Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Raffaelli, N. Articles by Magni, G. Search for Related Content PubMed PubMed Citation Articles by Raffaelli, N. Articles by Magni, G.

 Previous Article  |  Next Article 

Journal of Bacteriology, September 1999, p. 5509-5511, Vol. 181, No. 17
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

The Escherichia coli NadR Regulator Is Endowed with Nicotinamide Mononucleotide Adenylyltransferase Activity

Nadia Raffaelli,¹ Teresa Lorenzi,¹ P. Luigi Mariani,¹ Monica Emanuelli,¹ Adolfo Amici,¹ Silverio Ruggieri,² and Giulio Magni^1,*

Istituto di Biochimica, Facoltà di Medicina¹ and Dipartimento di Biotecnologie Agrarie ed Ambientali,² Università di Ancona, 60131 Ancona, Italy

Received 20 April 1999/Accepted 21 June 1999

	ABSTRACT

Top Abstract Text References

The first identification and characterization of a catalytic activity associated with NadR protein is reported. A computer-aided search for sequence similarity revealed the presence in NadR of a 29-residue region highly conserved among known nicotinamide mononucleotide adenylyltransferases. The Escherichia coli nadR gene was cloned into a T7-based vector and overexpressed. In addition to functionally specific DNA binding properties, the homogeneous recombinant protein catalyzes NAD synthesis from nicotinamide mononucleotide and ATP.

	TEXT

Top Abstract Text References

In the Escherichia coli and Salmonella typhimurium NAD biosynthetic pathways, the genes involved in both the de novo synthesis (nadA and nadB) and salvage routes (pncB) are under negative transcriptional control by the product of the nadR locus, also referred to as nadI (6, 15, 19). It has been demonstrated that the nadR gene product is a bifunctional protein that can both act as a repressor and control the transport of exogenous nicotinamide mononucleotide (NMN), the immediate NAD precursor, across the cytoplasmic membrane (5, 17). The latter function would be exerted through a regulatory modulation of the activity of the integral membrane protein PnuC, which is responsible for NMN transport (5, 18). While the repression function resides in the NadR N-terminal domain, the C-terminal domain is involved in the transport function (4). Both functions appear to exert their control in response to intracellular NAD (or NADP) levels (5, 18). In this regard, it has been proposed that NadR behaves as an allosteric protein: in the presence of high NAD levels it might assume a conformation which allows both repression of NAD biosynthetic genes transcription and inhibition of NMN transport system; conversely, when NAD levels are low, NadR might associate with the membrane, allowing full expression of biosynthetic genes and stimulating NMN uptake (5, 18).

Several eubacterial transcriptional factors are known to possess enzymatic activity (9, 16). However, in a recent study aimed at elucidation of the DNA binding properties of NadR, the possibility of the existence of a catalytic activity associated with the protein was ruled out (10). In the present note, we show that NadR is endowed with NMN adenylytransferase activity catalyzing the transfer of the adenylyl moiety from ATP to NMN, thus forming NAD. This finding emphasizes the pivotal role of NadR, which may be able to ensure an efficient NAD production when the pyridine nucleotides pool is depleted, by both derepressing transcription of the NAD biosynthetic genes and directly converting the imported NMN to NAD. It may represent a sophisticated mechanism to quickly respond to NAD depletion, at the same time preventing the excessive increase of the intracellular NMN pool, which would be harmful for the cell (8).

Cloning and expression of nadR gene. When the archaeal Methanococcus jannaschii NMN adenylyltransferase sequence (12) was used as a probe in a BLAST search for homologous sequences, a region spanning 29 residues at the N terminus of the protein was found to significantly align with an internal region of both S. typhimurium and E. coli NadR (Fig. 1). Due to the strict conservation of most of the residues present in this region both in the known archaeal NMN adenylyltransferases and in the slr0787 NMN adenylyltransferase from Synechocystis sp. (11), we expected this region to be involved in catalysis (Fig. 1). Therefore, its presence in NadR prompted us to clone and express the protein to investigate its possible NMN adenylyltransferase activity.

View larger version (19K): [in this window] [in a new window]   FIG. 1.   Sequence alignment of homologous regions of NadR proteins from E. coli (ENadR) and S. typhimurium (SNadR), NMN adenylyltransferase from M. jannaschii (MjAT), putative NMN adenylyltransferases from Methanobacterium thermoautotrophicum (MtAT), Archaeoglobus fulgidus (AfAT), and Pyrococcus horikoshii (PhAT), and NMN adenylyltransferase from Synechocystis sp. (SynAT). Identical and similar residues are in boldface. The alignment was generated by using the CLUSTAL W program.

