Previous Article | Next Article 
Journal of Bacteriology, September 1999, p. 5402-5408, Vol. 181, No. 17
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Roles of RuvC and RecG in Phage
Red-Mediated Recombination
Anthony R.
Poteete,*
Anita C.
Fenton, and
Kenan C.
Murphy
Department of Molecular Genetics & Microbiology, University of Massachusetts Medical School,
Worcester, Massachusetts 01655
Received 22 March 1999/Accepted 30 May 1999
 |
ABSTRACT |
The recombination properties of Escherichia coli
strains expressing the red genes of bacteriophage
and
lacking recBCD function either by mutation or by expression
of
gam were examined. The substrates for recombination
were nonreplicating
chromosomes, introduced by infection;
Red-mediated recombination was initiated by a double-strand break
created by the action of a restriction endonuclease in the infected
cell. In one type of experiment, two phages marked with restriction
site polymorphisms were crossed. Efficient formation of recombinant DNA
molecules was observed in ruvC+
recG+, ruvC recG+,
ruvC+ recG, and ruvC recG hosts. In
a second type of experiment, a 1-kb nonhomology was inserted between
the double-strand break and the donor chromosome's restriction site
marker. In this case, recombinant formation was found to be partially
dependent upon ruvC function, especially in a
recG mutant background. In a third type of experiment, the
recombining partners were the host cell chromosome and a 4-kb linear
DNA fragment containing the cat gene, with flanking
lac sequences, released from the infecting phage chromosome
by restriction enzyme cleavage in the cell; the formation of
chloramphenicol-resistant bacterial progeny was measured. Dependence on
RuvC varied considerably among the three types of cross. However, in
all cases, the frequency of Red-mediated recombination was higher in
recG than in recG+. These
observations favor models in which RecG tends to push invading 3'-ended
strands back out of recombination intermediates.
 |
INTRODUCTION |
As many as 15 to 20 proteins are
thought to be directly involved in homologous recombination in
Escherichia coli (for reviews, see references
19 and 23). The biochemical
activities of most of these proteins have been extensively
characterized. Even so, it is difficult to specify the precise roles of
most of the recombination proteins. One main reason for the difficulty
is that only one of the known proteins, RecA, is strictly required for
recombination to take place. Certain recombination events, involving
strand annealing rather than strand invasion, can take place in a
recA null mutant, but these require
bacteriophage-encoded recombination functions (36).
The nearly complete deficiency of recA mutants, blocked at
an early step in recombination (5), combined with extensive
biochemical characterization of RecA protein have yielded a relatively
clear description of RecA's role in recombination: synapsis and strand
invasion (for a review, see reference 32.
Several of the recombination proteins of E. coli are
helicases. Recombinant formation following conjugation or generalized transduction depends upon one of the helicases, the RecBCD protein, which is also a complex nuclease. In the absence of RecBCD, efficient recombination can take place if the sbcB gene, as well as
the sbcC or sbcD gene, encoding other nucleases,
is mutated. In this setting, recombination depends upon several
helicases, including RecG, RecQ, and RuvAB (19). Another
helicase, PriA, is important for recombination in otherwise-wild-type
cells (18, 33).
One recombination protein, RuvC, is a junction-specific endonuclease
that has the properties expected of a Holliday junction resolvase
(8). Recombination in wild-type E. coli is not
highly dependent upon RuvC, though, suggesting either that there is
another resolvase or that cutting a Holliday junction is only one of
two or more pathways to the production of recombinants. The latter explanation appears to be the case: Lloyd (21) found that
recombination in a ruvC mutant is dependent on RecG, and
biochemical studies of RecG protein have uncovered helicase but not
endonuclease activity (24). Rather, Whitby and coworkers
(38, 39) have proposed that RecG helicase can process
three-stranded junctions in such a way as to generate recombinants
without endonucleolytic resolution of a Holliday junction.
The bacteriophage
homologous recombination system, known as Red,
normally promotes highly efficient double-strand break repair and
recombination transiently in
-infected E. coli. The Red-induced "hyper-rec" state of E. coli can be made
permanent if the
recombination proteins are expressed in the cell
in the absence of infecting phage (29, 31). In addition to
operating at higher efficiency than other homologous recombination
pathways in E. coli, Red-mediated recombination is possibly
simpler in its early steps (diagrammed in Fig.
1). The
Gam protein shuts down all
the enzymatic activities of RecBCD (16, 28). Double-stranded ends initiate Red-mediated recombination (35, 37). The
exonuclease (Red
) loads onto double-stranded ends and processively
degrades the 5'-ended strand, leaving a 3' single-stranded tail
(20). RecA and
Red
protein then cooperate in
promoting invasion of the 3'-ended strand into an unbroken homologous
duplex (17, 27, 31). (Red
can promote recombination by
strand annealing in the absence of RecA protein, but only if a partner
with a double-stranded end at a nonallelic site is provided
[36].) In the absence of RecBCD, the only
proteins
required for efficient double-strand break repair and recombination are
Red
and Red
; host proteins carry out all other steps.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
Possible mechanism of Red-mediated recombination
involving strand invasion. The steps, and the roles of the
recombination proteins, are described in the text.
|
|
An E. coli strain containing
recombination proteins
provides an experimental setting in which recombination between
nonreplicating
phages occurs at high frequency at the site of a
double-strand break (37). Formation of recombinants between
physically marked chromosomes can be monitored directly by extraction
and analysis of DNA from infected cells. It depends upon (i)
double-strand breaks, (ii) RecA, (iii) Red proteins, and (iv)
inactivation of RecBCD, either by mutation or by
Gam protein
(31).
In this study, we examined the properties of Red-expressing E. coli bearing mutations in ruvC and recG,
singly and in combination. We found that the dependence of Red-mediated
recombination on RuvC was variable among the different types of crosses
tested. Red-mediated recombination is more efficient in a
recG mutant than in a recG+ strain,
in contrast to recombination via other pathways (RecBCD, RecF, or
RecE), which is reduced in recG mutant (22).
However, as in wild-type E. coli, this Red-mediated
recombination was, in most cases, highly dependent upon RuvC in the
recG mutant. These observations distinguish between models
that have been proposed for the roles of RuvC and RecG in recombination
(38, 39).
 |
MATERIALS AND METHODS |
Bacteria.
