Previous Article | Next Article 
Journal of Bacteriology, September 1999, p. 5516-5520, Vol. 181, No. 17
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Molecular Characterization of the PhoP-PhoQ
Two-Component System in Escherichia coli K-12:
Identification of Extracellular Mg2+-Responsive
Promoters
Akinori
Kato,
Hiroyuki
Tanabe, and
Ryutaro
Utsumi*
Department of Agricultural Chemistry, Kinki
University, 3327-204, Nakamachi, Nara 631-8505, Japan
Received 11 March 1999/Accepted 21 June 1999
 |
ABSTRACT |
We identified Mg2+-responsive promoters of the
phoPQ, mgtA, and mgrB genes of
Escherichia coli K-12 by S1 nuclease analysis. Expression
of these genes was induced by magnesium limitation and depended on PhoP
and PhoQ. The transcription start sites were also determined, which
allowed us to find a (T/G)GTTTA direct repeat in their corresponding
promoter regions.
 |
TEXT |
PhoP-PhoQ is a two-component
regulatory system that controls several virulence properties in the
gram-negative bacterium Salmonella typhimurium (6, 8,
11). Recently, extracellular Mg2+ has been identified
as a stimulus that affects the PhoP-PhoQ system. The PhoQ protein is a
Mg2+ sensor that changes conformation in the presence of
periplasmic Mg2+ (6). PhoP is a regulatory
protein that is necessary to transcribe some 25 different loci, many of
which are essential for growth at low Mg2+ concentration
(21).
The PhoP-PhoQ system is also present in Escherichia coli
(7, 12), Shigella flexneri, Yersinia
enterocolitica, and Yersinia pestis (8),
where a basic physiological role in response to Mg2+
starvation has been proposed (6). The PhoP and PhoQ proteins of E. coli and S. typhimurium are 93 and 86%
identical, respectively, indicating a high degree of structural and
functional similarity (7, 12). Divalent cations seems to
bind to an acidic cluster (148EDDDDAE154) of the E. coli
PhoQ sensor domain and stabilize a conformation inactive in signaling
(23). PhoP-PhoQ in E. coli is a promising system
for studying ligand-induced signal transduction because it is one of
the few two-component systems whose ligands have been identified.
However, the physiological role of the PhoP-PhoQ system in
E. coli is not understood. Here, we identified
extracellular Mg2+-responsive genes and promoters in
E. coli and investigated the regulation of their expression
by the PhoP-PhoQ system.
Isolation and identification of Mg2+-responsive
genes.
To isolate Mg2+-responsive genes, E. coli MC4100 (Table 1) was infected
with
placMu55 and
pMu507 as described by Bremar et al.
(3), and the resulting blue colonies were selected as
lac gene transcriptional fusion strains on a Luria-Bertani
(LB) medium plate (18) containing
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal;
40 µg/ml) and kanamycin (30 µg/ml). Bacteria were always grown at
37°C. Among 2,000 independent lacZ gene fusions,
Mg2+-responsive clones, which were white on MacConkey
plates containing 30 mM MgSO4 and were red in the
absence of Mg2+, were selected. A P1 phage lysate prepared
from the selected clones was used to infect MC4100 to obtain
kanamycin-resistant colonies (MG1301 and MG1601).
-Galactosidase
activity of lacZ fusion strains (MG1301 and MG1601) was
decreased significantly by 30 mM MgSO4 or 30 mM
MgCl2 but not by 30 mM Na2SO4
(Fig. 1), indicating that expression of
the fused genes was repressed by higher concentrations of
Mg2+. Fusion junctions were sequenced as follows.
placMu55 specialized transducing phage, which carries
various amounts of the adjacent host DNA, was prepared by UV
irradiation of the fusion strain (19). Aliquots (1.0 µg of
DNA) were sequenced directly with a PRISM Dye Terminator Cycle
Sequencing Ready Reaction kit with a Mu C-end primer (MU2;
5'-AATAATCCAATGTCCTCCCGG-3'). The PCR (25 cycles of 96°C
for 30 s, 57°C for 30 s, and 60°C for 4 min) identified
two Mg2+-responsive genes in E. coli K-12; one
(MG1601) was the mgtA gene encoding an ATP-dependent
Mg2+ transporter at 96.2 min on the chromosome (positions
8267 to 10963 in GenBank entry AE000495), and the other gene (MG1301) was a newly designated gene, mgrB, located at 41.2 min
(complementary to positions 68 to 211 in GenBank entry AE000277).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 1.
