template efficiency with repeated freezing and thawing or storage on ice and were unsatisfactory for sequencing.
Chromosomal DNA preparations for sequencing were prepared as suggested by Knut Jahreis (personal communication). A fresh overnight cell culture (1.5 ml) was centrifuged and resuspended in 567 µl of TE buffer (10 mM Tris, pH 8.3, 1 mM EDTA). Sodium dodecylsulfate (15 µl of a 20% solution) and proteinase K (3 µl of a 20-mg/ml solution) were added, and the suspension was incubated for 1 h at 37°C. NaCl (100 µl of a 5 M solution) was then added with gentle but complete mixing. CTAB was then added (80 µl of a solution of 41 mg of NaCl and 100 mg of CTAB in 1 ml of H2O) with gentle mixing. After 10 min at 65°C, the mixture was extracted with 1 volume of CIA (chloroform-isoamyl alcohol [24:1]). The aqueous phase was saved and drawn repeatedly through a 22-gauge syringe needle to fragment the DNA. The preparation was then extracted twice with phenol-CIA (1:1), and the final aqueous phase was extracted with 1 volume of 1-butanol. DNA was precipitated by addition of 1 volume of isopropanol and was recovered by centrifugation. The pellet was washed once with 70% ethanol, placed under vacuum until nearly (but not completely) dry, resuspended in 100 µl of H2O, and stored at
20°C.
PCR methods. (i) Standard amplification techniques. All PCRs were done in glass capillaries with an AirCycler thermal cycler (Idaho Technology). The buffers and conditions were as described in protocols provided by the company, with the following modifications: cresol red was used as the indicator dye, and magnesium was used at 1, 2, or 3 mM. Products for sequencing were purified with Wizard PCR purification kits (Promega). The two methods described below were used to amplify unknown sequence adjacent to a single known region.
(ii) Semirandom amplification. At sufficiently low stringency, a primer will often misprime close enough to its correct binding site that amplification of the intervening DNA will occur with a single primer (P1). The most stringent conditions of magnesium and annealing temperature which still allow one or a small number of misprimed bands to form are determined. These bands are excised and used as templates in a reamplification reaction at high stringency, using P1 with a nested primer oriented in the same direction (P2) at a 1:100 molar ratio of P1 to P2. P1 will continue to initiate at the unknown end, but P2 will dominate priming at the known end, leading to amplification of a fragment differing in size from the original product by the distance between the ends of P1 and P2. This difference is diagnostic of a product derived from the known region. The technique generates template which can be sequenced from either end by using P1 or P2.
(iii) Nested amplification. The second method uses one primer in known sequence (K primer) and an ambiguous N primer, which is designed to misprime at nearby sites. The amplified region is between the known K primer and all of the sites at which the N primer acts. This method is sensitive to initial template complexity. It works well on DNA extracted from MudP22 heads or on large PCR products.
The four N primers had the sequence ACTTCTCAACAACTCAGGACGAACA(N)10XCAGC, where X is replaced by G, A, T, or C, yielding primers NG, NA, NT, and NC. The reamplification primer (P primer) is identical in sequence to the common portion of the initial oligonucleotide preceding the run of 10 ambiguous bases in the N primers. Four initial primer extensions were done with NX primers at extremely low stringency (annealing temperature of 40°C). Wizard PCR columns were used to remove the primers and most of the large template DNA, which binds irreversibly to the columns. Extension times were less than 1 min, so most products are short enough to be easily eluted. The extensions were then used as templates in standard amplification reactions containing a known primer and the shorter P primer, which recognizes the outside end of all NX-primed products. Reamplification with a nested known primer can be used to identify correctly anchored fragments. Optimally, amplification with a nested known primer and the P primer yielded a series of products separated by an average of 256 bases. The unknown ends of all products can be sequenced with the P primer.Sequencing the eut operon and identifying insertion sites. Sequencing templates were PCR-amplified genomic regions between genetically mapped Tn10 and Mud insertions or between one such insertion and previously determined eut sequence. The approximate positions of insertions were judged by the size of the fragment; the precise position was determined by sequencing the junctions between the element and adjacent chromosomal sequence. To amplify regions resistant to PCR, MudP22-packaged DNA was sequenced directly; this DNA was obtained from phage particles released after inducing one of the MudP or MudQ lysogens (TT14884, TT15254, or TT15632). MudP and MudQ elements are described above.
Sequencing was done according to the method of Sanger et al (49) with variations described in manganese reagent Sequenase or ThermoSequenase kits (Amersham Life Science) and in protocols for dye-terminator sequencing (Applied Biosystems). The latter was carried out at the University of Utah Health Sciences DNA Sequencing Facility, headed by Margaret Robertson. Primers were synthesized by Robert Schackmann at the University of Utah Health Sciences DNA/Peptide Synthesis Facility.Nucleotide sequence accession number. The sequence described here has GenBank accession no. AF093749.
