Previous Article | Next Article 
Journal of Bacteriology, September 1999, p. 5771-5782, Vol. 181, No. 18
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Multiple Mechanisms Are Used for Growth Rate and
Stringent Control of leuV Transcriptional Initiation in
Escherichia coli
Dmitry K.
Pokholok,1,
Maria
Redlak,1
Charles L.
Turnbough Jr.,2
Sara
Dylla,2 and
Walter M.
Holmes1,*
Institute of Structural Biology and Drug
Discovery and Department of Microbiology and Immunology, Medical
College of Virginia of Virginia Commonwealth University, Richmond,
Virginia 23219-0133,1 and Department of
Microbiology, University of Alabama at Birmingham, Birmingham, Alabama
352942
Received 26 February 1999/Accepted 12 July 1999
 |
ABSTRACT |
Expression of the Escherichia coli leuV operon, which
contains three tRNA1Leu genes, is regulated by several
mechanisms including growth-rate-dependent control (GRDC) and stringent
control (SC). Structural variants of the leuV promoter
which differentially affect these regulatory responses have been
identified, suggesting that promoter targets for GRDC and SC may be
different and that GRDC of the leuV promoter occurs in the
absence of guanosine 3',5'-bisdiphosphate. To determine the mechanisms
of the leuV promoter regulation, we have examined the
stability of promoter open complexes and the effects of nucleotide triphosphate (NTP) concentration on the efficiency of the
leuV promoter and its structural variants in vitro and in
vivo. The leuV promoter open complexes were an order of
magnitude more stable to heparin challenge than those of
rrnBp1. The major initiating nucleotide GTP as
well as other NTPs increased the stability of the leuV
promoter open complexes. When the cellular level of purine triphosphates was increased at slower growth rates by pyrimidine limitation, a 10% reduction in leuV promoter activity was
seen. It therefore appears that transcription initiation from the
leuV promoter is less sensitive to changes in intracellular
NTP concentration than that from rrnBp1.
Comparative analysis of regulation of the leuV promoter
with and without upstream activating sequences (UAS) demonstrated that
the binding site for factor of inversion stimulation (FIS) located in
UAS is essential for maximal GRDC. Moreover, the presence of UAS
overcame the effects of leuV promoter mutations, which
abolished GRDC of the leuV core promoter. However, although the presence of putative FIS binding site was essential for optimal GRDC, both mutant and wild-type leuV promoters containing
UAS showed improved GRDC in a fis mutant background,
suggesting that FIS protein is an important but not unique participant
in the regulation of the leuV promoter.
 |
INTRODUCTION |
The tRNA multigene family of
Escherichia coli consists of 84 structural genes, which
produce 46 tRNA species (9). The production of tRNA is
closely regulated such that under various physiological conditions the
amount of tRNA produced is optimal for protein synthesis
(16). It has become apparent that the use of synonymous codons for a given amino acid is not random but strongly biased so that
the codon chosen is precisely correlated with the relative abundance of
the respective tRNA species among the isoacceptors. This is
particularly true for highly expressed genes, while, in weakly
expressed genes, synonymous codons recognized by rare tRNA species are
used with appreciable frequency. It is therefore important and
interesting to understand the factors which ensure that the cellular
complement of anticodons is optimal for all physiological conditions.
Earlier estimates showed that as the growth rate (expressed as
doublings per hour) increases from 0.6 to 2.5, tRNA concentration increases from 6.3 × 104 to 7 × 105
molecules per cell (10), which has been referred to as
growth-rate-dependent control (GRDC). A recent study has demonstrated
that the cellular concentration of numerous tRNA species is under GRDC
and that factor for inversion stimulation (FIS) is required for
the regulation of several tRNA species (35).
When protein synthesis is inhibited in E. coli by amino acid
starvation or with analogues, tRNA synthesis, like rRNA synthesis, is
strongly curtailed and the cellular level of guanosine
3',5'-bisdiphosphate (ppGpp) is dramatically increased. This response
has been referred to as the stringent response. Analyses of the
synthesis of individual tRNA species suggest that most if not all
species are subject to stringent control (SC) (7, 26, 43).
It has been proposed that both GRDC and SC are modulated by the
intracellular level of ppGpp, but this remains controversial since it
has been previously reported that rRNA promoters appear to display
growth-rate-dependent activity in cells which cannot synthesize ppGpp
(19). It seems clear from a number of studies that ppGpp is
absolutely required for the stringent response (12, 13, 19,
22-24).
Added complexities of the control of rRNA genes have emerged from
studies that demonstrated that these highly expressed genes show some
form of feedback inhibition, perhaps involving ribosomes or factors
which interact with them (20, 21). Other data which were
interpreted to be in conflict with this idea have been presented (3). A study by Vogel et al. reported that when a
pyrBI strain was exposed to partial pyrimidine starvation,
levels of ppGpp correlated directly with growth rate and the rates of
rRNA synthesis (44). In addition, it was proposed that
postinitiation effects of ppGpp may be an important factor in SC and/or
GRDC (45). A number of studies have shown clearly that ppGpp
affects RNA polymerase elongation rates in vivo and in vitro (28,
29, 46).
Yet another level of control for rrn promoters has recently
been proposed (18). It was shown that at least two E. coli rrn promoters (rrnBp1 and
