Previous Article | Next Article 
Journal of Bacteriology, September 1999, p. 5557-5562, Vol. 181, No. 18
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Low-Temperature-Induced DnaA Protein Synthesis Does
Not Change Initiation Mass in Escherichia coli
K-12
T.
Atlung1,* and
F. G.
Hansen2
Department of Life Sciences and Chemistry,
Roskilde University, DK-4000 Roskilde,1 and
Department of Microbiology, The Technical University of
Denmark, DK-2800 Lyngby,2 Denmark
Received 26 March 1999/Accepted 2 July 1999
 |
ABSTRACT |
Expression of the dnaA gene continues in the lag phase
following a temperature downshift, indicating that DnaA is a cold shock protein. Steady-state DnaA protein concentration increases at low
temperatures, being twofold higher at 14°C than at 37°C. DnaA protein was found to be stable at both low and high temperatures. Despite the higher DnaA concentration at low temperatures, the mass per
origin, which is proportional to the initiation mass, was the same at
all temperatures. Cell size and cellular DNA content decreased
moderately below 30°C due to a decrease in the time from termination
to division relative to generation time at the lower temperatures.
Analysis of dnaA gene expression and initiation of
chromosome replication in temperature shifts suggests that a fraction
of newly synthesized DnaA protein at low temperatures is irreversibly
inactive for initiation and for autorepression or that all DnaA protein
synthesized at low temperatures has an irreversible low-activity conformation.
 |
INTRODUCTION |
Escherichia coli is a
mesophilic bacterium able to grow at temperatures as low as 8°C,
although the optimum growth temperature is around 37°C
(21). When a growing culture of E. coli is
shifted to a low temperature, there is a lag (acclimation) phase where net mass increase is very low. During this lag, synthesis of most proteins is severely reduced while a number of proteins, collectively termed cold shock proteins, are synthesized at increased rates (24). After resumption of growth, many cold shock proteins
are still synthesized at higher differential rates than at the optimum temperature.
Cell cycle control has been studied extensively for cells growing at or
near the optimum temperature. However, very little is known about these
events in cells growing at suboptimal temperatures or in cells
subjected to a cold shock, i.e., a sudden shift to a low temperature.
The major cell cycle event is the initiation of chromosome replication
at the chromosomal origin, oriC. Initiation is normally
controlled such that the mass per origin at the time of initiation, the
initiation mass, is the same irrespective of growth rate, when the
growth rate is varied by varying the medium composition (13,
16). The major factor in setting the initiation mass is the
initiator protein DnaA (3, 19, 28), which must be
accumulated to a certain level for initiation to take place (15). The initiation mass is changed when the level or
activity of DnaA protein is varied (18, 35) and when extra
copies of DnaA boxes are introduced into wild-type cells (10,
25). DnaA first binds to its binding sites, DnaA boxes, present
in oriC and at other positions on the chromosome, including
the dnaA promoter which is autorepressed (2, 7).
Subsequently, an initial complex consisting of approximately 20 DnaA
monomers is formed at oriC, and the double strand is melted
in the AT-rich 13-mer region, allowing entry of DnaB and DnaC to
generate the prepriming complex (36).
In fast-growing rich medium cultures, cells are born with four origins,
which are all initiated within a very short time span, i.e., very
synchronously (37). This indicates that there is an
initiation cascade which might be due to release of DnaA protein from a
newly replicated hemimethylated origin that is sequestered and unable
to rebind DnaA (27). The released DnaA will quickly lead to
initiation from remaining nonreplicated origins. This initiation
synchrony is disturbed by mutations in many different genes
(30), including dnaA(Ts) mutant strains grown at
permissive temperatures (39).
In the present work, we have studied the initiation control in E. coli grown in rich medium at suboptimal temperatures. DnaA protein
levels were monitored by immunoblot, and dnaA gene
expression was assessed by a dnaA::lacZ fusion.
We used flow cytometry to analyze initiation synchrony, assess DNA- and
origin-per-cell distributions, and determine the initiation mass. The
replication time, C, was determined by Southern blot
marker frequency analysis, and the time from termination to division
(D) was estimated from C and the amount of DNA
per cell.
 |
MATERIALS AND METHODS |
Bacterial strain, growth media, and conditions, and enzyme
measurements.
The strain used throughout this study, BBC119
(10), is a
lac derivative of C600 that is a
healthy K-12 strain and carries the
RB1 containing a
dnaA::lacZ fusion (7), which allows
determination of dnaA gene expression by measuring
DnaA-
-galactosidase activity as described previously (3,
31). AB minimal medium (11) supplemented with 1%
Casamino Acids (Difco), 0.2% glucose, and 1 µg of thiamine per ml
was used for all experiments. Before the start of the experiment,
cultures were kept in exponential growth at the different temperatures
for more than 15 mass doublings.