Except as noted, all bacterial strains used in
this study were derivatives of E. coli AB1157 (argE3
his-4 leuB6 proA2 thr-1 ara-14 galK2 lacY1 mtl-1 xyl-5 thi-1 rpsL31
tsx-33 supE44); it and JC15329
[
(srlR-recA)306::Tn10]
were obtained from A. J. Clark. Strains CS85
(eda-51::Tn10 ruvC53) (34)
and N2731 (recG258::kan) (22) were obtained from F. W. Stahl. Strain CS85 was
reconstructed by transduction of AB1157 with a P1 lysate grown on
strain CS85, with selection for tetracycline resistance. A
tetracycline-sensitive derivative, TP438, was subsequently selected on
the basis of fusaric acid resistance (26). TP440
(ruvC53 recG258::kan) was constructed by transduction of TP438 with a P1 lysate grown on N2731, with selection for kanamycin resistance. Phage recombination functions and
the EcoRI restriction-modification system were introduced into these
strains by simultaneous transformation with plasmids pTP223 and pMB4,
as described previously (31).
Strain KM22,
(recC ptr recB
recD)::Plac-bet-exo kan, has been
described previously (29). KM32,
(recC ptr recB
recD)::Ptac-gam-bet-exo cat, was
constructed similarly.
Strain TP507, in which the recC, ptr,
recB, and recD genes are replaced by a cassette
consisting of Ptac-gam-bet-exo, the PaeR7 restriction-modification system, and
Plac-cI, was constructed by crossing KM22 with a
linear DNA fragment as described previously (29).
Recombinants were selected on the basis of their immunity to
infection. The linear fragment was generated by digestion with
NdeI and BamHI of plasmid pTP822, which was
constructed from a series of intermediates as follows. (i) Plasmid
pTP800 was made by ligation of a polycloning site, consisting of the
partially complementary oligonucleotides
AATTGGGCCCAGATCTCCATGGCCGCGGTCTAGAGCTC and
AATTGAGCTCTAGACCGCGGCCATGGAGATCTGGGCCC, into the
EcoRI site of pKM125 (29). One isolate, in which
the orientation of the inserted sequence was
thyA-ApaI-BglII-NcoI-SacII-XbaI-SacI-argA (see Fig. 4), was selected. (ii) The source of the
Ptac-gam-bet-exo sequence was plasmid pTP234
(Ptac-gam-bet-exo operon fusion inserted into the
EcoRI site of pBR322, containing
sequences from the SalI site immediately upstream from gam to the
AccI site immediately downstream from exo), which
served as a template for PCR with oligonucleotides
GACATAAGATCTCCGACATCATAACGGTTCTGGCAA and
GACATAAGATCTTTGCGCCTACCCGGATATTATCGT. The resulting 2.1-kb
fragment was digested with BglII and ligated into the
BglII site of pTP800. One isolate, in which the orientation of the inserted sequence is such that the
red genes are
transcribed in the direction thyA-argA, was selected and
designated pTP806. (iii) The source of the PaeR7
restriction-modification system (pae) was plasmid pAORM3.8
(12), which served as a template for PCR with
oligonucleotides ACAATTCCATGGGCCGATGATTTAGTGAGGTCGTCA and
ACAATTTCTAGACCTCCAAGCCCGAATGATCGAGAA. The resulting 2.5-kb fragment was digested with NcoI and XbaI and
ligated between the corresponding sites in pTP806, generating plasmid
pTP808. (iv) The source of Plac-cI was plasmid
pKB280 (4), which served as a template for PCR with
oligonucleotides AGTTGCTCTAGAACTCATTAGGCACCCCAGGCTTTA and
AGTTGCTCTAGATTATCAGCTATGCGCCGACCAGAA. The resulting 0.9-kb fragment was digested with XbaI and ligated into the
XbaI site of pTP808. One isolate, in which the orientation
of the inserted sequence is such that the
cI gene is
transcribed in the direction thyA-argA, was selected and
designated pTP810. (v) An ApaI-SacI fragment from
pTP810 containing Ptac-gam-bet-exo pae
Plac-cI was inserted between the ApaI and
SacI sites in pKM145-6 to generate pTP822. pKM145-6 is
similar in structure to pKM125 but has no antibiotic resistance
determinant between the recBCD-flanking sequences
(29a).
The chromosomal Ptac-gam-bet-exo pae
Plac-cI operon of strain TP507 represses expression of
lacZ from the PL promoter of an infecting
phage at least 1,000-fold and restricts the efficiency of plaque
formation by PaeR7-unmodified
imm P22 h80
approximately 104- to 105-fold (data not
shown). Although the
recombination and repressor genes in the
substitution are nominally under the control of the wild-type
lacI gene of this strain, effective expression is seen even
in the absence of inducer. Derivatives of TP507 bearing rec and ruv mutations were constructed by P1 transduction, with
selection for antibiotic resistance. Donor strains were as listed above.
Phages.
wild type and
nin5 were obtained
from F. W. Stahl.
sR1° RFLP381 sR3° sR4°
sR5° and sR1° RFLP382 sR3° sR4° sR5°,
referred to below as
RFLP381 and
RFLP382, have been described
previously (31). Additional RFLP substitutions were crossed
into the
chromosome as described previously (31);
recombinants were selected as described or on the basis of plaque
formation on a phage P2 lysogen (Spi
phenotype) and were
given the numerical designations of their plasmid parents (e.g.,
RFLP835 was made by crossing
wild type with plasmid pTP835). Phages
were propagated in a
(recC ptr recB recD)::Ptac-bet-exo cat
derivative of W3110 strA594 lac gal, which was constructed
by P1 transduction with KM32 as the donor and selection for
chloramphenicol resistance.