rrnDp1) require relatively high levels of initiating nucleotide triphosphates (NTPs) for optimal activity and
that unstable open complexes of promoters are stabilized by high
concentrations of initiating NTPs. It was reported that promoter activity increased as a function of NTP concentration in vivo and in
vitro. In view of these results, it was proposed that the GRDC of
rrnp1 promoters as well as the homeostatic
regulation of ribosomal synthesis might be explained by the response of
these promoters to intracellular NTP concentrations (18).
The leuV operon is located at 98 min of the E. coli genome from which three tRNA1Leu genes are
transcribed. In our previous studies, we have shown that the
leuV promoter (leuVp) shares several features
with rrnp1 promoters. First, the leuV
promoter contains upstream activating sequences (UAS) and an upstream
element (UP) (7). In addition, FIS appears to bind the UAS
and is required for optimal promoter activity (39). We have
also shown that the core promoter lacking UP and UAS sequences displays
some GRDC but that sequences which flank the core promoter are required
for optimal GRDC as well (15).
In this study, we have attempted to determine the extent to which
mechanisms for GRDC are employed by tRNA genes. In addition, we wished
to determine the extent to which the various mechanisms for GRDC might
be shared with the well-studied rrnp1 promoters. In particular, we have examined the putative role of NTP concentration and UAS in regulation of the leuV promoter. We report here
that a tRNA promoter displays important differences from
rrnBp1 in this regard and that multiple
mechanisms are clearly required for the expression of this tRNA gene.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
E. coli DJ480
(MG1655 lacZ) was used as a host for measurements of GRDC
and was a gift from Ding Jun Jin (National Cancer Institute, National
Institutes of Health [NIH]). Strain RLG1072, which harbors a
lysogen with polylinker cloning sites upstream of the
trp-lacZ fusion, and
fis::kan767 strain RLG1379
were a gift from Richard L. Gourse (University of Wisconsin at
Madison). Three lysogenic strains containing leuV
promoter-lacZ fusions with deletions or mutations in the
upstream FIS binding site (containing residues
107 to +11, for
example, and/or amino acid changes shown in parentheses) were also
obtained from the Gourse laboratory. They are RLG4043
[leuV(
107 +11)-lacZ], RLG4045
[leuV(
107 +11, T-72G, T-71G)-lacZ], and
RLG4044 [leuV(
47 +11)-lacZ] (39). All three are lysogens prepared with the MG1655-derived strain, RLG4006
(lac
145thi-39::Tn10). Another MG1655
derivative, CF1693 (relA251 spoT207) producing no detectable
ppGpp was a gift from M. Cashel (NIH, Bethesda, Md.) (47).
The pyrimidine auxotroph strain, CLT246
(car-403::Tn10
lacIZ) (38)
was utilized to provoke changes in NTP levels in vivo. This strain was
constructed by transduction of
car-403::Tn10 into strain VH1000, a
lacIZ pyrE+ derivative of strain MG1655. VH1000
was a gift of J. Hernandez.
M9 minimal medium (30) for growth of MG1655 derivatives was
routinely supplemented with uracil (50 mg/liter) and thiamine (10 mg/liter). Media used for GRDC experiments were as follows: medium 1, M9 plus 0.2% glycerol; medium 2, M9 plus 0.2% glucose; medium 3, M9
plus 0.2% glucose and 0.2% Casamino Acids; and medium 4, M9 plus
0.4% glucose and 0.5% Casamino Acids. Luria broth was used for
routine cloning procedures and as medium 5 for GRDC experiments.
Ultrapure NTPs were purchased from Pharmacia Biotech,
32P-labeled nucleotides were obtained from NEN DuPont.
Supercoiled plasmid
DNA was isolated by double ultracentrifugation in
CsCl. Enzymes
for molecular cloning were purchased from New England
Biolabs.
E. coli RNA polymerase was purchased from Amersham.
Avian myeloblastosis
virus reverse transcriptase was purchased from
Promega.
Preparation of mutant promoters.
The parental plasmid in
this study was pLC76 (8), which was originally derived from
pKK232-8 (11). It contains the leuV(
50 +11)
promoter located just upstream of the chloramphenicol acetyltransferase (cat) gene flanked by recognition sites for unique
restriction endonucleases ClaI and HindIII.
Plasmid pLTC76 was derived by the insertion of the trp
attenuator termination of transcription sequence into a unique
HindIII site of plasmid pLC76. This site was located
between the leuV promoter and the reporter cat
gene. The inserted trp attenuator sequence contained a
unique NsiI site which was used for further cloning
procedures. PCR fragments containing relevant portions of the
leuV operon were directionally cloned into pLTC76 digested
with restriction endonucleases ClaI and NsiI. This provided a termination signal for in vitro transcription initiated
at the leuV promoter. Transcripts ranging from 86 to 194 nucleotides long were produced from these constructions during in vitro
transcription. Single-base substitution G to C at position +7 of the
leuV operon created a recognition site for the unique restriction endonuclease KpnI. We have observed no effect of
this substitution on transcription in vitro and on regulation of the leuV operon expression in vivo. Mutations in the promoter
region were generated by oligonucleotide-directed mutagenesis using
PCR. Previously described sites for restriction endonucleases
ClaI and KpnI were used to clone mutant versions
of the leuV promoter. The same sites were used to clone the
tac promoter sequence which initiates the transcription of
the leuV operon with GTP. The sequence of this promoter
flanked by recognition sites for endonucleases ClaI and
KpnI was
39GAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGG+1.
pRLG1617 was a gift from Richard L. Gourse (University of
Wisconsin at Madison).
Single-copy