Immunoblot procedure.
Sample preparation and immunoblot
analysis were carried out as described previously (16).
Purified DnaA protein used as standard was obtained from Ole Skovgaard,
and the immunoblots were quantified with a Bio-Rad Molecular Analyst
GS-700 densitometer.
Flow cytometric procedures.
Samples were prepared and flow
cytometry was performed exactly as described in reference
10, based on the procedures described in references
28 and 38. The average number of
origins per cell and the average light scatter per cell were determined
in samples treated for 4 h at 37°C with rifampin (300 µg/ml)
and cephalexin (36 µg/ml). The DNA concentration was determined by analysis of the DNA content and light scatter of samples taken directly
from the exponentially growing cultures.
Determination of C by Southern blot marker frequency
analysis.
Chromosomal DNA was prepared and restricted with
HindIII, and Southern blot analysis was carried out as
described previously (3). A hybridization probe mixture was
prepared by labeling Qiaquick spin column purified PCR fragments with
[35S]dATP, using DNA polymerase I Klenow fragment and
random priming (Megaprime kit; Amersham). To prepare the probe mixture,
we used two PCR fragments, a 1,051-bp terC and a 1,196-bp
oriC fragment, which hybridize to 4.1- and 2.14-kb
chromosomal HindIII fragments, respectively. The
terC probe was produced by using pBD2348 (3) as
the template and the primers ter1 (GTTGAAGTACTTGAGTCACC) and ter2 (CATTCAGACTTGAATGCGTG). The oriC probe was
produced by using pFHC271 (17) as the template and the
primers ori4 (AAGAATGGCTGGGATCGTGG) and ori6
(ATCGAGGTTACTGCGGATCA). The oriC/terC ratio was
determined by measuring the intensities of hybridization to the 2.14- and the 4.1-kb fragments with the Bio-Rad Molecular Analyst GS-700 densitometer. The hybridization signals were normalized to the signals
of control plasmid pTAC4511 included on the gels, where the
oriC and terC bands are present in a 1:1 ratio.
Plasmid pTAC4511 was constructed by inserting the 2.14-kb
HindIII gidA fragment from pFHC271 into the
unique HindIII site of plasmid pBD2348. Plasmid pTAC4511
was digested with HindIII and NdeI to produce oriC and terC bands of the same or similar size
as those in the chromosomal DNA.
 |
RESULTS |
We have analyzed cultures grown at four different temperatures:
37°C for optimal growth; 30°C, which has been used frequently in
replication studies of dna(Ts) mutants; 21°C, which is the temperature where the Arrhenius plot of growth rate versus temperature shows an abrupt bend (21); and 14°C as the low temperature.
DnaA protein concentrations and dnaA gene
expression in balanced growth at different
temperatures.
Using the dnaA::lacZ
fusion, we measured dnaA gene expression at the four
different temperatures and found that it increased with decreasing
temperature (Fig. 1). The
DnaA-
-galactosidase specific activity was threefold higher in
14°C-grown cells than in those grown at 37°C. The
dnaA"lacZ fusion used is a protein fusion at codon 23 of the
dnaA gene. Thus, differences in DnaA-
-galactosidase specific activity at different temperatures reflect the combined effects on transcription and translation initiation but ignore the
possible effects on transcriptional polarity in dnaA and
differential effects on DnaA protein stability. Therefore, we also
determined the DnaA protein concentration by immunoblot analysis and
found that the DnaA protein itself was also increased at lower
temperatures (Fig. 1 and 2), being
twofold higher in cells grown at 14°C than in those grown at 37°C.
The difference between the increase in DnaA-
-galactosidase
(threefold) and DnaA protein itself (twofold), is not due to
proteolytic degradation of DnaA at the low temperature, since we found
that DnaA is stable at both 14 and 37°C. The amount of DnaA protein
stayed constant for four generations after inhibition of protein
synthesis (Fig. 2). The difference might therefore be due to increased
polarity in the dnaA gene at the low temperature since it
has been reported that there is transcription termination in the
C-terminal half of dnaA (34).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 1.
Replication control parameters at different
temperatures. Cultures of strain BBC119 were grown under conditions of
balanced growth in AB-thiamine-glucose-Casamino Acids supplemented
medium at the indicated temperatures. Samples were taken for flow
cytometric analysis of DNA, origins, and light scatter (LS), for
immunoblot analysis of DnaA protein, and for determination of
DnaA- -galactosidase specific activity. The indicated values are
averages of two (30 and 21°C) or three (14°C) independent
experiments, and error bars indicate ranges for the different
experiments. All values have been normalized to those determined in
parallel for the 37°C cultures. The actual values for DNA per cell
and origins per cell are shown in Table 1. We found that the cells at
37°C contained approximately 25 ng of DnaA per ml at
OD450 = 1, which is in accordance with previous
determinations (16), and that the specific activity of
DnaA- -galactosidase was 17 to 20 Miller units.
|
|

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 2.