| |
RESULTS |
|---|
|
|
|---|
Catabolism of ethanolamine. A current view of ethanolamine catabolism is diagrammed in Fig. 1. This scheme is consistent with previous genetic analyses and includes some of the gene assignments proposed here. Acetyl-CoA is formed by the sequential activity of the vitamin B12-dependent lyase and the dehydrogenase whose genes were identified genetically (eutBC and eutE). Acetyl-CoA can be converted to acetyl phosphate and excreted as acetate, yielding one molecule of ATP; these reactions (Pta and Ack functions) are required for aerobic growth on ethanolamine (28). Acetyl-CoA can enter the tricarboxylic acid (TCA) cycle and provide both a carbon and an energy source by respiration of oxygen. Under anaerobic conditions, tetrathionate can be used as an alternative electron acceptor, but other alternative acceptors, including nitrate and fumarate, do not support anaerobic growth on ethanolamine (12). The TCA cycle is thought to be essential, since mutants blocked in the glyoxalate shunt fail to use ethanolamine (12). If NADH generated by the TCA cycle exceeds that which can be removed by respiration, acetaldehyde may serve as an electron sink by being reduced to ethanol (Fig. 1). The energy yield from ethanolamine by these pathways might be expected to exceed that provided by acetate, because ethanolamine can enter cells by diffusion and be converted to acetyl-CoA by a dehydratase with no energetic cost. In contrast, acetate must be transported and converted to acetyl-CoA at the cost of at least one ATP.
Since the vitamin B12 cofactor of ethanolamine ammonia lyase is only made anaerobically, we suspect that under natural conditions a major use of ethanolamine may occur in the absence of oxygen. In the absence of any electron acceptor, conversion of ethanolamine to excreted acetate, catalyzed by the Pta and Ack activities, provides a source of energy (ATP) but not of carbon; this use of ethanolamine is detected as a stimulation of anaerobic growth on dilute casamino acids (12). When tetrathionate is provided as the alternative electron acceptor, ethanolamine can serve anaerobically as a nitrogen, carbon, and energy source, using endogenous vitamin B12. Anaerobic growth on ethanolamine (or propanediol) with tetrathionate as an electron acceptor are the only conditions known to us under which vitamin B12 synthesis is required for growth of wild-type cells. We propose that many of the extra Eut enzymes may be involved in CO2 fixation. This fixation may be required because so much carbon is lost as excreted acetate and ethanol (Fig. 1).Sequence of the eut operon. The eut operon sequence was completed and is diagrammed in Fig. 2. The portions determined previously are indicated (27, 60). The operon includes 17 genes. This was surprising, because only six genes were identified genetically (eutD, -E, -A, -B, -C, and -R). Features of the sequence are listed in Table 1, and selected alignments with other genes are given in Table 2. A copy of the transposable element IS200 was found upstream of the eut operon. Nucleotides are numbered with respect to the first base to the right of this IS200 copy (Fig. 2). Sequence downstream of eut structural genes includes a probable transcription terminator and the nearby hemF gene. The sequence of the homologous region from E. coli is indicated for comparison and will be described later.
|
|
|
mutants.
Correlating the genetic and physical maps of the eut
operon.
The physical locations of many genetically mapped
insertions, deletions, and point mutations were determined from the
sizes of PCR fragments or by sequencing. Table
3 lists the positions of
insertion mutations. Correlation of these sites with the sites of
genetically mapped deletion endpoints validates the genetic map
(44) and supports the gene assignments listed below.
|
|
|
Use of T-POP insertions to define gene functions.
The
transposable element T-POP was derived from transposon
Tn10dTc (42). Weak tetracycline-inducible
transcripts emerge from both ends of the parent transposon
Tn10dTc (63). Stronger regulated outward
transcription is seen for the derived T-POP element because internal
transcription terminators have been deleted. When no tetracycline is
provided, a T-POP insertion has a strong polar effect on expression of
distal genes in an operon, allowing detection of insertions that
prevent expression of genes required for a Eut+ phenotype.
Tetracycline induces expression of downstream genes and, in effect,
abolishes the polarity effect of the insertion. In the presence of
tetracycline, a T-POP insertion is defective only for the gene in which
it inserts. Genes with no mutant phenotype can be identified because
their T-POP insertions cause a Eut
phenotype (by a polar
effect on distal eut genes) that is corrected by addition of
tetracycline. This correction is not seen if the target gene is
essential to a Eut+ phenotype.
The eutS, -P, -Q,
-T, -D, -M, -J,
-G, -H, -L, and -K
genes are not essential for aerobic ethanolamine degradation.
Available insertions of T-POP in many genes (eutSPDMJGJK)
cause a Eut
phenotype that is corrected by addition of
tetracycline (Table 6). In some cases the
correction is incomplete, suggesting that the T-POP promoters may not
be sufficiently strong to provide a wild-type Eut+
phenotype; this is frequently true for insertions in orientation B,
which directs the weaker tetR promoter downstream.
Alternatively, the target gene may encode a protein that makes a minor
contribution but is not essential to ethanolamine degradation. The
phenotypes scored (Table 6) were aerobic use of ethanolamine as a sole
carbon and energy source (tested on minimal ethanolamine-vitamin
B12 plates), and acid production on MacConkey medium
containing ethanolamine and vitamin B12.
|
|
phenotype, but
multigene deletions that remove the eutD gene are
phenotypically Eut+; this suggests that the phenotype of
EutD point mutations was due to polar effects on other genes. This will
be discussed later.
Homologues of carboxysome proteins. Five genes (eutS, -M, -N, -L, and K) encode small proteins similar to the shell proteins of the carboxysome, an organelle found in photosynthetic and sulfur-oxidizing bacteria (57). These genes also resemble the pduA and -B genes of in the Salmonella pdu operon, which encode enzymes needed for vitamin B12-dependent degradation of propanediol (10, 11, 18, 47). The eutM and -N genes were identified previously, and their sequence similarity to carboxysome proteins was noted (60); these genes were originally designated cchA and cchB and have been renamed, since it is now clear that they are part of the ethanolamine (eut) operon.