lysogens containing
leuV
promoter-
lacZ fusions were constructed as previously
described (
32). Appropriate
leuV promoter
derivatives prepared in this laboratory contained
either residues

50
to +11 for core promoter or residues

107
to +11 for promoter with
UAS, with the exception of the
leuV promoter
used for
measurements of GRDC in the ppGpp

strain, which contained
residues

107 to +55 (
15). Promoter
fragments were prepared
by PCR, digested with restriction enzymes
EcoRI and
HindIII, ligated to the left and right arms of

,
packaged
in vitro, and used to lysogenize appropriate hosts as
described
previously (
7,
8). All mutations and

lysogens
were confirmed
by DNA sequence analyses. All strains were checked for
double
lysogens as previously outlined (
37).
-Galactosidase assays for GRDC.
Measurements were
performed on promoter-lacZ fusions as described previously
(31) with minor modifications. Lysogen cultures were grown
at 30°C in defined media listed above.
-Galactosidase specific
activity was determined in extracts prepared by sonication of cells
collected at mid-log phase by centrifugation and resuspended in
appropriate buffer. Values were expressed as nanomoles of
o-nitrophenyl-
-D-galactopyranoside (ONGP)
cleaved per minute per milligram of protein. Protein concentrations were measured by using the Bio-Rad protein assay reagent according to
provided protocols with immunoglobulin G as protein standard.
Primer extension assay for SC.
Single-copy
lysogens
containing the appropriate leuV promoter-lacZ
fusions were used for SC measurements. Cultures of test strains were
grown overnight at 30°C in Luria broth or medium 2 (see above). After
dilution to an A600 of 0.05, cells were grown to
an A600 of approximately 0.6 and each test
culture was divided into two aliquots. The stringent response was
provoked in the first aliquot of each culture by the addition of serine
hydroxamate (Sigma) to a final concentration of 1 mg/ml. The other half
received an equal volume of distilled water. Thirty minutes after the
addition of serine hydroxamate or water, 300 µl of mid-log reference
culture was added to each test sample. Total RNA was then isolated as previously described (41). The above reference culture was
strain MG1655 harboring the plasmid pLTC76 which contains the
leuV(
50 +11) promoter inserted into the polylinker site
upstream of the trp attenuator. Unique transcripts derived
from this reference construct serve to correct for variations in RNA
isolation and efficiency of primer extension reactions. Each RNA sample
was split and probed with test or reference primers. Primer extension of RNA derived from the reference strain was performed by using the
unique sequence primer 5'GCTTATCGATACCGTCGACCTCGAGGGG3'.
This probe primes only transcripts initiated at the plasmid-borne
leuV promoter and produces reverse transcripts 44 nucleotides long. Since only a few residues of the tRNA gene sequences
were present, tRNA processing pathways were not operative and therefore
not a factor in quantitations.
In addition to the reference primer, all samples were also probed as
described previously (
2) using the test primer
5'CTACCAATTCCGCCACCTTCGCATACCATC3'.
This sequence is located
within the