DnaA protein is stable at different temperatures.
Cultures of strain BBC119 were grown under conditions of balanced
growth in AB-glucose-Casamino-Acids medium at 14 and 37°C. Rifampin
and cephalexin were added, and incubation was continued at the growth
temperature. Samples were taken for immunoblot analysis at time zero
and after approximately four culture generation times (corresponding to
31 h [14°C] and 2 h [37°C]).
|
|
Initiation control in balanced growth at different
temperatures.
The relative origin-per-mass ratio, which is
inversely proportional to initiation mass, was determined by flow
cytometric analysis of cells grown at the different temperatures.
Surprisingly, in view of the increasing DnaA protein concentration, we
found the same origin per mass irrespective of growth temperature (Fig. 1); in other words, the initiation mass is constant. Thus, this is one
of the few cases where a higher amount of wild-type DnaA protein does
not lead to increased origin per mass. Another example is E. coli B/r relative to K-12 (16).
The DNA concentration at different growth temperatures was also
determined by flow cytometric analysis. In view of the apparently constant origin concentration we also expected constant DNA
concentration, but found it to decrease slightly but significantly
below 30°C (Fig. 1). This difference is not caused by an increase in
C relative to generation time (
) at low temperature
(Table 1), suggesting that the cause for
the discrepancy is an overestimation of the origin concentration at low
temperature.
During this work it was reported that rifampin-resistant initiations
are provoked by high temperature stress in
E. coli
(
6).
For the determination of origins, we had incubated
samples with
rifampin at 37°C irrespective of initial growth
temperature. Therefore,
we compared the origins per cell of a 14°C
culture treated with
rifampin and cephalexin at 14°C and at 37°C to
those of a 37°C
culture. We followed the kinetics of termination of
replication
in these three rifampin-treated cultures by taking samples
for
flow cytometry at different times after addition of the drugs
(Fig.
3). When the 14°C culture completed
replication at 14°C,
the average cell contained 6.06 origins, whereas
the average cell
contained 6.80 origins after completion of replication
at 37°C.
The cell size was the same in cultures treated with rifampin
at
14 or at 37°C (data not shown). Thus, we have overestimated the
origin concentration at 14°C and probably also at 21°C.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
Runout kinetics after inhibition of initiation of
replication and cell division. Cultures of strain BBC119 were grown
under conditions of balanced growth in AB-glucose-Casamino-Acids medium
at 14 and 37°C (see Table 1 for generation times). Rifampin and
cephalexin were added at time zero, and incubation was continued at the
growth temperature (A and B), while half of the 14°C culture was
shifted to 37°C (C). Samples were taken at the indicated times and
fixed, stained, and analyzed by flow cytometry. All distributions were
normalized to contain the same number of cells.
|
|
The extra replication forks initiated in rifampin at 37°C were
significantly slower than normal forks at 37°C (Fig.
3C), giving
rise
to a peak of cells with 6 origins 45 min after drug addition.
These
forks had not yet terminated after 90 min (data not shown),
but the
last sample contained only fully replicated chromosomes.
The
37°C-grown cells terminated replication within two generation
times
(Fig.
3A, 65 min). The 14°C-grown cells, however, terminated
replication faster in rifampin at 14°C; replication was nearly
completed within one generation time (Fig.
3B, 7
h).
The final origin-per-cell distribution (Fig.
3) shows that synchronous
initiation occurs at multiple cellular origins at 14°C
and at 37°C.
Also, the extra initiations, provoked by shifting
the culture to 37°C
at the time of rifampin addition, are synchronous,
reflecting that
initiation of replication had occurred at all
four origins in some
cells.
Cell cycle parameters in balanced growth at different
temperatures.
The major cell cycle event is initiation of
replication; cell division follows C + D min later,
where C is the chromosome replication time and D
is the period from termination to division, during which time the
daughter chromosomes are decatenated and segregated and the septum is
formed. The number of origins per cell and genome equivalents of DNA
per cell (Table 1) are purely a function of C and
D relative to
. The amount of DNA per cell is
significantly lower in cells grown at a low temperature, and thus
C or D or both relative to
must be shorter.
If the drugs used to inhibit initiation of replication and cell
division work efficiently, C + D can be estimated from
the number of origins per cell determined by flow cytometry
(origins/cell = 2C + D/
), and
C can be estimated from the origins per DNA. But, in this case, where there are rifampin-resistant initiations at the lower temperatures, this method is not applicable.