Gene expression dependent on Mg2+. E. coli MG1601 (lanes 1 to 4) and MG1301 (lanes 5 to 8) were grown in
LB medium and LB medium containing 30 mM MgSO4 (lanes 2 and
6), 30 mM MgCl2 (lanes 3 and 7), or 30 mM
Na2SO4 (lanes 4 and 8). An early-log-phase
(OD600, 0.4) culture was used to determine
-galactosidase activity (18). Data are the means of
triplicate values with standard deviations.
|
|
Isolation of phoPQ-defective strains by using
Tn10dCam.
To determine that expression of
Mg2+-responsive genes was controlled by both PhoP and PhoQ,
E. coli MG1301 was infected with
NK1324 grown on E. coli BD25 as described by Kleckner et al. (13).
Chloramphenicol-resistant (Camr) colonies (about 30,000)
were selected on MacConkey plates containing chloramphenicol (20 µg/ml), from which white colonies were isolated. A P1 phage lysate
prepared from one of them was used to infect MG1301, and
Camr colonies were isolated. We determined the
Tn10dCam insertion site by sequencing the genomic region
adjacent to Tn10dCam amplified by thermal asymmetric
interlaced PCR (15, 16). Consequently, three phoP
mutants (MG1320, MG1322, and MG1323) and four phoQ mutants
(MG1303, MG1306, MG1307, and MG1321) were identified. The mutant
strains defective in phoP (MG1622) and phoQ
(MG1607) were constructed by P1 transduction from MG1322 and MG1307 to MG1601, respectively (Table 1). When
-galactosidase activity was
assayed in phoP- and phoQ-defective strains,
neither mgtA nor mgrB was expressed, irrespective
of Mg2+ concentration (data not shown).
Identification of the promoter region of
Mg2+-responsive genes.
We determined the
transcriptional start sites of mgtA and mgrB as
well as phoPQ by S1 nuclease assay as follows. E. coli cells were grown in LB medium in the absence of
MgCl2 overnight, then diluted 100-fold into 20 ml of LB
medium in the presence or absence of 30 mM MgCl2, and grown
to mid-log phase (optical density at 600 nm [OD600], 0.5 to 0.8) to prepare total RNA (1). The S1 nuclease assay was
conducted as described previously (1, 6), with the following
modification. The RNA (20 to 100 µg) was mixed with the probe DNA in
50 µl of a hybridization buffer (80% formamide, 20 mM HEPES [pH
6.5], 0.4 M NaCl), incubated at 75°C for 10 min, and then incubated
at 37°C overnight. Then 220 µl of H2O and 30 µl of
10× S1 nuclease buffer (0.3 M sodium acetate [pH 4.5], 0.5 M
NaCl, 10 mM ZnSO4, 50% glycerol) were added, and the
mixture was treated with 50 U of S1 nuclease (Takara) at 37°C for 10 min. The reaction was stopped by adding 300 µl of phenol-chloroform, and the DNAs contained in the aqueous phase were precipitated with
ethanol. The precipitate was dissolved in a sequencing loading buffer (80% formamide, 10 mM NaOH, 1 mM EDTA, 0.025% bromophenol blue, 0.025% xylene cyanol) and electrophoresed in a 6 or 4%
acrylamide sequencing gel.
In the
E. coli strain (MC4100) grown in LB medium, two
transcripts (P1 and P2) of
phoPQ were found (Fig.