New substitution sequences were assembled by making a variety of
derivatives of plasmid pTP368 (31). This plasmid contains
sequences from 21,226 to 23,130 and 33,498 to 34,499; sequences cloned between the
segments, on recombination with phage, replace
sequences normally between them. The intermediate plasmids were made as follows. For pTP812, the cat gene from pCDK3
(9) was amplified by PCR with oligonucleotides
ATCATCGCTAGCATGAGAACGTTGATCGGCACGTAAG and
ATCATCGGTACCGGGCCCGACCGGGTCGAATTTGCTTTCGAA. The resulting 0.9-kb fragment was digested with KpnI and NheI
and ligated between the KpnI and NheI sites in
pTP368. pTP813 was constructed by conversion of the XhoI
site of pTP368 to an ApaI site by insertion of an oligonucleotide, TCGATCGGGCCCGA. For pTP815, the
XhoI site in pTP812 was eliminated by digestion with
XhoI, filling in the ends with DNA polymerase and
deoxynucleoside triphosphates, and ligating. pTP816 was constructed by
conversion of the AflII site in pTP815 to a PaeR7
(XhoI) site by substitution of a corresponding segment, bounded by NheI and SacI sites, from pTP817.
pTP817 was constructed by conversion of the AflII site in
pTP813 to a PaeR7 (XhoI) site by insertion of an
oligonucleotide, TTAACGCCTCGAGGCG. pTP835 and pTP836 were
constructed by conversion of the ApaI sites of pTP816 and
pTP817 to BglII sites by insertion of an oligonucleotide, GCAGATCTGCGGCC. For pTP863 and pTP864, the PaeR7
(XhoI) sites of pTP835 and pTP836, respectively, were
eliminated by digestion with XhoI, filling in the ends with
DNA polymerase and deoxynucleoside triphosphates, and ligating with a
HindIII linker (CAAGCTTG).
Derivatives of
designed to monitor recombination events with
the cell chromosome were constructed as described above. Two plasmid
intermediates were involved. pTP818 was constructed by conversion of
the AflII site in pTP368 to a PaeR7
(XhoI) site by insertion of an oligonucleotide,
TTAACGCCTCGAGGCG. For pTP819, sequences between the two
XhoI sites of pTP818 were replaced by a segment in which the
cat gene is flanked by lac sequences, assembled from three PCR-generated parts: (i) lacZ sequences amplified
from E. coli AB1157 DNA with primers
GACGCACTCGAGGCGTTAACCGTCACGA and CTCCAGTGGCCGGCGATGATGCAGCGGCGTCAGCAGTTGTT; (ii)
cat sequences amplified from DNA from an E. coli
strain bearing transposon Tn9 with primers
ATCATCGCCGGCCACTGGAGCACCTCAAAAACACCA and
TCATCAGGGCCCGACCGGGTCGAATTTGCTTTCGAA; and (iii)
lacZ and lacY sequences amplified from E. coli AB1157 DNA with primers
ACCCGGTCGGGCCCTGATGACCCGTGCACCGCTGGATAACG and GACGCACTCGAGGCACACAGCGCCCAG. Parts i and ii and parts ii and
iii were joined in pairs by PCR, making use of the overlaps of their primer sequences, and subcloned in intermediate plasmids via their XhoI and NgoM1 and their ApaI and
XhoI ends, respectively. The two subassemblies were
recombined in vitro by cutting and joining at the NcoI site
in cat. This construction makes use of two sites in the
E. coli lac operon that differ by 1 bp from PaeR7
sites, in such a way that when the
lac::cat819 segment is cut from the phage that bears it, the ends of the resulting DNA fragment match the
cell chromosome exactly.
Crosses.
Bacterial host strains were cultured and infected
with parent phages at a multiplicity of seven each as described
previously (31). When plasmid-bearing strains were used as
hosts, retention of the plasmid pMB4 bearing the EcoRI
restriction-modification system was measured as described previously
(31); in cases in which less than 85% of the cells retained
pMB4, the experiment was discontinued.
Phage DNA was extracted from 10-ml samples of
RFLP-infected cell
cultures by the use of lysozyme and a phenol-chloroform-isoamyl alcohol
mixture as described previously (31); in later experiments, phenol was substituted for the phenol-chloroform-isoamyl alcohol mixture. DNA samples (10% of the total) were digested overnight at
37°C with 15 U of BglII and 2.5 U of RNase A and then
subjected to electrophoresis in 0.7% agarose gels and transferred by
capillary flow to Zeta-Probe (Bio-Rad) membranes. In experiments with
RFLP381 and
RFLP382, blots were probed with
32P-labeled RNA as described previously (31). In
experiments with other
RFLP phages, the prehybridization mixture
was composed of 1 mM EDTA, 0.5 M sodium phosphate buffer [pH 7.2],
7% sodium dodecyl sulfate, and 200 µg of yeast RNA (baker's yeast
RNA, type III; Sigma). Following 30 min of prehybridization at 60°C,
32P-labeled cat gene probe (107 cpm)
was added. Following incubation at 60°C overnight, the filters were
washed and processed as described previously (31).
The cat gene probe was generated as follows. Plasmid pTP801
(made by cloning the cat gene, in the form of a DNA fragment
generated by PCR with oligonucleotide primers
CGGGATCCCGTGAGACGTTGATCGGCACGTAAGA and
CGGGATCCCGGACCGGGTCGAATTTGCTTTCGAA, into the
BamHI site of pUC19) was cut with BamHI to
generate a 0.9-kb fragment, which was purified by electrophoresis in a
0.7% agarose gel. The 0.9-kb band was removed, and the DNA was
extracted by centrifugation of the gel slice through an Easy Clean
agarose gel DNA extraction filter (Primm Labs). Approximately 25 ng of
the purified DNA was denatured by boiling it for 10 min and then placed
on ice and added to a random priming reaction mixture containing 3 µl
of a mixture of 0.167 mM (each) dATP, dGTP, and TTP (50 µCi of
[
32P]dCTP; 3,000 Ci/mmol), 5 U of Klenow polymerase,
and 2 µl of Boehringer Mannheim hexanucleotide mix (10×
concentration) in a total volume of 20 µl. After incubation at 37°C
for 30 min, the reaction mixture was extracted twice with phenol and
then once with ether, and DNA was precipitated twice with ethanol and then redissolved in 100 µl of water and boiled for 10 min before being added to the membranes.
Autoradiographs were scanned in a Molecular Dynamics Personal
Densitometer SI. Quantitation of bands was done by the use of ImageQuant software on an Apple computer.
In crosses between
lac::cat819 and
bacterial hosts, the bacteria were cultured and infected with phage as
described previously (31). The multiplicity of infection was
5, except as noted. After 1 h at 37°C, the infected cells were
titered on Luria-Bertani agar plates and on Luria-Bertani agar plates
supplemented with chloramphenicol (20 µg/ml),
isopropylthiogalactopyranoside (250 µg/ml), and X-Gal
(5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside) (133 µg/ml) for detection of recombinants.
 |
RESULTS |
Red-mediated recombination independent of RuvC and RecG.