The EutN protein is very similar to the CcmL protein of Synechococcus (Fig. 3). The EutM, EutK, and PduA proteins are clearly homologous to the CcmK protein of Synechococcus. The longer EutL, EutS, and PduB proteins are clearly similar to each other and are less obviously related to the others; their distant similarity to the CcmK family (EutMK and PduA) was inferred from a shared multiple-alignment profile (24). The C-terminal portions of the EutL, EutS, and PduB proteins are most similar to that of the PduA protein. Sequence features that the three proteins share with PduA are indicated in Fig. 3; these were identified with the profile program of the Genetics Computer Group sequence analysis software package.
|
The eutP and eutQ genes.
The predicted
EutP and EutQ proteins do not resemble others in current databases.
Neither gene has a Eut
mutant phenotype when mutants are
tested aerobically in an otherwise-wild-type background.
The eutT gene.
Point mutations in the
eutT gene were included in the original set of Eut mutations
but appeared to owe their phenotype to polarity on distal genes. This
is supported by the fact that all are nonsense mutations (Table 5).
This interpretation is consistent with the observation that the most
upstream eutT point mutations cause a Eut(N
C
) phenotype and distal mutations allow the use of
ethanolamine as a nitrogen source [Eut(N+
C
)] (Table 5); this might reflect position-dependent
variation in polarity effects. More support for this possibility came
from the finding that rho polarity suppressors corrected the
Eut(C
) phenotype of eutT nonsense mutations
(67) and that in-frame eutT deletions have no Eut
phenotype (see above).
phenotype in a cobA mutant strain
(54) which lacks the general cobalamin adenosyl transferase
(26, 61, 62). The eutT gene appears to encode a
second cobalamin adenosyl transferase, which converts CNB12
to AdoB12 (the lyase cofactor) (54). The
pdu operon of Salmonella also appears to encode
an adenosyl transferase (pduG) (1, 9, 66) which
is very similar in sequence to a demonstrated adenosyl transferase
(OrfZ) in the diol dehydratase operon of Citrobacter
(22, 52). Surprisingly, the amino acid sequence of the EutT
protein shows no similarity to that of the CobA adenosyl transferase
(20, 23, 61) or to that of the adenosyl transferase
PduG/OrfZ associated with diol dehydratase operons in
Salmonella and Citrobacter (9, 52).
Thus, it appears that three extremely different enzymes are able to
catalyze adenosylation of cobalamin
EutT, CobA, and PduG/OrfZ.
The eutD gene.
Some point mutations in the
eutD gene have a Eut(N
C
)
phenotype, and others are Eut(N+C
) (44,
45). Point mutations in this gene constituted a clear complementation group in the original genetic tests; they complemented mutants in all other genes and did not cause a measurable decrease in
the level of ethanolamine ammonia lyase or acetaldehyde dehydrogenase, encoded by distal genes (45). These point mutations were
assigned to an open reading frame by correlating map positions with the physical locations of insertion sites determined by PCR; their location
was confirmed by sequencing (Table 5). However the finding that all of
the eutD point mutations are nonsense types made it reasonable that their phenotype might have been due to polarity effects.
) (on minimal medium) even when
tetracycline is added to induce downstream genes, but tetracycline
restores the ability to produce acid, suggesting partial correction
(Table 6). Unfortunately, the only available
eutD::T-POP insertion is in the B orientation, which provides only weak induction of distal functions. These results
make it difficult to decide whether the phenotypes seen for
eutD mutations are due to polarity effects or an inherent lack of EutD function. However, the nonpolar deletion mutations (eutPQTD and eutDM), which remove both the
eutD gene and additional adjacent material, are
Eut+ aerobically. The simplest interpretation is that
eutD point mutations owe their phenotype to polarity effects
on multiple downstream genes and a simple EutD defect causes no aerobic phenotype.
The predicted EutD protein sequence is very similar to the C-terminal
half of Pta (phosphotransacetylase) and MeaB (NADP-dependent malate
oxidoreductase, or malic enzyme). The Pta enzyme catalyzes conversion
of acetyl-CoA to acetyl phosphate, and MeaB catalyzes the conversion of
malate to pyruvate with release of CO2.
The function of the domain shared by these three proteins is not known,
but we suspect that it may provide substrate specificity rather than
catalytic activity. Several malate oxidoreductases align only with the
N-terminal domains of Mez and Pta and share no similarity with EutD
protein (e.g., Streptococcus bovis [GenBank accession no.
U35659]); the substrate specificities of these single-domain proteins
are reportedly relaxed. Similarly, several malate-decarboxylating
enzymes, malic enzymes (which produce pyruvate), and malolactic enzymes
(which produce lactate) resemble the N-terminal domain of Pta but lack
the C-terminal domain that is homologous to the EutD sequence. Because
the two classes of homologues of Pta and Mez enzymes seem to have
catalytic domains which are not similar to EutD, we suspect that EutD
is not an independent catalyst but may serve as a subunit of a larger
complex, perhaps one involved in CO2 fixation.
The eutE and eutG genes (an aldehyde dehydrogenase and an alcohol dehydrogenase). The eutE gene was initially identified in mutants which could use ethanolamine as a source of nitrogen but not carbon (45). Direct assay revealed that these mutants lack acetaldehyde dehydrogenase, which converts acetaldehyde to acetyl-CoA (44). The gene was initially sequenced by Stojiljkovic et al. (60), who noted that the predicted amino acid sequence of the protein was strikingly similar to that of the aldehyde oxidoreductase domain of the AdhE family of alcohol dehydrogenases-aldehyde oxidoreductases. Sequencing of mutations in the eutE complementation group demonstrated that they affect this open reading frame. The EutE sequence most closely resembled that of NADP-dependent succinate-semialdehyde dehydrogenase of Clostridium kluyveri, which catalyzes formation of succinyl-CoA (59).