2a). The transcription
of P1 was
dependent on extracellular Mg
2+ concentration and was
decreased in
phoP (MP4022) or
phoQ (MQ4007)
mutants. In MC4100, MP4022, and MQ4007, the P2 transcript was
constitutively expressed in the presence or absence of
Mg
2+. For
mgtA and
mgrB, only one
transcript (P
mgtA and P
mgrB) was
found for each;
these transcripts were not detected in MP4022
and MQ4007 (Fig.
2b and
c). Gene expression in each of these defective
mutants was restored at
the lower Mg
2+ concentration upon transformation with
pHO119 (data not shown).
These results indicated that expression of
mgtA and
mgrB as well
as
phoPQ is
positively controlled by both PhoP and PhoQ in a
Mg
2+-dependent manner. In addition,
mgtA was
found to be specifically
transcribed during log phase but repressed
within 15 min after
the addition of 30 mM MgCl
2 (Fig.
3).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 2.
Transcriptional regulation of phoPQ,
mgtA, and mgrB. When grown to mid-log phase
(OD600, 0.5 to 0.8) in LB medium in the presence (+) or
absence ( ) of 30 mM MgCl2, cells of the indicated
E. coli strains were collected, and then RNA preparation and
S1 nuclease assay were done as described in the text. Probes A
(SalI-HincII [380-bp] DNA fragment of pHO19P),
B (AluI-DdeI [400-bp] fragment of pMGA19P), and
C (EcoRV-BstUI [600-bp] fragment of pMGB19P)
were used to determine start sites of phoPQ (a),
mgtA (b), and mgrB (c), respectively.
Electrophoresis was done with a 6% (a) or 4% (b and c) acrylamide
sequencing gel. Lanes A+G represent Maxam-Gilbert sequence reactions.
P1, P2, PmgtA, and PmgrB point to the
corresponding protected transcripts. Transcription start sites are
marked with asterisks. (d) DNA sequence (coding strand) around the
promoter of phoPQ (complementary to positions 4786 to 4837 of GenBank entry AE000213), mgtA (positions 7961 to 8012 of
AE000495), and mgrB (complementary to positions 229 to 280 of AE000277). Thin and bold arrows indicate starts and directions of
transcription and direct repeats, respectively. The putative 10
region of each promoter is boxed.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3.
Growth-phase-dependent transcription of mgtA.
After growth to exponential phase (OD600, 0.3) in LB
medium, cells of E. coli MC4100 were further cultivated in
the presence (b) or absence (a) of 30 mM MgCl2. Samples
were prepared at 0 min (lane 1), 15 min (lane 2), 30 min (lane 3),
1 h (lane 4), 2 h (lane 5), 4 h (lane 6), 6 h (lane
7), and 8 h (lane 8). RNA preparation and S1 nuclease assay were
done as described for Fig. 2. Lanes A+G represent Maxam-Gilbert
sequence reactions.
|
|
The direct repeat (T/G)GTTTA was conserved 25 bp upstream of
the transcriptional start site of
phoPQ (P1),
mgtA, and
mgrB (Fig.
2d). This direct repeat is
also found in the
phoPQ promoter
of
S. typhimurium (
20) and is very similar to one recognized
by the regulator PhoB (
17). Thus, (T/G)GTTTA is
assumed to be
a target for PhoP. A search of the entire
E. coli genome sequence
(4.64 Mb [
4a]) for a
(T/G)GTTTA-5 bp-(T/G)GTTTA or TAGTTA-5
bp-(T/G)GTTTA motif detected four genes, a
bor homolog,
ydcD,
a
fimD homolog, and
yrbL (12.5, 33.1, 34.4, and 72 min, respectively,
on the
chromosome), besides
phoP,
mgtA, and
mgrB. In fact, the
promoter of
yrbL was
Mg
2+ responsive (data not shown). In
S. typhimurium, this motif was
also found in the promoter region of
phoP,
mgtA,
mgtBC, and
pagA,
which are PhoP-activated genes, but many other
PhoP-activated
genes lack the consensus sequence (
11,
21).
Recently, the
expression of several genes was reported to be under the
direct
control of the PmrA-PmrB two-component system, in which PhoP
participates
by activating
pmrAB (
9,
22). These
results suggested that
some genes are regulated indirectly by PhoP
through other regulatory
factors.