Genetic and biochemical studies of recombination in E. coli,
summarized in the introduction, suggest that a recG ruvC
double mutant, which is highly defective in recombination, is
specifically blocked at the resolution step. A prediction that follows
from this idea is that unresolved recombination intermediates might accumulate in replication-blocked crosses between
phages in a
recG ruvC double mutant. To test this, we constructed
single- and double-mutant strains bearing plasmids that express
red genes,
cI repressor, and the
EcoRI restriction-modification system. The somewhat
surprising result of phage crosses in these strains (Fig.
2) was that the frequency of
recombination relative to that in the wild type was increased by
mutation of recG and only slightly affected by mutation of
ruvC, either alone or in combination with recG.
In seeking to understand this lack of dependence on either RuvC or
RecG, we considered and tested a number of possible explanations.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Recombination (Rec.) between nonreplicating chromosomes, one of which has a double-strand break. The phages, RFLP381 (381) and RFLP382 (382), bear a substitution that replaces
genes between orf194 and ssb with unrelated
sequences; the ends of the substitution are marked with different
restriction sites: B, BglII, and X, XbaI. The
host cells bear two plasmids: pTP223, which expresses genes
cI, gam, red , and
red , and pMB4, which encodes the EcoRI
restriction-modification system. The phages each have a single
EcoRI restriction site in the substitution sequence; in the
case of RFLP382, it was made uncuttable by prior passage through an
EcoRI-modifying host. DNA was extracted from infected cells
60 min after infection, digested with BglII, and analyzed on
Southern gels. Parental and recombinant bands from three experiments
were quantitated; the means and standard errors are indicated.
|
|
One explanation for the recombination proficiency of the ruvC
recG double mutant might be that the strain had acquired a
suppressing mutation. The rusA mutation described by Mahdi
et al. (25), in particular, activates a RuvC-like resolvase
encoded by a cryptic prophage. However, tests (data not shown) of the
ruvC recG strain showed that it is as
recombination-deficient in conjugative crosses and transduction, and as
UV sensitive, as the original strain described by Lloyd
(21).
Another explanation for the high frequency of Red-mediated
recombination might be that the phages themselves express a resolving function. The most likely candidate for such a function would be the
rap gene in the
nin region (15),
which Mahdi et al. (25) have proposed to be a Holliday
junction resolvase. This explanation is unlikely for two reasons: (i)
the crosses are carried out in host cells that overexpress
repressor from a plasmid, so few
genes (none from the
nin region) should be transcribed, and (ii) in redesigning
the tester phages (see below), we have deleted the nin
region and still detected efficient recombination in the ruvC
recG mutant host.
The explanation we consider most likely is that the process observed in
the
crosses does not necessarily involve simple break-join
recombination but rather can proceed via branch migration and
heteroduplex formation, as diagrammed in Fig.
3a. A control experiment showed that
mismatch repair would necessarily be involved in this alternative
pathway. We constructed mismatched heteroduplexes with the structure
that would be produced in an event of the type pictured above and found
that they could not be digested with the restriction enzyme
(BglII) used to characterize phage chromosomes extracted
from the infected cells (data not shown); therefore, branch migration
alone cannot account for the apparent recombination. We then attempted
to test the role of mismatch repair genetically. A ruvC recG
mutS triple mutant was constructed and transformed with Red,
cI, and EcoRI-expressing plasmids. However, the
resulting strain grew poorly, particularly in liquid culture, and the
phage crosses could not be carried out.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
(a) Possible mechanism of recombinant formation via the
Red pathway, independent of RuvC and RecG. The first steps (not shown)
would be the same as in Fig. 1. Branch migration, possibly
directionally biased due to the absence of RecG, leads to heteroduplex
formation at the site of marker B. Mismatch repair then converts the
heteroduplex to a homoduplex, bypassing the need for endonucleolytic
processing of a Holliday junction. On the right side, endonucleolytic
cleavage and trimming of the displaced strand or, possibly, extension
of the invading 3' end would produce a structure that would be counted
as a recombinant following extraction, digestion with BglII,
and analysis on a Southern gel. (b) A heterologous sequence inserted
between the invading end and the marker B is predicted to block the
pathway shown in panel a, making recombination more dependent upon RuvC
and/or RecG.
|
|
The alternative, branch migration-heteroduplex formation-mismatch
repair pathway to recombinant formation could in principle be blocked
by insertion of a heterologous sequence between the double-strand break
and the marker used to score recombination (a restriction site, in this
case), as pictured in Fig. 3b. Recombination might then be channeled
through a resolvase-requiring pathway.
Redesign of phages and hosts for detection of resolvase-dependent
recombination events.
For reasons described above, we constructed
new variants of the
RFLP phages (see Fig. 5 [top]). The
sequences replaced by the new RFLP substitutions are the same as in the
previous versions, but three main changes were made. (i) In the new
phages, the leftmost 1 kb of sequence in the substitution is either the same as before or has been replaced by a heterologous sequence, the
cat gene of transposon Tn9. (ii) A unique
PaeR7 restriction site has been introduced near the middle
of the 5-kb substitution sequence (near the EcoRI site of
the previous versions). This change was introduced because other
studies had demonstrated the greater efficiency of the PaeR7
restriction enzyme in promoting recombination events in vivo, relative
to the EcoRI system employed previously (36).
PaeR7-uncuttable partners were constructed by insertion of
HindIII linkers into the PaeR7 sites. (iii)
The nin region was eliminated by crossing in the deletion
nin5.
The extraordinary recombination proficiency of E. coli
strains bearing
red genes in their chromosomes in place
of recBCD (29) led us to place the other
functions needed for
RFLP crosses
cI repressor and the
PaeR7 restriction-modification system
in the chromosome as
well (Fig. 4). This approach eliminates
the need for plasmids in the host strains, a significant advantage.
Some bacterial strains lacking recombination functions grow relatively poorly when they bear plasmids. The plasmids' replication, moreover, is affected by mutations of the host recombination genes, as well as
expression of phage recombination functions. For example, in bacteria
in which RecBCD is inactivated, much plasmid DNA is found in the form
of linear multimers, apparently as the result of rolling-circle replication (7).

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 4.