The nadR gene was amplified from E. coli MG1655 chromosomal DNA by PCR using oligonucleotide primers d(CTAGAATTCGCATGAGATATACGGAGGGAGAT) and d(CGGCTGCAGTTATCTCTGCTCCCCCATCAT), designated to incorporate an EcoRI site at the start of the gene and a PstI site at its end. The 1,274-bp product was digested with EcoRI and PstI, purified, and ligated into EcoRI-PstI-digested pT7-7 plasmid (14) under control of a T7 promoter. The resulting plasmid, pT7-7-nadR, was transformed into E. coli BL21(DE3) cells for protein expression. Even without isopropyl-1-thio--galactopyranoside induction, a high level of protein expression was achieved following aerobic growth at 37°C in Luria-Bertani medium (supplemented with ampicillin [100 µg/ml]), as revealed by the appearance of a major band of the expected size of 45 kDa on sodium dodecyl sulfate-polyacrylamide gel electrophoresis of cell extracts (Fig. 2, lane c). The same extracts exhibited high levels of NMN adenylyltransferase activity (0.002 U/mg) [1 U is defined as the amount of NadR catalyzing the synthesis of 1 µmol of NAD per min at 37°C]) compared with control extracts prepared from E. coli cells transformed with the nonrecombinant plasmid (less than 4 × 10⁵ U/mg). The enzymatic activity was assayed by incubating extract samples in 50 mM HEPES (pH 8.6)-13 mM MgCl₂-1 mM ATP-1 mM NMN. After 20 min of incubation at 37°C, NAD formed was measured as described previously (11).

View larger version (97K): [in this window] [in a new window]   FIG. 2.   Purification of recombinant NadR protein. A Coomassie blue-stained polyacrylamide gel (10%) shows the fractions from the purification: (3 µg of hydroxyapatite fraction [lane a], 5 µg of DNA agarose fraction [lane b], and 28 µg of crude extract [lane c]), and positions of molecular weight standards (2 µg; lane d).

Purification of the recombinant NadR protein. Purification of the recombinant protein was monitored by assaying the NMN adenylyltransferase activity. The cell extract was prepared from 1 liter of saturated culture of E. coli cells harboring the pT7-7-nadR construct as previously reported (11). Crude extract (12 ml) was diluted fourfold with buffer A (11) and mixed with 50 ml of DNA-agarose suspension prepared as described previously (13), equilibrated with buffer A. After stirring overnight at 4°C, the resin was washed with buffer A plus 0.1 M NaCl, and NadR was eluted by incubating the resin with 100 ml of buffer A plus 1 M NaCl for 20 min at 4°C. The DNA-agarose fraction (100 ml) was loaded onto a 1.3- by 3.5-cm hydroxyapatite (Bio-Rad) column equilibrated with 10 mM buffer B (potassium phosphate, 1 mM MgCl₂, 1 mM dithiothreitol [DTT], 5% glycerol, [pH 7.0]). After a wash with 150 mM buffer B, a linear 150 to 250 mM buffer B gradient (25 ml plus 25 ml) was applied. Fractions containing NadR were pooled and concentrated by ultrafiltration. Throughout the overall purification procedure, NMN adenylyltransferase activity copurified with NadR. The homogeneous final preparation (Fig. 2, lane a) showed a specific activity of 0.05 U/mg. N-terminal sequencing of the pure protein confirmed that it was the product of the nadR gene. Gel filtration experiments performed on a Superose 12HR 10/30 (Pharmacia) column, equilibrated with sodium phosphate buffer (pH 7.4)-1 mM MgCl₂-0.5 mM EDTA-1 mM DTT-0.5 M NaCl, both in the presence and in the absence of 1% dimethyl sulfoxide, gave a native molecular mass of about 180 kDa, suggesting a tetrameric form of the protein.