In
S. typhimurium, the transcriptional start sites of the
phoPQ operon were previously identified (
6,
20).
Two RNA species
were detected in an exponentially grown
S. typhimurium culture.
These transcripts define two
promoters: P1, which requires both
PhoP and PhoQ for activity and
is regulated by environmental Mg
2+; and P2, which remains
active in the absence of PhoP and PhoQ
(
6,
20). We have
obtained similar results for the
E. coli phoPQ operon.
Identification of amino acid residues involved in the PhoP-PhoQ
signaling cascade.
To further examine the regulation by
phoPQ, we introduced a point mutation in the coding region
with respect to the putative PhoP phosphorylation site Asp51 and the
PhoQ autophosphorylation site His277 on pHO119 as follows.
Site-directed mutagenesis was performed by using a QuikChange
site-directed mutagenesis kit (Stratagene). pDA51 and pDN51 were
derived from pHO119, carrying phoP with changes of Asp51 to
Ala and Asn, respectively. pHR277 is a derivative of pHO119, carrying
phoQ with a change of His277 to Arg. Primers for the
site-directed mutagenesis were as follows: pDA51, forward
(5'GATATTGCGATTGTCGCTCTCGGATTGCC3') and reverse (5'GGCAATCCGAGAGCGACAATCGCAATATC3'); pDN51, forward
(5'GATATTGCGATTGTCAATCTCGGATTGCC3') and reverse
(5'GGCAATCCGAGATTGACAATCGCAATATC3'); and
pHR277, forward (5'CCGACCTGACCCGTAGTCTGAAAACGC3')
and reverse (GCGTTTTCAGACTACGGGTCAGGTCGG3').
As shown in Fig.
4, transcription of
phoPQ (P1),
mgtA, and
mgrB was not
observed when PhoQ H277R was expressed in the
phoQ mutant
(MQ4007) (Fig.
4, lanes 3, 4, 7, 8, 11, and 12). When the
wild-type
PhoQ was expressed, expression of
phoPQ,
mgtA,
and
mgrB was observed in the absence of Mg
2+ but
not in the presence of 30 mM Mg
2+ (lanes 1, 2, 5, 6, 9, and
10). The same result was obtained for
the
phoP mutant strain
(MP4022) and pDA51 or pDN51 (data not shown).
These results demonstrate
that Asp51 of PhoP and His277 of PhoQ
are indispensable for activation
of PhoP-PhoQ signaling and subsequent
expression of
mgtA and
mgrB.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of PhoQ H277R on transcription of
phoPQ, mgtA, and mgrB. E. coli MQ4007 in the presence of pHO119 (lanes 1, 2, 5, 6, 9, and
10) or pHR277 (lanes 3, 4, 7, 8, 11, and 12) was grown to mid-log phase
in LB medium in the presence (+) or absence ( ) of 30 mM
MgCl2 to prepare RNA. RNA preparation and S1 nuclease
assays were performed as described for Fig. 2.
|
|
Concluding remarks.
In this study, we tried to isolate
directly a Mg2+-responsive lacZ fusion strain of
E. coli. Among 2,000 independent lac gene transcriptional fusions, we identified two PhoP-activated genes, mgtA and mgrB. mgtA, encoding an
ATP-dependent Mg2+ transporter, is homologous to genes in
S. typhimurium, but mgrB is newly designated in
this report. mgtA was also found to be specifically
transcribed during log phase but repressed through the PhoP-PhoQ system
within 15 min after the addition of 30 mM MgCl2. These
results suggest that the PhoP-PhoQ-independent P2 promoter of E. coli provides a low intracellular concentration of PhoP and PhoQ
when magnesium is in excess, and upon shifting to limited magnesium,
autophosphorylated PhoQ serves as the phosphate donor for PhoP.