C was instead determined by measuring the origin-to-terminus
ratio by Southern blot analysis, and
C/
was then
determined
from the formula
oriC/terC = 2
C/
. The results (Table
1) showed that
C relative to

varied little
with temperature, decreasing
slightly at lower temperature. Calculation
of
D/
from
C/
and DNA per cell showed that
D/
decreased significantly
below 30°C. The value for C of 42 min,
obtained at 37°C, is in
good agreement with
C determined
recently for another K-12 strain
(
5), while the
D
of 41 min is about twice what is normally
found in fast-growing B/r
cells (
8). The
D/
found at 14°C
would
correspond to a more normal
D of 24 min at 37°C.
Initiation mass and dnaA gene expression following
temperature shifts.
To get a clue to the cause of the higher
dnaA gene expression and the reason why higher DnaA protein
at a low temperature is not accompanied by higher origin per mass, we
shifted cultures in balanced growth (monitored by determination of
optical density at 450 nm [OD450]) from 37 to 14°C
(Fig. 4), and vice versa, and measured
origin per mass, DNA per mass, and DnaA-
-galactosidase activity.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Chromosome replication and dnaA gene
expression following a temperature downshift. Strain BBC119 was grown
under conditions of balanced growth in AB-glucose-Casamino Acids medium
at 37°C, and part of the culture was shifted to 14°C at the time
indicated by the arrow. (A) Growth was followed by measurement of
OD450, and the culture was diluted when the
OD450 reached 0.5. (B) Samples were taken for measurement
of origins per light scatter (LS), DNA per light scatter, and
DnaA- -galactosidase specific activity. Origins per light scatter
was determined in samples incubated with rifampin and cephalexin at
37°C. Open symbols, 37°C; black symbols, 14°C; gray symbols,
steady-state 14°C values.
|
|
When the culture was shifted from high to low temperature, growth
stopped for approximately 2.5 h (Fig.
4A) as previously
reported
for another wild type K-12 strain (
24). After the lag
(acclimation phase), which probably corresponds to the time required
for synthesis of sufficient amounts of the cold shock proteins
(
23,
24), growth resumed and very quickly reached a rate
identical
to that in balanced growth. The
dnaA gene
expression, measured
as DnaA-

-galactosidase activity started to
increase immediately
after the shift (Fig.
4B). DnaA-

-galactosidase
synthesis remained
high after resumption of growth, and the specific
activity reached
the steady-state level within two mass doublings after
the shift.
Also, DnaA protein concentrations increased to near
steady-state
levels during this time (data not shown). Initiation
frequency
increased immediately after the shift, resulting in a
1.7-fold
increase in origins per mass within the first mass doubling.
After
this time, origins per mass started to decrease but did not reach
the steady-state level within the time span of the shift experiment
(Fig.
4B). Origins per mass measured by incubation with rifampin
at
14°C followed the same kinetics (data not shown). A temperature
shift
from 37 to 21°C gave very similar results except that there
was no
growth lag, and the shift effects on
dnaA gene expression,
like that in steady state, and on initiation were of smaller magnitude
(data not shown). The downshift experiments indicate that
dnaA is one of the cold shock genes. In the first period
after temperature
downshift, the increase in DnaA protein synthesis
results in an
increase in initiation frequency. However, it seems that
after
some time at the low temperature the DnaA protein activity is
half of the 37°C activity, leading to the same apparent initiation
mass as obtained at 37°C.
When the opposite shift was carried out, growth continued without any
lag (Fig.
5A), although initially with a
lower rate
than in steady state. The growth rate gradually increased,
reaching
the steady-state rate after three mass doublings, suggesting
that
some cold shock proteins were inhibiting growth at 37°C and had
to be diluted out by growth. DnaA-

-galactosidase synthesis
gradually
declined after the shift, as seen most clearly from the plot
in
Fig.
5B, where the slope is equivalent to differential rate of
synthesis. DnaA-

-galactosidase synthesis approached the
steady-state
rate only after more than two mass doublings. These
kinetics suggest
that a low temperature-stimulatory factor for
dnaA gene expression
had to be diluted before the normal
37°C rate could be established.
It might also indicate that the
excess DnaA protein from 14°C
was not activated as an autorepressor
upon the temperature shift.
Origin per mass was virtually constant over
the shift (data not
shown), indicating that the excess DnaA protein was
incapable
of acting as an initiator.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
Growth and dnaA gene expression after
temperature upshift. Strain BBC119 was grown under conditions of
balanced growth in AB-glucose-Casamino Acids medium at 14°C, and part
of the culture was shifted to 37°C at the time indicated by the
arrow. (A) Growth was followed by measurement of OD450 and
the culture was diluted when the OD450 reached 0.5. Samples
were taken for measurement of DnaA- -galactosidase specific
activity. (B) Differential plot of values for DnaA- -galactosidase
activity against OD450 from panel A. Open symbols: 14°C;
black symbols, 37°C.
|
|
 |
DISCUSSION |
The results presented here show that the initiator protein DnaA is
a cold shock protein that is synthesized at higher rates and is present
at higher concentrations at low growth temperatures. In spite of a
twofold-higher DnaA concentration at 14°C than at 37°C, the
steady-state origin and DNA concentrations were found to be lower. This
results in a more than twofold-higher DnaA-per-oriC ratio in
cells grown at 14°C than in those grown at 37°C. In addition, we
found that C relative to
was very similar at all
growth temperatures, whereas D relative to
becomes
significantly shorter at the lower temperatures, resulting in less DNA
per cell.