DNA binding activity of the recombinant NadR protein. DNA fragments of 200 bp containing the predicted promoter regions of nadA and nadB genes were used as probes in gel mobility shift assays to verify the DNA binding activity of recombinant NadR. These probes were produced by PCR amplification from E. coli MG1655 genomic DNA by using primers designated to amplify regions corresponding to nucleotides 180 to +19 and 199 to 1 with respect to the predicted transcription start sites of nadA and nadB, respectively. Different concentrations of the pure protein were mixed either with the probe or with the probe in the presence of PCR markers (Promega) as competitor DNA. After 30 min at 25°C in 50 mM Tris-HCl (pH 7.5)-1 mM EDTA-2 mM MgCl₂-5% glycerol-2 mM DTT, samples were loaded on a 5% native polyacrylamide gel (30:0.8 [wt/wt] acrylamide to N,N'-methylenebisacrylamide). Electrophoresis was carried out in 89 mM Tris-89 mM borate-2.5 mM EDTA, at constant voltage (8 V/cm), at 4°C. Gels were stained with ethidium bromide. As shown in Fig. 3, the mobility of the specific 200-bp fragment containing the nadB operator region was shifted upon addition of NadR. The band shift was not affected by the presence of competitor DNA (unpublished results). Identical results were obtained with the nadA control region (not shown), suggesting that the recombinant NadR retained its ability to specifically bind to NAD biosynthetic genes operator regions.

View larger version (54K): [in this window] [in a new window]   FIG. 3.   Gel retardation of the nadB operator region by NadR protein. An ethidium bromide-stained polyacrylamide gel shows the migration of a 200-bp DNA fragment containing the nadB control region (60 nM) after incubation with increasing amounts of pure NadR. Concentrations of NadR were 211 nM (lane a), 114 nM (lane b), 55 nM (lane c), and 0 nM (lane d).

NMN adenylyltransferase activity of the recombinant NadR protein. Unlike the NMN adenylyltransferases so far characterized (1, 3, 7, 11, 12), which show a broad pH optimum ranging from 6.0 to 9.0, the activity associated with NadR exhibits an alkaline pH optimum. In HEPES buffer, the enzyme was maximally active at pH 8.6, the activity at pH 7.0 being only about 5% of that measured at pH 8.6. NadR requires divalent metal cations for activity. All ion species tested, including Ni²⁺, Co²⁺, Cd²⁺, Cu²⁺, Zn²⁺, Ca²⁺, Mg²⁺, and Mn²⁺, stimulated the activity. Routine enzymatic assays were carried out in the presence of Mg²⁺, which is the most effective for all known NMN adenylyltransferases. However, Ni²⁺ and Co²⁺ at 1 mM increased the reaction rate about fourfold compared to Mg²⁺ at the optimal concentration. NadR was highly specific for the amidated form of NMN, NAD synthesis occurring at a rate 170 times faster than nicotinic acid adenine dinucleotide synthesis. Such a strict specificity clearly differentiates the NMN adenylyltransferase activity associated with E. coli NadR from the E. coli NMN adenylyltransferase described by Dahmen et al. (2), which exhibits a remarkable preference for the NMN. Another distinctive feature of NadR activity is represented by the significantly different K_m values of 0.7 mM and 1.7 µM for NMN and ATP, respectively. The K_m for NMN is much higher than K_ms for other known NMN adenylyltransferases (1, 3, 7, 11) and may account for the conversion of NMN to NAD by NadR under conditions of NAD depletion, which stimulate NMN uptake.

Conclusions. Evidence for the existence of an NMN adenylyltransferase activity associated with NadR protein has been presented. Although the physiological role of this enzymatic function has not been fully elucidated, this finding represents a novel feature of NAD biosynthesis regulation system in eubacteria and may shed light on the understanding of the mechanisms underlying NMN uptake. In addition, the present work provides the basis for the identification of a novel putative consensus sequence representing an NMN adenylyltransferase catalytic motif.

	ACKNOWLEDGMENTS

This work was partly supported by CNR grant 98.00473.CT04 and CNR Target Project "Biotechnology".

We thank G. M. Rossolini (University of Siena, Siena, Italy) for providing E. coli MG1655 genomic DNA.

	FOOTNOTES

^* Corresponding author. Mailing address: Istituto di Biochimica, Facoltà di Medicina, Università di Ancona, Via Ranieri, 60131 Ancona, Italy. Phone: (39) 71 2204678. Fax: (39) 71 2802117. E-mail: magnig{at}popcsi.unian.it.