Phospho-PhoP autogenously activates the P1 promoter in the E. coli phoPQ operon, resulting in activation of mgtA gene expression to increase the intracellular Mg2+
concentration. Such a signaling cascade seems to be essential for
active growth of E. coli in a low-Mg2+ medium.
 |
ACKNOWLEDGMENTS |
We thank E. Bremar for providing bacterial strains and phages and
K. Yoshida for critical reading of the manuscript. We also thank H. Mori for computer search of PhoP target genes.
This work was financially supported by the Mishima Kaiun Memorial
Foundation and a Sasakawa Scientific Research Grant from the Japan
Science Society.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Agricultural Chemistry, Kinki University, 3327-204, Nakamachi, Nara
631-8505, Japan. Phone: 81-742-43-151. Fax: 81-742-43-1445. E-mail:
utsumi{at}nara.kindai.ac.jp.
 |
REFERENCES |
| 1.
|
Aiba, H.
1983.
Autoregulation of the Escherichia coli crp gene: CRP is a transcriptional repressor of its own gene.
Cell
32:141-149[Medline].
|
| 2.
|
Bernardi, A., and F. Bernardi.
1984.
Complete sequence of pSC101.
Nucleic Acids Res.
12:9415-9426[Abstract/Free Full Text].
|
| 3.
|
Bremar, E.,
T. J. Silhavy, and G. M. Weinstock.
1988.
Transposition of placMu is mediated by the A protein altered at its carboxy-terminal end.
Gene
71:177-186[Medline].
|
| 4.
|
Casadaban, M. J.
1976.
Transposition and fusion of lac genes to selected promoters in Escherichia coli using bacteriophage lambda and Mu.
J. Mol. Biol.
104:541-555[Medline].
|
| 4a.
| Escherichia coli WWW Home Page. 28 August
1998, revision date. [Online.] http://mol.genes.nig.ac.jp/ecoli/.
[16 July 1999, last date accessed.]
|
| 5.
|
Garcia-Vescovi, E.,
F. C. Soncini, and E. A. Groisman.
1994.
The role of the PhoP/PhoQ regulon in Salmonella virulence.
Res. Microbiol.
145:473-480[Medline].
|
| 6.
|
Garcia-Vescovi, E.,
F. C. Soncini, and E. A. Groisman.
1996.
Mg2+ as an extracellular signal: environmental regulation of Salmonella virulence.
Cell
84:165-174[Medline].
|
| 7.
|
Groisman, E. A.,
F. Heffron, and A. Solomon.
1992.
Molecular genetic analysis of the Escherichia coli phoP locus.
J. Bacteriol.
174:486-491[Abstract/Free Full Text].
|
| 8.
|
Groisman, E. A., and F. Heffron.
1995.
Regulation of Salmonella virulence by two-component regulatory systems, p. 319-332.
In
J. A. Hoch, and T. J. Silhavy (ed.), Two-component signal transduction. ASM Press, Washington, D.C.
|
| 9.
|
Gunn, J. S., and S. I. Miller.
1996.
PhoP-PhoQ activates transcription of pmrAB, encoding a two-component regulatory system involved in Salmonella typhimurium antimicrobial peptide resistance.
J. Bacteriol.
178:6857-6864[Abstract/Free Full Text].
|
| 10.
|
Gunn, J. S.,
E. L. Hohmann, and S. I. Miller.
1996.
Transcriptional regulation of virulence: a PhoQ periplasmic domain mutation results in increased net phosphotransfer to PhoP.
J. Bacteriol.
178:6369-6373[Abstract/Free Full Text].
|
| 11.
|
Hohmann, E. L., and S. I. Miller.
1994.
The Salmonella PhoP virulence regulon, p. 120-125.
In
A. Torriani-Gorini, E. Yagil, and S. Silver (ed.), Phosphate in microorganisms. ASM Press, Washington, D.C.
|
| 12.
|
Kasahara, M.,
A. Nakata, and H. Shinagawa.
1992.
Molecular analysis of the Escherichia coli phoP-phoQ operon.
J. Bacteriol.
174:492-498[Abstract/Free Full Text].
|
| 13.
|
Kleckner, N.,
J. Bender, and S. Gottesman.
1991.