Cold shock induction of the dnaA gene.
During the
lag following a downshift in growth temperature, synthesis of most
proteins is severely reduced while a number of proteins (cold shock
proteins) are synthesized at increased rates (24). Class I
cold shock proteins are those for which synthesis is increased more
than 10-fold and which are expressed at very low levels at 37°C
(32). Class II proteins, like GyrA, InfB, and H-NS, are
synthesized at high rates at 37°C and are induced only a fewfold upon
cold shock. In addition, synthesis of many ribosomal proteins is high
during the lag phase (23). DnaA clearly belongs to the class
II cold shock proteins: DnaA-
-galactosidase activity increases
during the lag phase, and initially after resumption of growth the
differential rate of synthesis is more than fourfold higher than at
37°C.
The primary cause of the growth lag is impaired initiation of
translation on most mRNAs (
23,
41), and this defect leads
to
decreased pppGpp and ppGpp levels (
29). Transcription of
the
dnaA gene, like that of ribosomal genes, is negatively
regulated
by ppGpp (
9). We therefore expect
dnaA
mRNA to increase upon
the temperature downshift. mRNAs for all
identified cold shock
proteins, both class I and class II, carry a
sequence motif, a
14-base downstream box, complementary to bases in 16S
RNA around
base 1475 (
40). This sequence motif, which is
required for translation
of the
cspA mRNA in the acclimation
phase, has been proposed to
mediate initiation of translation of all
cold shock genes in the
lag phase (
32). The downstream box
of class II genes starts
at the initiation codon (
32). When
we inspected the
dnaA mRNA
sequence, we found a very nice
homology to the downstream box
starting at the GUG codon located 12 bp
upstream of the GUG normally
considered to be the start codon for
dnaA (Fig.
6). Initiation
of
dnaA translation using the downstream box would thus produce
a DnaA protein with an N-terminal extension of four amino acids.
This
alternative product is probably an active DnaA protein, since
an
N-terminal fusion with a biotinylation domain shows DnaA activity
in
vivo (
1).

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 6.
Nucleotide sequence of the dnaA mRNA
translational initiation region. At the top is shown the 16S rRNA
sequence which is complementary to the downstream box (40).
In the dnaA mRNA sequence, the normal ribosome binding site
and GUG start codon are shown in bold; at the bottom is shown the DnaA
sequence translated from the first GUG start codon.
|
|
The increased DnaA concentration elicited by cold shock leads to a
transient increase in origin concentration which causes
a temporary
increase in
rrn operons and ribosomal protein operons
relative to other genes due to their origin proximal localization.
This
increased relative ribosomal gene dosage might help to restore
the
translation capacity during the transition from the lag phase
to
renewed
growth.
Rifampin-resistant initiations.
In agreement with the results
of Botello and Jiménez-Sánchez (6), we observed
rifampin-resistant initiations when cells grown at a low temperature
were incubated with the drug at a high temperature. In our experiment,
however, only a small fraction of the cells (10%) initiated after the
drug addition. Botello and Jiménez-Sánchez (6)
showed that the rifampin-resistant initiations were from the
oriC region but were abnormal in the sense that they
required RNase H and RecA. Rifampin-resistant initiations have
previously been characterized when DnaA protein in some of the mutants
in the P loop of the ATP binding site (e.g., dnaA601 and
dnaA606) is reactivated upon downshift in temperature (14). The capacity for rifampin-resistant initiation was
suggested to be dependent on DnaA since it decayed with the same
half-life as the mutant DnaA proteins. Furthermore, rifampin-resistant
initiation has been observed in cells overproducing wild-type DnaA
protein (1). We suggest that the rifampin-resistant
initiations elicited by shift to high temperature might be provoked by
the higher DnaA concentrations in cells grown at low temperature.
Inactivation of DnaA protein activity at low temperature.
In
contrast to the effects of increased DnaA protein levels at normal
growth temperatures (3, 4), we found that the higher DnaA
protein concentrations at low temperature than at 37°C did not lead
to higher origin concentration. Actually, origins per mass decreased
with decreasing growth temperature. Thus, initiation of chromosome
replication clearly requires more DnaA protein per oriC at
the lower temperatures. The downshift experiment showed that the DnaA
protein synthesized upon the cold shock increased the initiation
capacity and that the activity decreased slowly over several
generations of growth. The temperature upshift experiment indicated that the surplus DnaA protein synthesized at the low temperature was inactive both for initiation of chromosome replication and for dnaA autoregulation.