Map of the
(recC-recD)::red-pae-cI substitution
in strain TP507 and derivatives. Sequences between the XmaI
site upstream from recC and the SspI site near
the C-terminus-encoding end of recD are replaced. The block
of sequence designated "red" includes (from left to right) the
promoter Ptac and genes gam,
red , and red . pae includes the restriction
endonuclease and methylase genes of Pseudomonas aeruginosa
R7, transcribed rightward. The cI gene is fused to the
promoter PlacUV5 and is also transcribed
rightward.
|
|
As detailed in Materials and Methods, we constructed a cassette bearing
the
genes gam, bet, and exo, the
PaeR7 restriction-modification system, and
cI
repressor and recombined it into the chromosome of E. coli
AB1157 in place of recBCD (Fig. 4). The resulting strain, TP507, is recombination proficient in general and hyper-rec with respect to recombination with short linear DNA fragments, as described previously (29). Mutant alleles of recG and
ruvC were introduced into the TP507 background by P1 transduction.
Resolvase-dependent Red-mediated recombination.
Crosses
between the new
RFLP phages were predicted to have different
outcomes, depending upon which partner was cut, as diagrammed in Fig.
5 (top). Cutting the
non-cat-bearing phage should result in the production of
recombinants independent of resolution functions, as seen previously.
However, according to the scheme outlined in Fig. 3, a double-strand
break in the cat-bearing phage should lead to the production
of a recombination intermediate that can be processed into a
recombinant only by the action of a resolvase.

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 5.
(Top) Recombination between RFLP phages bearing a
heterologous sequence. As indicated, production of a recombinant
follows different potential pathways, depending upon which phage is
cut. On the left, the invading partner has homology (1 kb) at the end
but has a heterologous sequence (the cat gene; 1 kb) between
the end and the restriction site marker B (BglII). Formation
of recombinants by the mechanism diagrammed in Fig. 3 is blocked. On
the right, the invading strand encounters no substantial heterology,
only the restriction site polymorphism. Formation of recombinants by
the mechanism diagrammed in Fig. 3 is permitted. The cross on the left
involves phages RFLP835 nin5 (above) and RFLP864 nin5 (below); that on the right involves RFLP863 nin5 (above) and RFLP836 nin5
(below). (Bottom) Autoradiographs of Southern gels of
BglII-digested DNA extracted from host cells 60 min after
infection and probed with cat sequences. The positions of
parental (P) and recombinant (R) bands are indicated. The lowest band
results from cutting with PaeR7 in vivo and with
BglII in vitro. The bacterial strains were all
(recC-recD)::red-pae-cI. +, present;
, absent.
|
|
The involvement of resolution functions in recombination in the new
system was tested in the experiment shown in Fig. 5 (bottom). In this
experiment, DNA was extracted from cells infected with RFLP phages,
digested with BglII endonuclease, run in a Southern gel, and
hybridized with a cat-specific probe. In crosses in which the cat-bearing phage was cut in vivo, three bands were
seen: parental, recombinant, and a 1,990-bp fragment generated by
PaeR7 cutting in vivo and BglII cutting in vitro.
The last band was not present in DNA extracted from crosses in which
the non-cat-bearing phage was cut. The three bands
correspond to ones seen previously (31).
The fraction of label in recombinant bands in Fig. 5 (bottom) and
similar autoradiograms was quantitated; the results are shown in Table
1. As seen previously, the two phages
recombine efficiently in the red-expressing host that lacks
RecBCD but is otherwise wild type for recombination functions. In
contrast to previous results, however, recombination was reduced more
than 15-fold by mutation of ruvC. The RuvC dependence of
recombination was seen regardless of which parent was cut.
Recombination was increased by mutation of recG; this
effect, too, was independent of which parent was cut. In a
recG mutant background, however, loss of ruvC
function resulted in a 16-fold decrease in recombination when the
cat-bearing chromosome was cut but only a slight (possibly insignificant) decrease when the non-cat-bearing chromosome
was cut.
Biological-recombinant formation.
We sought to address the
question of whether the formation of recombinant DNA molecules in
RFLP crosses correlates with the production of biological recombinants.
We constructed a variant of the RFLP phages,
lac::cat819, which, upon infecting an
immune host with the PaeR7 restriction-modification system,
is cut by the PaeR7 nuclease, releasing a 4-kb fragment with
lacZ and lacY sequences at its ends and the
cat gene in the middle (Fig.
6a). Red-mediated recombination results
in replacement of the chromosomal lacZ gene with a mutant
allele that is defective for lacZ function but confers
chloramphenicol resistance on the recombinant. According to the
rationale diagrammed in Fig. 3, production of chloramphenicol-resistant recombinants would be expected to require the same functions as production of recombinant DNA molecules in
RFLP crosses in which the cat-bearing chromosome is cut (Fig. 5, top left).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
(a) Recombination between lac::cat819 nin5 and the bacterial
chromosome. Phage repressor in the infected cell prevents transcription
of phage genes. PaeR7 restriction endonuclease releases a
DNA fragment that recombines with the chromosome, generating a
chloramphenicol-resistant, Lac recombinant. (b)
Production of recombinants following infection with lac::cat819 nin5. Log-phase cells
(approximately 108/ml) were infected at various
multiplicities and, after 1 h of further aeration, were plated for
total and recombinant (cat+ lac) titers. Open
circles, (recC-recD)::red-pae-cI
recG258; solid circles,
(recC-recD)::red-pae-cI. Total cell
counts increased approximately fourfold during the experiment.
|
|
Infection of a
recBCD::red-pae-cI
recG host with
lac::cat819
nin5 at low multiplicity produced Lac
chloramphenicol-resistant recombinants at the rate of approximately 0.02 per infecting phage. This frequency was independent of
multiplicity over a range of 0.001 to 1, indicating that infection with
a single phage is sufficient to produce a recombinant (Fig. 6b). When
this strain was infected with
lac::cat819 nin5 at high multiplicity, as many as 18% of the infected cells gave rise to
chloramphenicol-resistant recombinants (data not shown).
The abilities of
(
recBCD::red-pae-cI)
ruvC, recG, and recG ruvC mutants to
recombine with
lac::cat819 and
lac::cat819 nin5 are compared in Table
2. The two phages gave comparable frequencies of recombination in all hosts, indicating that
genes in
the nin region did not significantly affect recombinant
formation. Loss of ruvC function reduced the recombination
frequency two- to threefold, while loss of recG function
increased it five- to eightfold. The effect of the ruvC
mutation was much greater in a recG mutant background,
resulting in a 20- to 40-fold decrease in recombination. A
recA mutation, by comparison, reduced recombination 90-fold.