-galactosidase gene and yields
reverse transcripts 68 nucleotides
long.
After electrophoresis in 8% denaturing polyacrylamide gels (7 M urea
included), bands were visualized by autoradiography and
quantified by
radioanalytical imaging using ImageQuant PhosphorImager
software
(Molecular Dynamics, Sunnyvale, Calif.).
Determination of promoter activity in response to in vivo
pyrimidine limitation.
To address the question of leuV
promoter responses to in vivo purine levels, the pyrimidine auxotroph
CLT246 was lysogenized with one of two phages containing
leuV promoter-lacZ fusions. The constructions
included the leuV(
107 +55) promoter and the D mutant,
which contains T substitutions at positions 4, 5, and 7 in the
discriminator region (Fig. 1). In the
pyrimidine auxotroph strain, CLT246, the first enzyme in the pyrimidine
biosynthesis pathway is insertionally inactivated (38).
Cellular pyrimidine concentrations and growth rate were modulated by
growing cells in C medium (1) supplemented with 1 mM
arginine, 0.4% glucose, 0.25 mM UMP, and MgSO4 ranging in
concentrations from 0.2 to 0.8 mM.
-Galactosidase activities were
measured as described above.

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 1.
leuV promoter sequence and structural
variants. 10 and 35 regions are underlined, and the numbering of
bases in the discriminator starts from the 10 region. Note the G
substitutions at positions 72 and 71. Promoter variants in the
discriminator region are shown in bold type, and all contain sequences
from positions 50 to +11 of the leuV promoter
(14) fused directly to trp-lacZ fusion sequences
in the phage employed for lysogen formation.
|
|
In vitro transcription.
Reaction mixtures (10 µl)
contained the following: 50 mM Tris-HCl (pH 7.9); 5 mM
MgCl2; 0.1 mM dithiothreitol; 0.1 mg of bovine serum
albumin per ml; 200 µM (each) ATP, CTP, or GTP; 20 µM UTP including
[
-32P]UTP; supercoiled DNA; RNA polymerase; and
various concentrations of KCl or potassium glutamate. When other
-32P-labeled NTPs were used, the amount of unlabeled
nucleotide was 10-fold lower and the concentration of unlabeled UTP was
increased up to 200 µM. For multiple rounds of transcription, 0.5 nM
DNA template and defined KCl concentrations were used. Reactions were initiated by the addition of 5 nM RNA polymerase and allowed to proceed
for 10 min. Single rounds of transcription were done in the presence of
70 mM KCl. In all experiments, 5 nM RNA polymerase was preincubated
with 3 nM DNA template for 10 min. Transcription was initiated by
addition of a mixture of NTPs added 10 s after heparin addition to
a final concentration of 100 µg/ml. Transcription was performed at
23°C for 10 min and stopped by the addition of formamide loading
buffer. Transcripts were analyzed on 6% sequencing gels, followed by
autoradiography, and quantified with ImageQuant PhosphorImager
(Molecular Dynamics). To determine the stability of promoter open
complexes, RNA polymerase was preincubated with DNA template in the
presence of different effectors if indicated for 10 min. Heparin (100 µg/ml) was added at time zero. Transcription was initiated by the
addition of NTPs at various times after the addition of heparin,
and reactions were allowed to proceed 10 more min.
 |
RESULTS |
Promoter mutations that affect in vivo regulation.
First, we
wanted to determine whether the promoter sequences required for GRDC
and SC are the same in leuVp and whether these regulatory
responses employ the same mechanisms for controlling tRNA gene
transcription. Initially, we addressed this question by analyzing
regulation of the leuV promoter and its structural variants
in vivo. Our hypothesis was that if both responses require the same
promoter sequences, then all promoter mutations should affect both
responses equally. As can be seen in Fig.
2A, sequence variations in the
discriminator region can have large effects on GRDC. Two mutant
promoters, D and T45 (Fig. 1), with substitutions lying in a middle
portion of the discriminator region displayed disturbed GRDC (Fig. 2A)
yet exhibited normal SC (Fig. 3). In contrast, mutant A7 (Fig. 2A) displayed normal GRDC, but its SC was
affected. In this case, a 70% reduction in promoter activity was
observed after induction of amino acid starvation compared to 90%
reduction for the wild-type promoter (Fig. 3). These results clearly
indicate that mutations in the promoter can differentially affect GRDC
and SC.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
(A) GRDC of the leuV( 50 +10) promoter and
its mutants. -Galactosidase ( -gal) activities of
promoter-trp-lacZ fusions are plotted against growth rate
expressed as doublings per hour. Each datum point represents the
average of at least three independent experiments. The slopes
determined for the different promoters using Sigma Plot linear
regression analyses were as follows: leuV, 0.75; T45 mutant,
3; D mutant, 2; and A7 mutant, 0.73. (B) GRDC of
leuV( 107 +55) promoter and D mutant (residues 50 to +11)
in relA spoT mutant strain and control strain MG1655.
|
|