The EutG protein appears to be an alcohol dehydrogenase (aldehyde reductase) (60). The best BLAST alignment was with lactaldehyde reductase (1,2-propanediol oxidoreductase) of E. coli. The EutE and EutG sequences aligned in tandem without overlap along the E. coli AdhE sequence, with EutE resembling the C-terminal aldehyde oxidoreductase domain and EutG resembling the N-terminal alcohol dehydrogenase domain. The AdhE protein is known to catalyze reduction of acetyl-CoA to acetaldehyde and further to ethanol. We propose that the EutE and EutG proteins together catalyze the same reactions as AdhE. During growth on ethanolamine, EutE catalyzes formation of acetyl-CoA (as shown previously) and EutG may help to maintain redox balance by reducing some aldehyde to ethanol. Mutants of the eutG gene have no Eut phenotype under the conditions tested, presumably because NADH+ can be recycled via respiratory enzymes or other alcohol dehydrogenases (Fig. 1). In the eut operon, the tandem arrangement of the eutE and eutG genes is interrupted by the eutJ gene.The eutJ and eutA genes may encode chaperonins. The eutJ gene had no mutant phenotype. The inferred amino acid sequence of the EutJ protein showed similarity to that of members of the DnaK family of heat shock chaperonins (60). A comparison of the conserved cores of EutJ, EutA, and the E. coli DnaK protein is shown in Fig. 4.
|
C
) phenotype under aerobic conditions
with CNB12 and defined one of the original eut
complementation groups (45). These mutants became phenotypically Eut(N+ C
) when
AdoB12 was provided instead of CNB12. A
eutA mutant shows normal induction of the operon by
CNB12 or AdoB12, demonstrating that it is not
defective for cobalamin adenosylation (54). Recent results
suggest that EutA protects the lyase from inhibition by CNB12 (54). It is important to remember that
eutA mutants retain their Eut(C
) phenotype
even when AdoB12 is provided, suggesting that the protein
plays some additional role.
The EutA sequence is weakly related to the same group of proteins that
show similarity with EutJ (Table 2 and Fig. 4). A motif common to EutJ,
EutA, and the DnaK family proteins was the tract DIGGGT. This sequence
pattern is part of the nucleotide binding loop in the crystal structure
of DnaK protein (55).
The EutJ and EutA proteins may be important in assembling the
carboxysome or in refolding lyase. The adenosyl moiety of
AdoB12 is cleaved during catalysis (2) and may
be subject to occasional loss from the enzyme or destruction by
inappropriate reactions (65). Cobalamins without adenosine
bind strongly to the enzyme and inhibit its activity in vitro
(7). Replacement of damaged AdoB12 may require
removal by refolding lyase. The ability to remove inhibitory forms of
vitamin B12 from lyase may contribute to the ability of
EutA to protect lyase from inhibition. A function of this sort has been
reported for the vitamin B12-dependent enzyme propanediol dehydratase
(65).
The eutH gene encodes a membrane protein of unknown function. The eutH gene had no mutant phenotype. The deduced EutH amino acid sequence suggests 11 membrane-spanning segments capped at their ends with short tracts of polar residues. Although a role in ethanolamine transport has been suggested for the EutH protein (60), genetic data indicate that no ethanolamine transport functions are encoded within the operon (45). However, if sufficient ethanolamine enters cells by other means, this gene could encode a transporter with a very slight mutant phenotype. This is true for the propanediol diffusion facilitator PduF, which makes only a minimal contribution to the ability of cells to grow on that carbon source (18, 19). Unlinked mutations previously thought to affect ethanolamine transport have recently been shown to affect vitamin B12 uptake (41, 64). The EutH protein has no resemblance to a reported ethanolamine transporter, EutP, from Rhodococcus (GenBank accession no. U17129). Other possibilities are that the EutH protein increases uptake of vitamin B12 or facilitates efflux of acetaldehyde or acetate produced during ethanolamine catabolism.
The eutBC genes encode ethanolamine ammonia lyase. The assignment of ethanolamine ammonia lyase to the eutBC genes was initially based on enzyme assays of mutants for these two genes (44). The cloned sequence that complemented these two mutant types provided the first sequence for an ethanolamine ammonia lyase (27). The sequence data reported here contain several corrections of the originally reported sequence. Use of the improved sequence may help identify cobalamin binding motifs (38). The only other described homologue of lyase is from Rhodococcus (GenBank accession no. L24492), whose eutB and eutC homologues are adjacent but do not appear to be part of a larger operon.
The EutR protein is a positive regulatory protein of the AraC
family.
The eutR gene was identified in mutants with a
Eut
phenotype that were unable to induce the operon in
response to the regulatory effectors, ethanolamine and vitamin
B12 (45, 46). The EutR protein is encoded within
the operon and thus positively controls its own synthesis. This
autocatalytic cycle is essential for full operon induction. Coinduction
of lyase (EutBC) and EutR may serve to equalize their competition for a
small pool of AdoB12, allowing operon control to remain
sensitive to cofactor levels over a wide range of vitamin
B12 concentrations (53).
The region between the eut operon and the
hemF gene.