Uses of transposons with emphasis on Tn10.
Methods Enzymol.
204:139-180[Medline].
|
| 14.
|
Kohara, Y.,
K. Akiyama, and K. Isono.
1987.
The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genome library.
Cell
50:495-508[Medline].
|
| 15.
|
Liu, Y.-G., and R. F. Whittier.
1995.
Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clone for chromosome walking.
Genomics
25:674-681[Medline].
|
| 16.
|
Liu, Y.-G.,
N. Mitsukawa,
T. Oosumi, and R. F. Whittier.
1995.
Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR.
Plant J.
8:457-463[Medline].
|
| 17.
|
Makino, K.,
M. Amemura,
S.-K. Kim,
A. Nakata, and H. Shinagawa.
1994.
Mechanism of transcriptional activation of the phosphate regulon in Escherichia coli, p. 5-12.
In
A. Torriani-Gorini, E. Yagil, and S. Silver (ed.), Phosphate in microorganisms. ASM Press, Washington, D.C.
|
| 18.
|
Miller, J. H.
1972.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 19.
|
Roy, R. N.,
S. Mukhopadhyay,
L. I. C. Wei, and H. E. Schellhorn.
1995.
Isolation and sequencing of gene fusions carried by placMu specialized transducing phage.
Nucleic Acids Res.
23:3076-3078[Free Full Text].
|
| 20.
|
Soncini, F. C.,
E. G. Vescovi,
F. Solomon, and E. A. Groisman.
1995.
Transcriptional autoregulation of the Salmonella typhimurium phoPQ operon.
J. Bacteriol.
177:4364-4371[Abstract/Free Full Text].
|
| 21.
|
Soncini, F. C.,
E. G. Vescovi,
F. Solomon, and E. A. Groisman.
1996.
Molecular basis of the magnesium deprivation response in Salmonella typhimurium: identification of PhoP-regulated genes.
J. Bacteriol.
178:5092-5099[Abstract/Free Full Text].
|
| 22.
|
Soncini, F. C., and E. A. Groisman.
1996.
Two-component regulatory systems can interact to process multiple environmental signals.
J. Bacteriol.
178:6796-6801[Abstract/Free Full Text].
|
| 23.
|
Waldburger, C. D., and R. T. Sauer.
1996.
Signal detection by the PhoQ sensor-transmitter.
J. Biol. Chem.
271:26630-26636[Abstract/Free Full Text].
|
| 24.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[Medline].
|
Journal of Bacteriology, September 1999, p. 5516-5520, Vol. 181, No. 17
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Yan, Q., Gao, W., Wu, X.-G., Zhang, L.-Q.
(2009). Regulation of the PcoI/PcoR quorum-sensing system in Pseudomonas fluorescens 2P24 by the PhoP/PhoQ two-component system. Microbiology
155: 124-133
[Abstract]
[Full Text]
-
Miyashiro, T., Goulian, M.
(2008). High stimulus unmasks positive feedback in an autoregulated bacterial signaling circuit. Proc. Natl. Acad. Sci. USA
105: 17457-17462
[Abstract]
[Full Text]
-
Song, H., Kong, W., Weatherspoon, N., Qin, G., Tyler, W., Turk, J., Curtiss, R. III, Shi, Y.
(2008). Modulation of the Regulatory Activity of Bacterial Two-component Systems by SlyA. J. Biol. Chem.
283: 28158-28168
[Abstract]
[Full Text]
-
Barchiesi, J., Castelli, M. E., Soncini, F. C., Vescovi, E. G.
(2008). mgtA Expression Is Induced by Rob Overexpression and Mediates a Salmonella enterica Resistance Phenotype. J. Bacteriol.
190: 4951-4958
[Abstract]
[Full Text]
-
Kong, W., Weatherspoon, N., Shi, Y.
(2008). Molecular Mechanism for Establishment of Signal-dependent Regulation in the PhoP/PhoQ System. J. Biol. Chem.