An interesting and as yet unexplained aspect of recombination between
lac::cat819 and E. coli
strains bearing the
recBCG::red-pae-cI substitution is
that up to one-third of the chloramphenicol-resistant recombinants in
some crosses were LacZ+. Production of these
LacZ+ recombinants appears to depend on the same functions
as the LacZ
recombinants
in particular, recA and, in a
recG background, ruvC (data not shown). Their
retention of lacZ function implies that the recombination
event that generated them was not simple gene replacement. The
LacZ+ recombinants may contain duplications of the
lac region. This idea is favored by the observation that
many of them gave rise to spontaneous LacZ
colonies on
restreaking (unpublished observations).
 |
DISCUSSION |
The results of experiments examining Red-mediated recombination
between linear and circular partners suggest two main interpretations concerning the roles of RecG and RuvC. (i) the main pathway to recombinant formation involves RuvC and (ii) RecG impedes this main
recombination pathway. However, RecG may also stimulate recombination via a RuvC-independent pathway.
In the presence of RecG function, the degree of dependence of
Red-mediated recombination on RuvC varied substantially among the three
types of crosses described in the preceding section. The dependence was
greatest in crosses between nonreplicating phage chromosomes in
non-plasmid-bearing cells (Fig. 5). In the other cases, recombination
appeared to be nearly independent of RuvC.
The contribution of RecG to Red-mediated recombination was less
variable among experiments: in all cases, elimination of RecG function
increased the frequency of recombination. In both types of crosses that
were carried out in non-plasmid-bearing cells
between nonreplicating
chromosomes and between short linear DNA fragments and the
bacterial chromosome
the resulting higher-frequency recombination was
also more dependent on RuvC (except when recombinant formation could in
theory proceed via branch migration, heteroduplex formation, and
mismatch repair, as pictured in Fig. 3). The simplest interpretation of
these observations is that RecG opposes the main pathway of Red-mediated recombination, which is RuvC dependent. The data in Table
2 suggest that RecG may also promote an alternative, RuvC-independent
recombination pathway: recombination frequencies in the ruvC
mutant were slightly higher than in the ruvC recG double mutant.
An alternative interpretation of the effects on Red-mediated
recombination of the recG258 allele is that they do not
result from inactivation of recG but rather from a function
expressed by the mini-Tn10 used to generate the allele
(22). This interpretation is ruled out by the observation
that a simple deletion allele of recG exhibits the same
stimulation of Red-mediated recombination as recG258
(unpublished observations).
Our description of the roles of RecG and RuvC is similar to a model
proposed by Whitby and coworkers (39), in which RecG actually aborted genetic exchanges resulting from RecA-mediated strand
invasion but then allowed RecBCD to catalyze exchanges at the ends of
the incoming DNA by an unspecified mechanism. Although these
researchers found biochemical evidence for RecG's ability to act in
this way, the fact that a recG mutant is recombination deficient relative to wild type apparently led them to favor other interpretations of RecG's activity in recombination (1,
38).
The generation of late-arising revertants of lacZ mutants
under conditions of selection is another cellular activity that apparently is impeded by RecG (10, 13). This activity,
sometimes called "adaptive mutability," is dependent upon
recombination functions (6, 13). Its dependence upon
recombination functions may be a consequence of the involvement of gene
amplification in the process (3). Harris et al.
(13) proposed a model for recombination associated with
adaptive mutation, in which RecG aborts 3'-end invasion and promotes
5'-end invasion.
The initial steps of Red-mediated recombination are perhaps less
complex than those of RecBCD-mediated recombination or of RecBCD-dependent adaptive mutation. The
exonuclease specifically and processively degrades the 5'-ended strand of double-stranded DNA
(20), leaving exclusively 3'-ended single strands for
synapsis and strand invasion. Production of these 3'-ended
single-strand tails in
-infected cells has been observed directly
(14). The observation that RecG inhibits Red-mediated
recombination that is constrained to proceed via strand invasion favors
models in which RecG tends to push out invading 3' ends.
The model diagrammed in Fig. 1 and 3 accounts reasonably well for
recombination between linear and circular partners in a red-expressing cell lacking recBCD and
recG functions: double-stranded ends are channeled nearly
exclusively through a pathway that involves the creation of 3'-ended
single-strand tails, which invade an unbroken homologous duplex. If and
only if branch migration is impeded by a significant nonhomology,
recombinant formation is dependent upon nucleolytic resolution of the
resulting Holliday junction by RuvC. In the absence of RuvC,
presumably, a recombination intermediate something like the structure
diagrammed in Fig. 3b accumulates. We have not observed such an
intermediate, but the methods employed in the extraction and
restriction enzyme digestion of DNA from
-infected cells might be
expected to favor its dissociation by spontaneous branch migration.
The model diagrammed in Fig. 1 and 3 does not account so well, by
itself, for what happens in a recG+ cell. A more
complete model would account for three questions raised by the data in
Fig. 2 and Tables 1 and 2. (i) Why was recombination between
nonreplicating
chromosomes, with no substantial nonhomologies,
dependent upon RuvC in one set of crosses (Table 1,
non-cat-bearing phage cut) and independent in another (Fig. 2)? One possible explanation is that the interacting DNA sequences in
question were not identical in the two experiments and branch migration
could proceed all the way past the restriction site polymorphism in the
face of opposition by RecG in one case but not in the other. (ii) The
crosses diagrammed in Fig. 5 (left side) and Fig. 6 both involve
recombination of a linear cat-bearing chromosome with a
circular chromosome. Why was recombinant formation dependent upon RuvC
in the former case and independent in the latter? A key difference
between the two crosses is that replication of both partners is blocked
in the
cross (Fig. 5) whereas replication of only the linear
partner is blocked in the linear-by-host chromosome cross (Fig. 6). The
passage of a replication fork may potentiate alternative pathways for
the resolution of recombination intermediates. (iii) How does RecG
promote, rather than impede, RecBCD-mediated recombination? One
possibility is that RecBCD-mediated recombination proceeds primarily
via 5'-ended strand invasion, but extensive studies of the activities
of RecBCD, both in vitro (2) and in vivo (11),
favor the view that RecBCD generates invading 3'-ended strands.
Together, these observations are consistent with the idea that RecBCD
may function in the processing or resolution of recombination
intermediates that it participates in generating (5, 30).
Perhaps the normal role of RecG is to facilitate this function of RecBCD.
 |
ACKNOWLEDGMENTS |
We thank Rik Myers and Susan Rosenberg for helpful discussions
and Michael Volkert for critical reading of the manuscript.