	REFERENCES

Top Abstract Text References

1.	Balducci, E., G. Orsomando, V. Polzonetti, A. Vita, M. Emanuelli, N. Raffaelli, S. Ruggieri, G. Magni, and P. Natalini. 1995. NMN adenylyltransferase from bull testis: purification and properties. Biochem. J. 310:395-400.
2.	Dahmen, W., B. Webb, and J. Press. 1967. The deamidodiphosphopyridine nucleotide and diphosphopyridine nucleotide pyrophosphorylases from Escherichia coli and yeast. Arch. Biochem. Biophys. 120:440-450[Medline].
3.	Emanuelli, M., P. Natalini, N. Raffaelli, S. Ruggieri, A. Vita, and G. Magni. 1992. NAD biosynthesis in human placenta: purification and characterization of homogeneous NMN adenylyltransferase. Arch. Biochem. Biophys. 298:29-34[Medline].
4.	Foster, J. W., and T. Penfound. 1993. The bifunctional nadR regulator of Salmonella typhimurium: location of regions involved with DNA binding, nucleotide transport and intramolecular communication. FEMS Microbiol. Lett. 112:179-184[Medline].
5.	Foster, J. W., Y. K. Park, T. Penfound, T. Fenger, and M. P. Spector. 1990. Regulation of NAD metabolism in Salmonella typhimurium: molecular sequence analysis of the bifunctional nadR regulator and the nadA-pnuC operon. J. Bacteriol. 172:4187-4196[Abstract/Free Full Text].
6.	Holley, B. A., M. P. Spector, and J. W. Foster. 1985. Regulation of NAD biosynthesis in Salmonella typhimurium: expression of nad-lac gene fusions and identification of a nad regulatory locus. J. Gen. Microbiol. 131:2759-2770[Abstract/Free Full Text].
7.	Natalini, P., S. Ruggieri, N. Raffaelli, and G. Magni. 1986. Nicotinamide mononucleotide adenylyltransferase. Molecular and enzymatic properties of the homogeneous enzyme from baker's yeast. Biochemistry 25:3725-3729[Medline].
8.	Olivera, B. M., and F. Bonhoeffer. 1972. Discontinuous DNA replication in vitro. I. Two distinct size classes of intermediates. Nature (London) New Biol. 240:233-235.
9.	Ostrovsky de Spicer, P., K. O'Brien, and S. Maloy. 1991. Regulation of proline utilization in Salmonella typhimurium: a membrane-associated dehydrogenase binds DNA in vitro. J. Bacteriol. 173:211-219[Abstract/Free Full Text].
10.	Penfound, T., and J. W. Foster. 1999. NAD-dependent DNA-binding activity of the bifunctional NadR regulator of Salmonella typhimurium. J. Bacteriol. 181:648-655[Abstract/Free Full Text].
11.	Raffaelli, N., T. Lorenzi, A. Amici, M. Emanuelli, S. Ruggieri, and G. Magni. 1999. Synechocystis sp. slr0787 protein is a novel bifunctional enzyme endowed with both nicotinamide mononucleotide adenylyltransferase and `Nudix' hydrolase activities. FEBS Lett. 444:222-226[Medline].
12.	Raffaelli, N., F. M. Pisani, T. Lorenzi, M. Emanuelli, A. Amici, S. Ruggieri, and G. Magni. 1997. Characterization of nicotinamide mononucleotide adenylyltransferase from thermophilic archaea. J. Bacteriol. 179:7718-7723[Abstract/Free Full Text].
13.	Schaller, H., C. Nusslein, F. J. Bonhoeffer, C. Kurz, and I. Nietzschmann. 1972. Affinity chromatography of DNA-binding enzymes on single-stranded DNA-agarose columns. Eur. J. Biochem. 26:474-481[Medline].
14.	Studier, F. W., and B. A. Moffatt. 1986. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189:113-130[Medline].
15.	Tritz, G. J., and J. L. Chandler. 1973. Recognition of a gene involved in the regulation of nicotinamide adenine dinucleotide biosynthesis. J. Bacteriol. 114:128-136[Abstract/Free Full Text].
16.	Turner, R. J., E. R. Bonner, G. K. Grabner, and R. L. Switzer. 1998. Purification and characterization of Bacillus subtilis PyrR, a bifunctional pyr mRNA-binding attenuation protein/uracil phosphoribosyltransferase. J. Biol. Chem. 273:5932-5938[Abstract/Free Full Text].
17.	Zhu, N., and J. R. Roth. 1991. The nadI region of Salmonella typhimurium encodes a bifunctional regulatory protein. J. Bacteriol. 173:1302-1310[Abstract/Free Full Text].
18.	Zhu, N., B. M. Olivera, and J. R. Roth. 1991. Activity of the nicotinamide mononucleotide transport system is regulated in Salmonella typhimurium. J. Bacteriol. 173:1311-1320[Abstract/Free Full Text].
19.	Zhu, N., B. M. Olivera, and J. R. Roth. 1988. Identification of a repressor gene involved in the regulation of NAD de novo biosynthesis in Salmonella typhimurium. J. Bacteriol. 170:117-125[Abstract/Free Full Text].