283: 16612-16621
[Abstract]
[Full Text]
-
Goldman, S. R., Tu, Y., Goldberg, M. B.
(2008). Differential Regulation by Magnesium of the Two MsbB Paralogs of Shigella flexneri. J. Bacteriol.
190: 3526-3537
[Abstract]
[Full Text]
-
Eguchi, Y., Itou, J., Yamane, M., Demizu, R., Yamato, F., Okada, A., Mori, H., Kato, A., Utsumi, R.
(2007). B1500, a small membrane protein, connects the two-component systems EvgS/EvgA and PhoQ/PhoP in Escherichia coli. Proc. Natl. Acad. Sci. USA
104: 18712-18717
[Abstract]
[Full Text]
-
Miyashiro, T., Goulian, M.
(2007). Stimulus-dependent differential regulation in the Escherichia coli PhoQ PhoP system. Proc. Natl. Acad. Sci. USA
104: 16305-16310
[Abstract]
[Full Text]
-
Bachhawat, P., Stock, A. M.
(2007). Crystal Structures of the Receiver Domain of the Response Regulator PhoP from Escherichia coli in the Absence and Presence of the Phosphoryl Analog Beryllofluoride. J. Bacteriol.
189: 5987-5995
[Abstract]
[Full Text]
-
Kato, A., Mitrophanov, A. Y., Groisman, E. A.
(2007). A connector of two-component regulatory systems promotes signal amplification and persistence of expression. Proc. Natl. Acad. Sci. USA
104: 12063-12068
[Abstract]
[Full Text]
-
Ogasawara, H., Hasegawa, A., Kanda, E., Miki, T., Yamamoto, K., Ishihama, A.
(2007). Genomic SELEX Search for Target Promoters under the Control of the PhoQP-RstBA Signal Relay Cascade. J. Bacteriol.
189: 4791-4799
[Abstract]
[Full Text]
-
Winfield, M. D., Latifi, T., Groisman, E. A.
(2005). Transcriptional Regulation of the 4-Amino-4-deoxy-L-arabinose Biosynthetic Genes in Yersinia pestis. J. Biol. Chem.
280: 14765-14772
[Abstract]
[Full Text]
-
Baxter, M. A., Jones, B. D.
(2005). The fimYZ Genes Regulate Salmonella enterica Serovar Typhimurium Invasion in Addition to Type 1 Fimbrial Expression and Bacterial Motility. Infect. Immun.
73: 1377-1385
[Abstract]
[Full Text]
-
Zwir, I., Shin, D., Kato, A., Nishino, K., Latifi, T., Solomon, F., Hare, J. M., Huang, H., Groisman, E. A.
(2005). Dissecting the PhoP regulatory network of Escherichia coli and Salmonella enterica. Proc. Natl. Acad. Sci. USA
102: 2862-2867
[Abstract]
[Full Text]
-
Yamamoto, K., Hirao, K., Oshima, T., Aiba, H., Utsumi, R., Ishihama, A.
(2005). Functional Characterization in Vitro of All Two-component Signal Transduction Systems from Escherichia coli. J. Biol. Chem.
280: 1448-1456
[Abstract]
[Full Text]
-
Winfield, M. D., Groisman, E. A.
(2004). Phenotypic differences between Salmonella and Escherichia coli resulting from the disparate regulation of homologous genes. Proc. Natl. Acad. Sci. USA
101: 17162-17167
[Abstract]
[Full Text]
-
Eguchi, Y., Okada, T., Minagawa, S., Oshima, T., Mori, H., Yamamoto, K., Ishihama, A., Utsumi, R.
(2004). Signal Transduction Cascade between EvgA/EvgS and PhoP/PhoQ Two-Component Systems of Escherichia coli. J. Bacteriol.
186: 3006-3014
[Abstract]
[Full Text]
-
Derzelle, S., Turlin, E., Duchaud, E., Pages, S., Kunst, F., Givaudan, A., Danchin, A.
(2004). The PhoP-PhoQ Two-Component Regulatory System of Photorhabdus luminescens Is Essential for Virulence in Insects. J. Bacteriol.