This work was supported by Public Health Service grant GM51609 from the
National Institutes of Health.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Dept. of
Molecular Genetics & Microbiology, University of Massachusetts Medical
School, 55 Lake Ave. North, Worcester, MA 01655. Phone: (508) 856-3708. Fax: (508) 856-5920. E-mail: tpoteete{at}ummed.edu.
 |
REFERENCES |
| 1.
|
Al-Deib, A. A.,
A. A. Mahdi, and R. G. Lloyd.
1996.
Modulation of recombination and DNA repair by the RecG and PriA helicases of Escherichia coli K-12.
J. Bacteriol.
178:6782-6789[Abstract/Free Full Text].
|
| 2.
|
Anderson, D. G., and S. C. Kowalczykowski.
1997.
The translocating RecBCD enzyme stimulates recombination by directing RecA protein onto ssDNA in a -regulated manner.
Cell
90:77-86[Medline].
|
| 3.
|
Anderson, D. I.,
E. S. Slechta, and J. R. Roth.
1998.
Evidence that gene amplification underlies adaptive mutability of the bacterial lac operon.
Science
282:1133-1135[Abstract/Free Full Text].
|
| 4.
|
Backman, K., and M. Ptashne.
1978.
Maximizing gene expression on a plasmid using recombination in vitro.
Cell
13:65-71[Medline].
|
| 5.
|
Birge, E. A., and K. B. Low.
1974.
Detection of transcribable recombination products following conjugation in Rec+, RecB , and RecC strains of Escherichia coli K12.
J. Mol. Biol.
83:447-457[Medline].
|
| 6.
|
Cairns, J., and P. L. Foster.
1991.
Adaptive reversion of a frameshift mutation in Escherichia coli.
Genetics
128:695-701[Abstract].
|
| 7.
|
Cohen, A., and A. J. Clark.
1986.
Synthesis of linear plasmid multimers in Escherichia coli K-12.
J. Bacteriol.
167:327-335[Abstract/Free Full Text].
|
| 8.
|
Dunderdale, H. J.,
F. E. Benson,
C. A. Parsons,
G. J. Sharples,
R. G. Lloyd, and S. C. West.
1991.
Formation and resolution of recombination intermediates by E. coli RecA and RuvC proteins.
Nature
354:506-510[Medline].
|
| 9.
|
Dykstra, C. C.,
D. Prasher, and S. R. Kushner.
1984.
Physical and biochemical analysis of the cloned recB and recC genes of Escherichia coli K-12.
J. Bacteriol.
157:21-27[Abstract/Free Full Text].
|
| 10.
|
Foster, P. L.,
J. M. Trimarchi, and R. A. Maurer.
1996.
Two enzymes, both of which process recombination intermediates, have opposite effects on adaptive mutation in Escherichia coli.
Genetics
142:25-37[Abstract].
|
| 11.
|
Friedman-Ohana, R., and A. Cohen.
1998.
Heteroduplex joint formation in Escherichia coli recombination is initiated by pairing of a 3'-ending strand.
Proc. Natl. Acad. Sci. USA
95:6909-6914[Abstract/Free Full Text].
|
| 12.
|
Gingeras, T. R., and J. E. Brooks.
1983.
Cloned restriction/modification system from Pseudomonas aeruginosa.
Proc. Natl. Acad. Sci. USA
80:402-406[Abstract/Free Full Text].
|
| 13.
|
Harris, R. S.,
K. J. Ross, and S. M. Rosenberg.
1996.
Opposing roles of the Holliday junction processing systems of Escherichia coli in recombination-dependent adaptive mutation.
Genetics
142:681-691[Abstract].
|
| 14.
|
Hill, S. A.,
M. M. Stahl, and F. W. Stahl.
1997.
Single-strand DNA intermediates in phage 's Red recombination pathway.
Proc. Natl. Acad. Sci. USA
94:2951-2956[Abstract/Free Full Text].
|
| 15.
|
Hollifield, W.,
E. Kaplan, and H. Huang.
1987.
Efficient RecABC-dependent, homologous recombination between coliphage lambda and plasmids requires a phage ninR region gene.
Mol. Gen. Genet.
210:248-255[Medline].
|
| 16.
|
Karu, A. E.,
Y. Sakaki,
H. Echols, and S. Linn.
1975.
The protein specified by bacteriophage .
J. Biol. Chem.
250:7377-7387[Abstract/Free Full Text].
|
| 17.
|
Kmiec, E., and W. K. Holloman.
1981.
protein of bacteriophage promotes renaturation of DNA.
J. Biol. Chem.
256:12636-12639[Abstract/Free Full Text].
|
| 18.
|
Kogoma, T.,
G. W. Cadwell,
K. G. Barnard, and T. Asai.
1996.
The DNA replication priming protein, PriA, is required for homologous recombination and double-strand break repair.
J. Bacteriol.
178:1258-1264[Abstract/Free Full Text].
|
| 19.
|
Kowalczykowski, S. C.,
D. A. Dixon,
A. K. Eggleston,
S. D. Lauder, and W. M. Rehrauer.
1994.
Biochemistry of homologous recombination in Escherichia coli.
Microbiol. Rev.
58:401-465[Abstract/Free Full Text].
|
| 20.
|
Little, J. W.
1967.
An exonuclease induced by bacteriophage . II. Nature of the enzymic reaction.
J. Biol. Chem.
242:679-686[Abstract/Free Full Text].
|
| 21.
|
Lloyd, R. G.
1991.
Conjugational recombination in resolvase-deficient ruvC mutants of Escherichia coli K-12 depends on recG.
J. Bacteriol.
173:5414-5418[Abstract/Free Full Text].
|
| 22.
|
Lloyd, R. G., and C. Buckman.
1991.
Genetic analysis of the recG locus of Escherichia coli K-12 and of its role in recombination and DNA repair.
J. Bacteriol.
173:1004-1011[Abstract/Free Full Text].
|
| 23.
|
Lloyd, R. G., and K. B. Low.
1996.
Homologous recombination, p. 2236-2255.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology. ASM Press, Washington, D.C.
|
| 24.
|
Lloyd, R. G., and G. J. Sharples.
1993.
Dissociation of synthetic Holliday junctions by E. coli RecG protein.
EMBO J.
12:17-22[Medline].
|
| 25.
|
Mahdi, A. A.,
G. J. Sharples,
T. N. Mandal, and R. G. Lloyd.
1996.