---

Journal of Bacteriology, September 1999, p. 5509-5511, Vol. 181, No. 17
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

This article has been cited by other articles:

• Gazzaniga, F., Stebbins, R., Chang, S. Z., McPeek, M. A., Brenner, C. (2009). Microbial NAD Metabolism: Lessons from Comparative Genomics. Microbiol. Mol. Biol. Rev. 73: 529-541 [Abstract] [Full Text]  
• Rodionov, D. A., Li, X., Rodionova, I. A., Yang, C., Sorci, L., Dervyn, E., Martynowski, D., Zhang, H., Gelfand, M. S., Osterman, A. L. (2008). Transcriptional regulation of NAD metabolism in bacteria: genomic reconstruction of NiaR (YrxA) regulon. Nucleic Acids Res 36: 2032-2046 [Abstract] [Full Text]  
• Rodionov, D. A., De Ingeniis, J., Mancini, C., Cimadamore, F., Zhang, H., Osterman, A. L., Raffaelli, N. (2008). Transcriptional regulation of NAD metabolism in bacteria: NrtR family of Nudix-related regulators. Nucleic Acids Res 36: 2047-2059 [Abstract] [Full Text]  
• Ostrowski, E. A, Woods, R. J, Lenski, R. E (2008). The genetic basis of parallel and divergent phenotypic responses in evolving populations of Escherichia coli. Proc R Soc B 275: 277-284 [Abstract] [Full Text]  
• Gerlach, G., Reidl, J. (2006). NAD+ utilization in pasteurellaceae: simplification of a complex pathway.. J. Bacteriol. 188: 6719-6727 [Full Text]  
• Gerdes, S. Y., Kurnasov, O. V., Shatalin, K., Polanuyer, B., Sloutsky, R., Vonstein, V., Overbeek, R., Osterman, A. L. (2006). Comparative Genomics of NAD Biosynthesis in Cyanobacteria.. J. Bacteriol. 188: 3012-3023 [Abstract] [Full Text]  
• Berger, F., Lau, C., Dahlmann, M., Ziegler, M. (2005). Subcellular Compartmentation and Differential Catalytic Properties of the Three Human Nicotinamide Mononucleotide Adenylyltransferase Isoforms. J. Biol. Chem. 280: 36334-36341 [Abstract] [Full Text]  
• Rossolillo, P., Marinoni, I., Galli, E., Colosimo, A., Albertini, A. M. (2005). YrxA Is the Transcriptional Regulator That Represses De Novo NAD Biosynthesis in Bacillus subtilis. J. Bacteriol. 187: 7155-7160 [Abstract] [Full Text]  
• Merdanovic, M., Sauer, E., Reidl, J. (2005). Coupling of NAD+ Biosynthesis and Nicotinamide Ribosyl Transport: Characterization of NadR Ribonucleotide Kinase Mutants of Haemophilus influenzae. J. Bacteriol. 187: 4410-4420 [Abstract] [Full Text]  
• Grose, J. H., Bergthorsson, U., Xu, Y., Sterneckert, J., Khodaverdian, B., Roth, J. R. (2005). Assimilation of Nicotinamide Mononucleotide Requires Periplasmic AphA Phosphatase in Salmonella enterica. J. Bacteriol. 187: 4521-4530 [Abstract] [Full Text]  
• Grose, J. H., Bergthorsson, U., Roth, J. R. (2005). Regulation of NAD Synthesis by the Trifunctional NadR Protein of Salmonella enterica. J. Bacteriol. 187: 2774-2782 [Abstract] [Full Text]  
• Sauer, E., Merdanovic, M., Price Mortimer, A., Bringmann, G., Reidl, J. (2004). PnuC and the Utilization of the Nicotinamide Riboside Analog 3-Aminopyridine in Haemophilus influenzae. Antimicrob. Agents Chemother. 48: 4532-4541 [Abstract] [Full Text]  
• Saridakis, V., Pai, E. F. (2003). Mutational, Structural, and Kinetic Studies of the ATP-binding Site of Methanobacterium thermoautotrophicum Nicotinamide Mononucleotide Adenylyltransferase. J. Biol. Chem. 278: 34356-34363 [Abstract] [Full Text]  