The low activity of DnaA at the low temperature might be caused by
folding problems due to the lower level of the chaperonins
DnaK, GroES,
and GroEL (
23). These chaperonins have been shown
to
reactivate mutant DnaA proteins (
20,
22). However, we
consider
this unlikely in view of the results of the temperature
upshift,
where levels of heat shock proteins should increase rapidly,
and
thus at least the DnaA synthesized at a higher rate shortly after
the shift should have normal
activity.
Therefore, we favor alternative hypotheses. The low DnaA activity could
be due to increased synthesis of an inhibitor at low
temperatures. The
level of unsaturated fatty acids increases at
low temperatures to
maintain membrane fluidity (
12). The inhibitory
factor is,
however, probably not the unsaturated acid phospholipids,
since an
increased level of unsaturation has been shown to stimulate
the ATP-ADP
exchange reaction that in vitro activates DnaA for
initiation
(
43). Among the proteins, SeqA is the prime candidate
for an
inhibitory factor, since it seems to be an inhibitor of
DnaA for both
initiation and autoregulation (
26,
42). Another
candidate is
IdiA, which inhibits DnaA initiation activity in
vitro by stimulation
of ATP hydrolysis (
33).
Alternatively, DnaA protein, expressed in cells growing at low
temperatures, may be synthesized in a form (maybe with four
extra
N-terminal amino acids) which shows altered binding characteristics
toward the different DnaA boxes present on the chromosome. In
such a
model, the low-temperature DnaA protein is postulated to
have lower
affinity for the
dnaA promoter and
oriC, leading
to
the observed twofold-higher DnaA protein concentration at 14°C,
which is needed to give a normal initiation mass at this temperature.
In the temperature downshift experiment, initially there will
be
sufficient 37°C DnaA protein available which, together with
the newly
synthesized protein, acts to temporarily decrease the
initiation mass.
However, after prolonged growth at 14°C, the
37°C DnaA protein will
be diluted out and the initiation mass
will be set exclusively by the
14°C DnaA protein. In the reciprocal
shift similar considerations can
be
applied.
We are presently investigating whether low-temperature DnaA protein is
predominantly the four-amino-acid-extended form and
whether
artificially produced DnaA protein of this variety has
lower activity
at 37°C.
 |
ACKNOWLEDGMENTS |
We thank Kirsten Olesen for technical assistance and Anders
Løbner-Olesen, Ulrik von Freiesleben, and Ole Skovgaard for
discussions and editorial advice on the manuscript.
This work was supported by grants from the Danish Natural Science
Research Council.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Life Sciences and Chemistry, Roskilde University, DK-4000 Roskilde,
Denmark. Phone: (45) 46 74 24 02. Fax: (45) 46 74 30 11. E-mail:
atlung{at}ruc.dk.
 |
REFERENCES |
| 1.
| Atlung, T. 1999. Unpublished work.
|
| 2.
|
Atlung, T.,
E. Clausen, and F. G. Hansen.
1985.
Autoregulation of the dnaA gene of Escherichia coli.
Mol. Gen. Genet.
200:442-450[Medline].
|
| 3.
|
Atlung, T., and F. G. Hansen.
1993.
Three distinct chromosome replication states are induced by increasing concentrations of DnaA protein in Escherichia coli.
J. Bacteriol.
175:6537-6545[Abstract/Free Full Text].
|
| 4.
|
Atlung, T.,
A. Løbner-Olesen, and F. G. Hansen.
1987.
Overproduction of DnaA protein stimulates initiation of chromosome and minichromosome replication in E. coli.
Mol. Gen. Genet.
206:51-59[Medline].
|
| 5.
|
Bipatnath, M.,
P. P. Dennis, and H. Bremer.
1998.
Initiation and velocity of chromosome replication in Escherichia coli B/r and K-12.
J. Bacteriol.
180:265-273[Abstract/Free Full Text].
|
| 6.
|
Botello, E., and A. Jiménez-Sánchez.
1997.
A temperature upshift induces initiation of replication at oriC on the Escherichia coli chromosome.
Mol. Microbiol.
26:133-144[Medline].
|
| 7.
|
Braun, R. E.,
K. O'Day, and A. Wright.
1985.
Autoregulation of the DNA replication gene dnaA in E. coli.
Cell
40:159-169[Medline].
|
| 8.
|
Bremer, H., and P. P. Dennis.
1996.
Modulation of chemical composition and other parameters of the cell by growth rate, p. 1553-1569.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, D.C.
|
| 9.
|
Chiaramello, A. E., and J. W. Zyskind.
1990.