Holliday junction resolvases encoded by homologous rusA genes in Escherichia coli K-12 and phage 82.
J. Mol. Biol.
257:561-573[Medline].
|
| 26.
|
Maloy, S. R., and W. D. Nunn.
1981.
Selection for loss of tetracycline resistance by Escherichia coli.
J. Bacteriol.
145:1110-1112[Abstract/Free Full Text].
|
| 27.
|
Muniyappa, K., and C. M. Radding.
1986.
The homologous recombination system of phage : pairing activities of protein.
J. Biol. Chem.
261:7472-7478[Abstract/Free Full Text].
|
| 28.
|
Murphy, K. C.
1991.
gam protein inhibits the helicase and -stimulated recombination activities of Escherichia coli RecBCD enzyme.
J. Bacteriol.
173:5808-5821[Abstract/Free Full Text].
|
| 29.
|
Murphy, K. C.
1998.
Use of bacteriophage recombination functions to promote gene replacement in Escherichia coli.
J. Bacteriol.
180:2063-2071[Abstract/Free Full Text].
|
| 29a.
| Murphy, K. C. Unpublished data.
|
| 30.
|
Myers, R. S., and F. W. Stahl.
1994.
Chi and the RecBCD enzyme of Escherichia coli.
Annu. Rev. Genet.
28:49-70[Medline].
|
| 31.
|
Poteete, A. R., and A. C. Fenton.
1993.
Efficient double-strand break-stimulated recombination promoted by the general recombination systems of phages and P22.
Genetics
134:1013-1021[Abstract].
|
| 32.
|
Roca, A. I., and M. M. Cox.
1997.
RecA protein: structure, function, and role in recombinational DNA repair.
Prog. Nucleic Acid Res. Mol. Biol.
56:129-223[Medline].
|
| 33.
|
Sandler, S. J.,
H. S. Samra, and A. J. Clark.
1996.
Differential suppression of priA2::kan phenotypes in Escherichia coli K-12 by mutations in priA, lexA, and dnaC.
Genetics
143:5-13[Abstract].
|
| 34.
|
Sharples, G. J.,
F. E. Benson,
G. T. Illing, and R. G. Lloyd.
1990.
Molecular and functional analysis of the ruv region of Escherichia coli K-12 reveals three genes involved in DNA repair and recombination.
Mol. Gen. Genet.
221:219-226[Medline].
|
| 35.
|
Stahl, F. W.,
I. Kobayashi, and M. M. Stahl.
1985.
In phage , cos is a recombinator in the Red pathway.
J. Mol. Biol.
181:199-209[Medline].
|
| 36.
|
Stahl, M. M.,
L. Thomason,
A. R. Poteete,
T. Tarkowski,
A. Kuzminov, and F. W. Stahl.
1997.
Annealing vs. invasion in phage recombination.
Genetics
147:961-977[Abstract].
|
| 37.
|
Thaler, D. S.,
M. M. Stahl, and F. W. Stahl.
1987.
Double-chain-cut sites are recombination hotspots in the Red pathway of phage .
J. Mol. Biol.
195:75-87[Medline].
|
| 38.
|
Whitby, M. C., and R. G. Lloyd.
1995.
Branch migration of three-strand recombination intermediates by RecG, a possible pathway for securing exchanges initiated by 3'-tailed duplex DNA.
EMBO J.
14:3302-3310[Medline].
|
| 39.
|
Whitby, M. C.,
L. Ryder, and R. G. Lloyd.
1993.
Reverse branch migration of Holliday junctions by RecG protein: a new mechanism for resolution of intermediates in recombination and DNA repair.
Cell
75:341-350[Medline].
|
Journal of Bacteriology, September 1999, p. 5402-5408, Vol. 181, No. 17
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Huen, M. S. Y., Li, X.-t., Lu, L.-Y., Watt, R. M., Liu, D.-P., Huang, J.-D.
(2006). The involvement of replication in single stranded oligonucleotide-mediated gene repair. Nucleic Acids Res
34: 6183-6194
[Abstract]
[Full Text]
-
Kajimura, J., Rahman, A., Hsu, J., Evans, M. R., Gardner, K. H., Rick, P. D.
(2006). O Acetylation of the Enterobacterial Common Antigen Polysaccharide Is Catalyzed by the Product of the yiaH Gene of Escherichia coli K-12. J. Bacteriol.
188: 7542-7550
[Abstract]
[Full Text]
-
Hayes, S., Asai, K., Chu, A. M., Hayes, C.
(2005). NinR- and Red-Mediated Phage-Prophage Marker Rescue Recombination in Escherichia coli: Recovery of a Nonhomologous imm{lambda} DNA Segment by Infecting {lambda}imm434 Phages. Genetics
170: 1485-1499
[Abstract]
[Full Text]
-
Poteete, A. R.
(2004). Modulation of DNA Repair and Recombination by the Bacteriophage {lambda} Orf Function in Escherichia coli K-12. J. Bacteriol.
186: 2699-2707
[Abstract]
[Full Text]
-
van der Weyden, L., Adams, D. J., Bradley, A.
(2002). Tools for targeted manipulation of the mouse genome. Physiol. Genomics
11: 133-164
[Abstract]
[Full Text]
-
Poteete, A. R., Fenton, A. C., Wang, H. R.
(2002). Recombination-Promoting Activity of the Bacteriophage {lambda} Rap Protein in Escherichia coli K-12. J. Bacteriol.
184: 4626-4629
[Abstract]
[Full Text]
-
Poteete, A. R., Wang, H. R., Foster, P. L.
(2002). Phage {lambda} Red-Mediated Adaptive Mutation. J. Bacteriol.
184: 3753-3755
[Abstract]
[Full Text]
-
Lombardo, M.-J., Rosenberg, S. M.
(2000). radC102 of Escherichia coli Is an Allele of recG. J. Bacteriol.
182: 6287-6291
[Abstract]
[Full Text]
-
Muyrers, J. P.P., Zhang, Y., Buchholz, F., Stewart, A. F.
(2000). RecE/RecT and Redalpha /Redbeta initiate double-stranded break repair by specifically interacting with their respective partners. Genes Dev.
14: 1971-1982
[Abstract]
[Full Text]
-
Poteete, A. R., Fenton, A. C.
(2000). Genetic Requirements of Phage lambda Red-Mediated Gene Replacement in Escherichia coli K-12. J. Bacteriol.
182: 2336-2340
[Abstract]
[Full Text]