• Miller, E. S., Heidelberg, J. F., Eisen, J. A., Nelson, W. C., Durkin, A. S., Ciecko, A., Feldblyum, T. V., White, O., Paulsen, I. T., Nierman, W. C., Lee, J., Szczypinski, B., Fraser, C. M. (2003). Complete Genome Sequence of the Broad-Host-Range Vibriophage KVP40: Comparative Genomics of a T4-Related Bacteriophage. J. Bacteriol. 185: 5220-5233 [Abstract] [Full Text]  
• Kurnasov, O. V., Polanuyer, B. M., Ananta, S., Sloutsky, R., Tam, A., Gerdes, S. Y., Osterman, A. L. (2002). Ribosylnicotinamide Kinase Domain of NadR Protein: Identification and Implications in NAD Biosynthesis. J. Bacteriol. 184: 6906-6917 [Abstract] [Full Text]  
• Singh, S. K., Kurnasov, O. V., Chen, B., Robinson, H., Grishin, N. V., Osterman, A. L., Zhang, H. (2002). Crystal Structure of Haemophilus influenzae NadR Protein. A BIFUNCTIONAL ENZYME ENDOWED WITH NMN ADENYLYLTRANSFERASE AND RIBOSYLNICOTINAMIDE KINASE ACTIVITIES. J. Biol. Chem. 277: 33291-33299 [Abstract] [Full Text]  
• Gerdes, S. Y., Scholle, M. D., D'Souza, M., Bernal, A., Baev, M. V., Farrell, M., Kurnasov, O. V., Daugherty, M. D., Mseeh, F., Polanuyer, B. M., Campbell, J. W., Anantha, S., Shatalin, K. Y., Chowdhury, S. A. K., Fonstein, M. Y., Osterman, A. L. (2002). From Genetic Footprinting to Antimicrobial Drug Targets: Examples in Cofactor Biosynthetic Pathways. J. Bacteriol. 184: 4555-4572 [Abstract] [Full Text]  
• Kemmer, G., Reilly, T. J., Schmidt-Brauns, J., Zlotnik, G. W., Green, B. A., Fiske, M. J., Herbert, M., Krai{beta}, A., Schlor, S., Smith, A., Reidl, J. (2001). NadN and e (P4) Are Essential for Utilization of NAD and Nicotinamide Mononucleotide but Not Nicotinamide Riboside in Haemophilus influenzae. J. Bacteriol. 183: 3974-3981 [Abstract] [Full Text]  
• Mehl, R. A., Kinsland, C., Begley, T. P. (2000). Identification of the Escherichia coli Nicotinic Acid Mononucleotide Adenylyltransferase Gene. J. Bacteriol. 182: 4372-4374 [Abstract] [Full Text]  
• Emanuelli, M., Carnevali, F., Saccucci, F., Pierella, F., Amici, A., Raffaelli, N., Magni, G. (2001). Molecular Cloning, Chromosomal Localization, Tissue mRNA Levels, Bacterial Expression, and Enzymatic Properties of Human NMN Adenylyltransferase. J. Biol. Chem. 276: 406-412 [Abstract] [Full Text]  
• Saridakis, V., Christendat, D., Kimber, M. S., Dharamsi, A., Edwards, A. M., Pai, E. F. (2001). Insights into Ligand Binding and Catalysis of a Central Step in NAD+ Synthesis. STRUCTURES OF METHANOBACTERIUM THERMOAUTOTROPHICUM NMN ADENYLYLTRANSFERASE COMPLEXES. J. Biol. Chem. 276: 7225-7232 [Abstract] [Full Text]  
• Olland, A. M., Underwood, K. W., Czerwinski, R. M., Lo, M.-C., Aulabaugh, A., Bard, J., Stahl, M. L., Somers, W. S., Sullivan, F. X., Chopra, R. (2002). Identification, Characterization, and Crystal Structure of Bacillus subtilis Nicotinic Acid Mononucleotide Adenylyltransferase. J. Biol. Chem. 277: 3698-3707 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Raffaelli, N. Articles by Magni, G. Search for Related Content PubMed PubMed Citation Articles by Raffaelli, N. Articles by Magni, G.