Coupling of DNA replication to growth rate in Escherichia coli: a possible role for guanosine tetraphosphate.
J. Bacteriol.
172:2013-2019[Abstract/Free Full Text].
|
| 10.
|
Christensen, B. B.,
T. Atlung, and F. G. Hansen.
1999.
DnaA boxes are important elements in setting the initiation mass of Escherichia coli.
J. Bacteriol.
181:2683-2688[Abstract/Free Full Text].
|
| 11.
|
Clark, D. J., and O. Maaløe.
1967.
DNA replication and the division cycle in Escherichia coli.
J. Mol. Biol.
23:99-112.
|
| 12.
|
Cronan, J. E., Jr., and C. O. Rock.
1996.
Biosynthesis of membrane lipids, p. 612-636.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, D.C.
|
| 13.
|
Donachie, W. D.
1968.
Relationship between cell size and time of initiation of DNA replication.
Nature
219:1077-1079[Medline].
|
| 14.
|
Hansen, F. G.
1995.
Reinitiation kinetics in eight dnaA(Ts) mutants of Escherichia coli: rifampicin resistant initiation of chromosome replication.
Mol. Microbiol.
15:133-140[Medline].
|
| 15.
|
Hansen, F. G., and T. Atlung.
1995.
Initiation of chromosome replication after induction of DnaA protein synthesis in a dnaA(null) rnh mutant of Escherichia coli.
Mol. Microbiol.
15:149-154[Medline].
|
| 16.
|
Hansen, F. G.,
T. Atlung,
R. E. Braun,
A. Wright,
P. Hughes, and M. Kohiyama.
1991.
Initiator (DnaA) protein concentration as a function of growth rate in Escherichia coli and Salmonella typhimurium.
J. Bacteriol.
173:5194-5199[Abstract/Free Full Text].
|
| 17.
|
Hansen, F. G.,
S. Koefoed,
K. von Meyenburg, and T. Atlung.
1981.
Transcription and translation events in the oriC region of the E. coli chromosome.
ICN-UCLA Symp. Mol. Cell. Biol.
22:37-55.
|
| 18.
|
Hansen, F. G., and K. V. Rasmussen.
1977.
Regulation of the dnaA product in E. coli.
Mol. Gen. Genet.
155:219-225[Medline].
|
| 19.
|
Herrick, J.,
M. Kohiyama,
T. Atlung, and F. G. Hansen.
1996.
The initiation mess?
Mol. Microbiol.
19:659-666[Medline].
|
| 20.
|
Hupp, T. R., and J. M. Kaguni.
1993.
Activation of mutant forms of DnaA protein of Escherichia coli by DnaK and GrpE proteins occurs prior to DNA replication.
J. Biol. Chem.
268:13143-13150[Abstract/Free Full Text].
|
| 21.
|
Ingraham, J. L., and A. G. Marr.
1996.
Effect of temperature, pressure, pH, and osmotic stress on growth, p. 1570-1577.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, D.C.
|
| 22.
|
Jenkins, A. J.,
J. B. March,
I. R. Oliver, and M. Masters.
1986.
A DNA fragment containing the groE genes can suppress mutations in the E. coli dnaA gene.
Mol. Gen. Genet.
202:446-454[Medline].
|
| 23.
|
Jones, P. G., and M. Inouye.
1996.
RbfA, a 30S ribosomal binding factor, is a cold-shock protein whose absence triggers the cold-shock response.
Mol. Microbiol.
21:1207-1218[Medline].
|
| 24.
|
Jones, P. G.,
R. A. VanBogelen, and F. C. Neidhardt.
1987.
Induction of proteins in response to low temperature in Escherichia coli.
J. Bacteriol.
169:2092-2095[Abstract/Free Full Text].
|
| 25.
|
Kitagawa, R.,
T. Ozaki,
S. Moriya, and T. Ogawa.
1998.
Negative control of replication initiation by a novel chromosomal locus exhibiting exceptional affinity for Escherichia coli DnaA protein.
Genes Dev.
12:3032-3043[Abstract/Free Full Text].
|
| 26.
|
Lu, M.,
J. L. Campbell,
E. Boye, and N. Kleckner.
1994.
SeqA: a negative modulator of replication initiation in E. coli.
Cell
77:413-426[Medline].
|
| 27.
|
Løbner-Olesen, A.,
F. G. Hansen,
K. V. Rasmussen,
B. Martin, and P. L. Kuempel.
1994.
The initiation cascade for chromosome replication in wild-type and Dam methyltransferase deficient Escherichia coli cells.
EMBO J.
13:1856-1862[Medline].
|
| 28.
|
Løbner-Olesen, A.,
K. Skarstad,
F. G. Hansen,
K. von Meyenburg, and E. Boye.
1989.
The DnaA protein determines the initiation mass of Escherichia coli K-12.