The region between the eut
operon and the hemF gene includes a sequence resembling a
Rho-independent transcription terminator located 519 bases from the end
of the eutR gene (Fig. 2 and Table 1). A heavily exploited
Mud-lac insertion mutant (eut-38::MudA) lies between the last gene in the operon (eutR) and this
proposed terminator (Table 3). Strains with this insertion are
phenotypically Eut+ but show
-galactosidase induction in
response to eut operon regulatory effectors (46).
This insertion lies within the transcribed region of the operon but
promoter distal to all structural genes.
The region upstream of the eut operon.
The 1,200 bases upstream of the first gene of the eut operon
(eutS) includes one of the six IS200 elements
found in the chromosome of S. typhimurium LT2 (32, 35,
48). The element is flanked by pairs of A residues, as seen in
other examples of IS200 insertions (31). Upstream
of the insertion sequence is the meaB gene, encoding NADP-dependent malic enzyme (malate
pyruvate) (39, 40). The meaB gene and the IS200 element are separated
by 42 bases. To the left of meaB are the genes
(tktB and talA) for transketolase and
transaldolase, enzymes which act in the pentose-phosphate shunt. They
form an apparent operon whose orientation is opposite to that of the
eut and meaB genes.
The eut operon has a main promoter and a minor internal
promoter.
The main regulated promoter (PI) is
activated by EutR when both ethanolamine and AdoB12 are
present and requires Crp protein as a global regulator (46).
A good potential
70 binding site was found 83 nucleotides before the start of the eutS gene. This lies
within a noncoding region well conserved between Salmonella
and E. coli. We assume, but have not yet demonstrated, that
the EutR regulator binds a site within this region to stimulate transcription. Although the operon is subject to catabolite repression (46), we have found no likely Crp-binding site in the
sequence in this region.
70 consensus is associated with PII.
Comparing the eut operons of S. typhimurium and E. coli. Initial biochemical work on ethanolamine degradation was done for E. coli, with little parallel genetic analysis. Both S. typhimurium and E. coli use the same degradative pathway, and both sets of enzymes are induced by the presence of ethanolamine plus vitamin B12 (6, 7, 33, 34). As diagrammed in Fig. 2, the E. coli operon sequence encodes close homologues of the 17 genes described above for Salmonella (8). The presence of a eut operon in E. coli is surprising in that E. coli does not make the needed vitamin B12 cofactor de novo (36, 37). Furthermore, E. coli cannot reduce tetrathionate, a process that seems essential for anaerobic ethanolamine degradation by Salmonella. For both organisms, the eut operon has a rather high G+C content, suggesting acquisition by horizontal transfer. However, the two sequences differ at only 17% of aligned positions, a degree of conservation expected for genes that have been inherited vertically from the common ancestor of Salmonella and E. coli. A surprising feature of the E. coli eut operon sequenced by Blattner and coworkers (8) is the presence of an insertion element between the eutA and eutB genes which does not damage either of the flanking genes (Fig. 2). This element is not found in other K-12 genomes (69).
| |
DISCUSSION |
|---|
|
|
|---|
The complete sequence of the eut operon includes 17 genes, of which only 6 are required for aerobic use of ethanolamine as a carbon or nitrogen source. The functions encoded by the extra genes
may be needed for ethanolamine use under unknown conditions, or they
may make a slight contribution that escaped our detection. We initially
expected that the extra genes would be required for anaerobic growth.
This has recently been tested, since it was found that wild-type
strains can grow anaerobically on ethanolamine if the electron acceptor
tetrathionate is provided (12). However, the extra
eut genes tested thus far are also nonessential for anaerobic growth with tetrathionate (28). It seems that the lack of mutant phenotypes for the extra genes is due to an alternative pathway for ethanolamine degradation that can supply some of the Eut
functions and prevent the detection of eut mutations in some genes. In the presence of mutations that appear to block this alternative pathway, all genes in the eut operon have a
Eut
phenotype aerobically and anaerobically
(28).
The five Eut proteins that are similar to carboxysome components suggest that the ethanolamine pathway may involve fixation of CO2. In photosynthetic bacteria (Synechococcus) and in sulfur oxidizers (Thiobacillus), this protein-bounded organelle is thought to concentrate CO2 and exclude O2; this supports activity of RUBISCO, the enzyme directly involved in CO2 fixation (14, 25, 29, 30, 56, 58). In Salmonella, structures resembling carboxysomes have recently been observed by electron microscope following induction of the pdu (9) or eut (21) operon, but fixation of CO2 has not yet been shown to accompany growth on ethanolamine.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported in part by NIH grant GM34804.
We thank Tom Fazzio and David Sheppard for helpful discussions and sharing unpublished results during the course of this work.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biology, University of Utah, Salt Lake City, UT 84112. Phone: (801) 581-6517. Fax: (801) 585-6207. E-mail: Roth{at}bioscience.utah.edu.
Present address: Department of Biology, University of California,
San Diego, La Jolla, CA 92093.
Present address: Department of Microbiology and Immunology, Emory
University, Atlanta, GA 30322.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Ailion, M., and J. R. Roth.
1996.
Repression of the cob operon of Salmonella typhimurium by adenosylcobalamin is influenced by mutations in the pdu operon.
J. Bacteriol.
179:6084-6091 |
| 2. |
Babior, B. M.,
T. J. Carty, and R. H. Abeles.
1974.
The mechanism of action of ethanolamine ammonia-lyase, a B12-dependent enzyme.
J. Biol. Chem.
249:1689-1695 |
| 3. |
Baker, S. H.,
S. Jin,
H. C. Aldrich,
G. T. Howard, and J. M. Shively.
1998.