186: 1270-1279
[Abstract]
[Full Text]
-
Lejona, S., Aguirre, A., Cabeza, M. L., Vescovi, E. G., Soncini, F. C.
(2003). Molecular Characterization of the Mg2+-Responsive PhoP-PhoQ Regulon in Salmonella enterica. J. Bacteriol.
185: 6287-6294
[Abstract]
[Full Text]
-
Hagiwara, D., Sugiura, M., Oshima, T., Mori, H., Aiba, H., Yamashino, T., Mizuno, T.
(2003). Genome-Wide Analyses Revealing a Signaling Network of the RcsC-YojN-RcsB Phosphorelay System in Escherichia coli. J. Bacteriol.
185: 5735-5746
[Abstract]
[Full Text]
-
Eguchi, Y., Oshima, T., Mori, H., Aono, R., Yamamoto, K., Ishihama, A., Utsumi, R.
(2003). Transcriptional regulation of drug efflux genes by EvgAS, a two-component system in Escherichia coli. Microbiology
149: 2819-2828
[Abstract]
[Full Text]
-
Zhou, L., Lei, X.-H., Bochner, B. R., Wanner, B. L.
(2003). Phenotype MicroArray Analysis of Escherichia coli K-12 Mutants with Deletions of All Two-Component Systems. J. Bacteriol.
185: 4956-4972
[Abstract]
[Full Text]
-
Minagawa, S., Ogasawara, H., Kato, A., Yamamoto, K., Eguchi, Y., Oshima, T., Mori, H., Ishihama, A., Utsumi, R.
(2003). Identification and Molecular Characterization of the Mg2+ Stimulon of Escherichia coli. J. Bacteriol.
185: 3696-3702
[Abstract]
[Full Text]
-
Lesley, J. A., Waldburger, C. D.
(2003). Repression of Escherichia coli PhoP-PhoQ Signaling by Acetate Reveals a Regulatory Role for Acetyl Coenzyme A. J. Bacteriol.
185: 2563-2570
[Abstract]
[Full Text]
-
Kato, A., Latifi, T., Groisman, E. A.
(2003). Closing the loop: The PmrA/PmrB two-component system negatively controls expression of its posttranscriptional activator PmrD. Proc. Natl. Acad. Sci. USA
100: 4706-4711
[Abstract]
[Full Text]
-
Sanowar, S., Martel, A., Moual, H. L.
(2003). Mutational Analysis of the Residue at Position 48 in the Salmonella enterica Serovar Typhimurium PhoQ Sensor Kinase. J. Bacteriol.
185: 1935-1941
[Abstract]
[Full Text]
-
Brodsky, I. E., Ernst, R. K., Miller, S. I., Falkow, S.
(2002). mig-14 Is a Salmonella Gene That Plays a Role in Bacterial Resistance to Antimicrobial Peptides. J. Bacteriol.
184: 3203-3213
[Abstract]
[Full Text]
-
Verhamme, D. T., Arents, J. C., Postma, P. W., Crielaard, W., Hellingwerf, K. J.
(2001). Glucose-6-phosphate-dependent phosphoryl flow through the Uhp two-component regulatory system. Microbiology
147: 3345-3352
[Abstract]
[Full Text]
-
Robey, M., O'Connell, W., Cianciotto, N. P.
(2001). Identification of Legionella pneumophila rcp, a pagP-Like Gene That Confers Resistance to Cationic Antimicrobial Peptides and Promotes Intracellular Infection. Infect. Immun.
69: 4276-4286
[Abstract]
[Full Text]
-
Groisman, E. A.
(2001). The Pleiotropic Two-Component Regulatory System PhoP-PhoQ. J. Bacteriol.
183: 1835-1842
[Full Text]
-
Macfarlane, E. L. A., Kwasnicka, A., Hancock, R. E. W.
(2000). Role of Pseudomonas aeruginosa PhoP-PhoQ in resistance to antimicrobial cationic peptides and aminoglycosides. Microbiology
146: 2543-2554
[Abstract]
[Full Text]