Cell
57:881-889[Medline].
|
| 29.
|
Mackow, E. R., and F. N. Chang.
1983.
Correlation between RNA synthesis and ppGpp content in Escherichia coli during temperature shifts.
Mol. Gen. Genet.
192:5-9[Medline].
|
| 30.
|
Messer, W., and C. Weigel.
1996.
Initiation of chromosome replication, p. 1578-1601.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, D.C.
|
| 31.
|
Miller, J. H.
1972.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 32.
|
Mitta, M., and M. Inouye.
1997.
Deletion analysis of cspA of Escherichia coli: requirement of the AT-rich UP element for cspA transcription and the downstream box in the coding region for its cold shock induction.
Mol. Microbiol.
26:321-335[Medline].
|
| 33.
|
Mizushima, T.,
S. Nishida,
K. Kurokawa,
T. Katayama,
T. Miki, and K. Sekimizu.
1997.
Negative control of DNA replication by hydrolysis of ATP bound to DnaA protein, the initiator of chromosomal DNA replication in Escherichia coli.
EMBO J.
16:3724-3730[Medline].
|
| 34.
|
Perez-Roger, I.,
F. Macian, and M. E. Armengod.
1995.
Transcription termination in the Escherichia coli dnaA gene is not mediated by the internal DnaA box.
J. Bacteriol.
177:1896-1899[Abstract/Free Full Text].
|
| 35.
|
Schaus, N. A.,
K. O'Day,
W. Peters, and A. Wright.
1981.
Isolation and characterization of amber mutations in gene dnaA of Escherichia coli K-12.
J. Bacteriol.
145:904-913[Abstract/Free Full Text].
|
| 36.
|
Sekimizu, K.,
D. Bramhill, and A. Kornberg.
1988.
Sequential early stages in the in vitro initiation of replication at the origin of the Escherichia coli chromosome.
J. Biol. Chem.
263:7124-7130[Abstract/Free Full Text].
|
| 37.
|
Skarstad, K.,
E. Boye, and H. B. Steen.
1986.
Timing of initiation of chromosome replication in individual E. coli cells.
EMBO J.
5:1711-1717[Medline].
|
| 38.
|
Skarstad, K.,
H. B. Steen, and E. Boye.
1985.
Escherichia coli DNA distributions measured by flow cytometry and compared with theoretical computer simulations.
J. Bacteriol.
163:661-668[Abstract/Free Full Text].
|
| 39.
|
Skarstad, K.,
K. von Meyenburg,
F. G. Hansen, and E. Boye.
1988.
Coordination of chromosome replication initiation in Escherichia coli: effects of different dnaA alleles.
J. Bacteriol.
170:852-858[Abstract/Free Full Text].
|
| 40.
|
Sprengart, M. L.,
E. Fuchs, and A. G. Porter.
1996.
The downstream box: an efficient and independent translation initiation signal in Escherichia coli.
EMBO J.
15:665-674[Medline].
|
| 41.
|
VanBogelen, R. A., and F. C. Neidhardt.
1990.
Ribosomes as sensors of heat and cold shock in Escherichia coli.
Proc. Natl. Acad. Sci. USA
87:5589-5593[Abstract/Free Full Text].
|
| 42.
|
von Freiesleben, U.,
K. V. Rasmussen, and M. Schaechter.
1994.
SeqA limits DnaA activity in replication from oriC in Escherichia coli.
Mol. Microbiol.
14:763-772[Medline].
|
| 43.
|
Yung, B. Y. M., and A. Kornberg.
1988.
Membrane attachment activates dnaA protein, the initiation protein of chromosome replication in Escherichia coli.
Proc. Natl. Acad. Sci. USA
85:7202-7205[Abstract/Free Full Text].
|
Journal of Bacteriology, September 1999, p. 5557-5562, Vol. 181, No. 18
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Rodrigues, D. F., Tiedje, J. M.
(2008). Coping with Our Cold Planet. Appl. Environ. Microbiol.
74: 1677-1686
[Full Text]
-
Riber, L., Lobner-Olesen, A.
(2005). Coordinated Replication and Sequestration of oriC and dnaA Are Required for Maintaining Controlled Once-per-Cell-Cycle Initiation in Escherichia coli. J. Bacteriol.
187: 5605-5613
[Abstract]
[Full Text]
-
Skovgaard, O., Lobner-Olesen, A.
(2005). Reduced initiation frequency from oriC restores viability of a temperature-sensitive Escherichia coli replisome mutant. Microbiology
151: 963-973
[Abstract]
[Full Text]
-
Atlung, T., Hansen, F. G.
(2002). Effect of Different Concentrations of H-NS Protein on Chromosome Replication and the Cell Cycle in Escherichia coli. J. Bacteriol.
184: 1843-1850
[Abstract]
[Full Text]