Insertion mutation of the form I cbbL gene encoding ribulose bisphosphate carboxylase/oxygenase (RuBisCO) in Thiobacillus neapolitanus results in expression of form II RuBisCO, loss of carboxysomes, and an increased CO2 requirement for growth.
J. Bacteriol.
180:4133-4139 |
| 4. | Bender, J., and N. Kleckner. 1992. IS10 transposase mutations that specifically alter target site recognition. EMBO J. 11:741-750[Medline]. |
| 5. |
Berkowitz, D.,
J. M. Hushon,
H. J. Whitfield, Jr.,
J. R. Roth, and B. N. Ames.
1968.
Procedure for identifying nonsense mutations.
J. Bacteriol.
96:215-220 |
| 6. |
Blackwell, C. M.,
F. A. Scarlett, and J. M. Turner.
1977.
Microbial metabolism of amino alcohols: control of formation and stability of partially purified enthanolamine ammonia-lyase in Escherichia coli.
J. Gen. Microbiol.
98:133-139 |
| 7. | Blackwell, C. M., and J. M. Turner. 1978. Microbial metabolism of amino alcohols: purification and properties of coenzyme B12-dependent ethanolamine ammonia-lyase of Escherichia coli. Biochem. J. 175:555-563[Medline]. |
| 8. |
Blattner, F. R.,
G. R. Plunkett,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
V. J. Collado,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474 |
| 9. | Bobik, T. Personal communication. |
| 10. |
Bobik, T.,
Y. Xu,
R. Jeter,
K. Otto, and J. R. Roth.
1997.
Propanediol utilization genes (pdu) of Salmonella typhimurium: three genes for the propanediol dehydratase.
J. Bacteriol.
179:6633-6639 |
| 11. |
Bobik, T. A.,
M. Ailion, and J. R. Roth.
1992.
A single regulatory gene integrates control of vitamin B12 synthesis and propanediol degradation.
J. Bacteriol.
174:2253-2266 |
| 12. | Bobik, T. A., J. Tingey, and J. R. Roth. Unpublished data. |
| 13. |
Bradbeer, C.
1965.
The clostridial fermentations of choline and ethanolamine. I. Preparation and properties of cell-free extracts.
J. Biol. Chem.
240:4669-4674 |
| 14. |
Cannon, G. C.,
R. S. English, and J. M. Shively.
1991.
In situ assay of ribulose-1,5-bisphosphate carboxylase/oxygenase in Thiobacillus neapolitanus.
J. Bacteriol.
173:1565-1568 |
| 15. |
Casadaban, M. J., and S. N. Cohen.
1979.
Lactose genes fused to exogenous promoters in one step using a Mu-lac bacteriophage: in vivo probe for transcriptional control sequences.
Proc. Natl. Acad. Sci. USA
76:4530-4533 |
| 16. |
Castilho, B. A.,
P. Olfson, and M. J. Casadaban.
1984.
Plasmid insertion mutagenesis and lac gene fusion with mini-Mu bacteriophage transposons.
J. Bacteriol.
158:488-495 |
| 17. | Chan, R. K., D. Botstein, T. Watanabe, and Y. Ogata. 1972. Specialized transduction of tetracycline by phage P22 in Salmonella typhimurium. II. Properties of a high frequency transducing lysate. Virology 50:883-898[Medline]. |
| 18. |
Chen, P.,
D. I. Andersson, and J. R. Roth.
1994.
The control region of the pdu/cob regulon in Salmonella typhimurium.
J. Bacteriol.
176:5474-5482 |
| 19. | Chen, P., and J. R. Roth. Unpublished results. |
| 20. |
Crouzet, J.,
S. Levy-Schil,
B. Cameron,
L. Cauchois,
S. Rigault,
M.-C. Rouyez,
F. Blanche,
L. Debussche, and D. Thibaut.
1991.
Nucleotide sequence and genetic analysis of a 13.1-kilobase-pair Pseudomonas denitrificans DNA fragment containing five cob genes and identification of structural genes encoding cob(I)alamin adenosyltransferase, cobyric acid synthase, and bifunctional cobinamide kinase-cobinamide phosphate guanylyltransferase.
J. Bacteriol.
173:6074-6087 |
| 21. | Czymmek, K. Unpublished results. |
| 22. | Daniel, R., and G. Gottschalk. Personal communication. |
| 23. |
Debussche, L.,
M. Couder,
D. Thibaut,
B. Cameron,
J. Crouzet, and F. Blanche.
1991.
Purification and partial characterization of cob(I)alamin adenosyltransferase from Pseudomonas denitrificans.
J. Bacteriol.
173:6300-6302 |
| 24. | Devereux, J. 1989. Profile analysis: associating distantly related proteins and finding structural motifs, p. 7.3-7.5. In J. Devereux (ed.), Program manual: sequence analysis software package. Genetics Computer Group, Madison, Wis. |
| 25. | English, R. S., S. C. Lorbach, X. Qin, and J. M. Shively. 1994. Isolation and characterization of a carboxysome shell gene from Thiobacillus neapolitanus. Mol. Microbiol. 12:647-654[Medline]. |
| 26. |
Escalante-Semerena, J. C.,
S.-J. Suh, and J. R. Roth.
1990.
cobA function is required for both de novo cobalamin biosynthesis and assimilation of exogenous corrinoids in Salmonella typhimurium.
J. Bacteriol.
172:273-280 |
| 27. |
Faust, L. P.,
J. A. Connor,
D. M. Roof,
J. A. Hoch, and B. M. Babior.
1990.
Cloning, sequencing and expression of the genes encoding the adenosylcobalamin-dependent ethanolamine ammonia-lyase of Salmonella typhimurium.
J. Biol. Chem.
265:12462-12466 |
| 28. | Fazzio, T. Unpublished results. |
| 29. | Friedberg, D., K. M. Jager, M. Kessel, N. J. Silman, and B. Bergman. 1993. Rubisco but not Rubisco activase is clustered in the carboxysomes of the cyanobacterium Synechococcus sp. PCC 7942: Mud-induced carboxysomeless mutants. Mol. Microbiol. 9:1193-1201[Medline]. |
| 30. |
Friedberg, D.,
A. Kaplan,
R. Ariel,
M. Kessel, and J. Seijffers.
1989.
The 5'-flanking region of the gene encoding the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase is crucial for growth of the cyanobacterium Synechococcus sp. strain PCC 7942 at the level of CO2 in air.
J. Bacteriol.
171:6069-6076 |
| 31. | Haack, K., and J. Roth. Unpublished. |
| 32. | Haack, K., and J. R. Roth. 1995. Recombination between chromosomal IS200 elements supports frequent duplication formation in Salmonella typhimurium. Genetics 141:1245-1252[Abstract]. |
| 33. |
Jones, P. W., and J. M. Turner.
1984.
Interrelationships between the enzymes of ethanolamine metabolism in Escherichia coli.
J. Gen. Microbiol.
130:299-308 |
| 34. |
Jones, P. W., and J. M. Turner.
1984.
A model for common control of enzymes of ethanolamine metabolism in Escherichia coli.
J. Gen. Microbiol.
130:849-860 |
| 35. |
Lam, S., and J. R. Roth.
1983.
Genetic mapping of insertion sequence IS200 copies in Salmonella typhimurium strain LT2.
Genetics
105:801-812 |
| 36. |
Lawrence, J. G., and J. R. Roth.
1995.
The cobalamin (coenzyme B12) biosynthetic genes of Escherichia coli.
J. Bacteriol.
177:6371-6380 |
| 37. | Lawrence, J. G., and J. R. Roth. 1995. Evolution of coenzyme B12 synthesis among enteric bacteria: evidence for loss and reacquisition of a multigene complex. Genetics 142:11-24[Abstract]. |
| 38. | Ludwig, M., and R. Matthews. 1997. Structure-based perspectives on B12-dependent enzymes. Annu. Rev. Biochem. 66:269-313[Medline]. |
| 39. | Murai, T., M. Tokushige, J. Nagai, and H. Katsuki. 1971. Physiological functions of NAD- and NADP-linked malic enzymes in Escherichia coli. Biochem. Biophys. Res. Commun. 43:875-881[Medline]. |
| 40. |
Murai, T.,
M. Tokushige,
J. Nagai, and H. Katsuki.
1972.
Studies on regulatory functions of malic enzymes. I. Metabolic functions of NAD- and NADP-linked malic enzymes in Escherichia coli.
J. Biochem. (Tokyo).
71:1015-1028 |
| 40a. |
Oppenheim, D. S., and C. Yanofsky.
1980.
Translational coupling during expression of the tryptophan operon of Escherichia coli.
Genetics
95:785-795 |
| 41. |
O'Toole, G. A., and J. C. Escalante-Semerena.
1991.
Identification and initial characterization of the eutF locus of Salmonella typhimurium.
J. Bacteriol.
173:5168-5172 |
| 42. |
Rappleye, C. A., and J. R. Roth.
1997.
A Tn10 derivative ("T-POP") for isolation of insertions A Tn10 derivative ("T-POP") for isolation of insertions with conditional (tetracycline-dependent) phenotypes.
J. Bacteriol.
179:5827-5834 |
| 43. |
Ratzkin, B., and J. Roth.
1978.
Cluster of genes controlling proline degradation in Salmonella typhimurium.
J. Bacteriol.
133:744-754 |
| 44. |
Roof, D. M., and J. R. Roth.
1988.
Ethanolamine utilization in Salmonella typhimurium.
J. Bacteriol.
170:3855-3863 |
| 45. |
Roof, D. M., and J. R. Roth.
1989.
Functions required for vitamin B12-dependent ethanolamine utilization in Salmonella typhimurium.
J. Bacteriol.
171:3316-3323 |
| 46. |
Roof, D. M., and J. R. Roth.
1992.
Autogenous regulation of ethanolamine utilization by a transcriptional activator of the eut operon in Salmonella typhimurium.
J. Bacteriol.
174:6634-6643 |
| 47. | Roth, J. R., J. G. Lawrence, and T. A. Bobik. 1996. Cobalamin (coenzyme B12): synthesis and biological significance. Annu. Rev. Microbiol. 50:137-181[Medline]. |
| 48. |
Sanderson, K. E.,
P. Sciore,
S. Liu, and A. Hessel.
1993.
Location of IS200 on the genomic map of Salmonella typhimurium LT2.
J. Bacteriol.
175:7624-7628 |
| 49. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 50. |
Scarlett, F. A., and J. M. Turner.
1976.
Microbial metabolism of amino alcohols. Ethanolamine catabolism mediated by coenzyme B12-dependent ethanolamine ammonia-lyase in Escherichia coli and Klebsiella aerogenes.
J. Gen. Microbiol.
95:173-176 |
| 51. | Schmieger, H. 1971. A method for detection of phage mutants with altered transducing ability. Mol. Gen. Genet. 110:378-381[Medline]. |
| 52. |
Seyfried, M.,
R. Daniel, and G. Gottschalk.
1996.
Cloning, sequencing, and overexpression of the genes encoding coenzyme B12-dependent glycerol dehydratase of Citrobacter freundii.
J. Bacteriol.
178:5793-5796 |
| 52a. |
Sharp, P. M., and W. H. Li.
1987.
The codon adaptation index a measure of directional synonymous codon usage bias, and its potential applications.
Nucleic Acids Res.
15:1281-1295 |
| 53. |
Sheppard, D. E., and J. R. Roth.
1994.
A rationale for autoinduction of a transcriptional activator: ethanolamine ammonia-lyase (EutBC) and the operon activator (EutR) compete for adenosyl-cobalamin in Salmonella typhimurium.
J. Bacteriol.
176:1287-1296 |
| 54. | Sheppard, D. E., and J. R. Roth. Vitamin B12 adenosylation functions in the eut operon of Salmonella typhimurium. Submitted for publication. |
| 55. | Sheppard, P. Personal communication. |
| 55a. | Shields, D. C., P. M. Sharp, D. G. Higgins, and F. Wright. 1998. "Silent" sites in Drosophila genes are not neutral: evidence of selection among synonymous codons. Mol. Biol. Evol. 5:704-716[Abstract]. |
| 56. | Shively, J. M. 1974. Inclusion bodies of prokaryotes. Annu. Rev. Microbiol. 28:167-187[Medline]. |
| 57. |
Shively, J. M.,
F. Ball,
D. H. Brown, and R. E. Saunders.
1973.
Functional organelles in prokaryotes: polyhedral inclusions (carboxysomes) of Thiobacillus neapolitanus.
Science
182:584-586 |
| 58. |
Shively, J. M.,
E. Bock,
K. Westphal, and G. C. Cannon.
1977.
Icosahedral inclusions (carboxysomes) of Nitrobacter agilis.
J. Bacteriol.
132:673-675 |
| 59. |
Sohling, B., and G. Gottschalk.
1996.
Molecular analysis of the anaerobic succinate degradation pathway in Clostridium kluyveri.
J. Bacteriol.
178:871-880 |
| 60. |
Stojiljkovic, I.,
A. J. Bäumler, and F. Heffron.
1995.
Ethanolamine utilization in Salmonella typhimurium: nucleotide sequence, protein expression, and mutational analysis of the cchA cchB eutJ eutG eutH gene cluster.
J. Bacteriol.
177:1357-1366 |
| 61. | Suh, S.-J., and J. C. Escalante-Semerena. 1993. Cloning, sequencing and overexpression of cobA, which encodes ATP:corrinoid adenosyltransferase in Salmonella typhimurium. Gene 129:93-97[Medline]. |
| 62. |
Suh, S.-J., and J. C. Escalante-Semerena.
1995.
Purification and initial characterization of the ATP:corrinoid adenosyltransferase encoded by the cobA gene of Salmonella typhimurium.
J. Bacteriol.
177:921-925 |
| 63. |
Takiff, H. E.,
T. Baker,
T. Copeland,
S. Chen, and D. L. Court.
1992.
Locating essential Escherichia coli genes by using mini-Tn10 transposons: the pdxJ operon.
J. Bacteriol.
174:1544-1553 |
| 64. |
Thomas, M. G.,
G. A. O'Toole, and J. C. Escalante-Semerena.
1999.
Molecular characterization of eutF mutants of Salmonella typhimurium LT2 identifies eutF lesions as partial-loss-of-function tonB alleles.
J. Bacteriol.
181:368-374 |
| 65. |
Toraya, T., and K. Mori.
1999.
A reactivating factor for coenzyme B12-dependent diol dehydratase.
J. Biol. Chem.
274:3372-3377 |
| 66. |
Walter, D.,
M. Ailion, and J. R. Roth.
1996.
Genetic characterization of the pdu operon: use of 1,2 propanediol in Salmonella typhimurium.
J. Bacteriol.
179:1013-1022 |
| 67. | Warnick, L. Unpublished results. |
| 68. | Way, J. C., M. A. Davis, D. Morisato, D. E. Roberts, and N. Kleckner. 1984. New Tn10 derivatives for transposon mutagenesis and for construction of lacZ operon fusions by transposition. Gene 32:369-379[Medline]. |
| 69. | Yamamoto, Y., H. Aiba, T. Baba, K. Hayashi, T. Inada, K. Isono, T. Itoh, S. Kimura, M. Kitagawa, K. Makino, T. Miki, N. Mitsuhashi, K. Mizobuchi, H. Mori, S. Nakade, Y. Nakamura, H. Nashimoto, T. Oshima, S. Oyama, N. Saito, G. Sampei, Y. Satoh, S. Sivasundaram, H. Tagami, H. Takahashi, J. Takeda, K. Takemoto, K. Uehara, C. Wada, S. Yamagata, and T. Horiuchi. 1997. Construction of a contiguous 874 kb sequence of the Escherichia coli K-12 genome corresponding to 50.0-68.8 min region on the linkage map and analysis of its sequence features. DNA Res. 4:91-113[Abstract]. |
| 70. |
Youdarian, P.,
P. Sugiono,
K. L. Brewer,
N. P. Higgins, and T. Elliot.
1988.
Packaging specific segments of the Salmonella chromosome with locked-in Mud-P22 prophages.
Genetics
118:581-592 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»