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 3.
SC of the leuV( 50 +10) promoter and mutant
derivatives. The strains from which RNA was extracted and whether the
cultures were treated (+) or not treated ( ) with serine hydroxymate
(SeOH) to induce the stringent response are shown above the lanes.
Transcripts were detected with the test primer which is complementary
to -galactosidase mRNA sequences or with the reference primer
complementary to unique plasmid transcripts (see Materials and
Methods). These mixtures were electrophoresed in separate wells to
avoid overlapping with nonspecific bands. All samples were quantitated
by using an ImageQuant PhosphorImager. Actual values (in pixels × 1,000 per microgram of total RNA) of promoter activity were as follows:
leuV, 20.8 ± 4.2 before induction and 3 ± 0.7 after induction; 45T, 48.5 ± 5.7 before induction and 7.5 ± 0.65 after induction; D mutant (Dmut), 49 ± 6.8 before induction
and 8 ± 0.9 after induction; and A7 mutant, 37.5 ± 5.2 before induction and 13 ± 2.3 after induction. Values reported
are the averages of five different independent experiments.
|
|
The putative role of ppGpp in GRDC and SC of ribosomal promoter
rrnBp1 has been recently examined
(
19). It was shown that
in the
relA spoT mutant,
rrnBp1 was relaxed for the stringent
response,
but its GRDC was unimpaired. Thus, it was proposed that
SC required
ppGpp but that GRDC did not. To determine whether
this was also the
case for the
leuV promoter, appropriate promoter
reporter
fusions were inserted into control and
relA spoT strains
and
then GRDC and SC were assessed. As expected, it was found
that the
stringent response of the
leuV promoter in the
relA
spoT mutant was drastically affected, revealing further
accumulation
of message after induction of amino acid starvation (data
not
shown). Next we tested GRDC of the complete
leuV
promoter in the
relA spoT mutant and in the control strain.
As can be seen, GRDC
was not affected in the absence of ppGpp (Fig.
2B). This strongly
suggested that similar to the
rrnBp1 promoter, GRDC of
leuVp occurs
in the absence of ppGpp. The D mutant, which exhibited a reverse
response to growth rate in the wild-type strain was also tested
in the
relA spoT mutant background. In this case, the negative
slope of activity versus growth rate was essentially the same
as that
of the control strain (Fig.
2A). This indicates that the
promoter
activity of D mutant is unaffected at all growth rates
tested in the
absence of ppGpp. Moreover, it suggests that other
promoters showing
negative growth regulation such as
lac may,
like the D
mutant, be regulated in the absence of ppGpp. Overall,
these studies
support the hypothesis that GRDC and SC involve
different mechanisms,
which is consistent with results previously
reported for the
rrnBp1 promoter (
27).
Stability and initiating nucleotide dependence of promoter open
complexes.
Recent studies have shown that
rrnBp1 promoter open complexes are extremely
unstable in vitro and are stabilized by high concentrations of the
initiating nucleotide ATP. It was shown that the apparent Ks for ATP in vitro is more than 1,500 µM in
the presence of 200 mM KCl and that in vivo promoter activity is
proportional to ATP concentration. It was also shown that a
rrnBp1 mutant, which displayed more-stable open
complex of promoters lost GRDC. Based on these results, a model
referred to as NTP sensing was proposed, which suggested that the in
vivo level of purine triphosphates determines the steady-state level of
rrnp1 open complexes and therefore directly
controls the rate of transcription initiation (18).
In view of the apparent structural resemblance between
rrnBp1 and
leuV promoters, and
similar responses to SC and GRDC, we
have examined the stability of the
leuV promoter open complex
to heparin challenge in the
presence of different nucleotides.
We wished to determine whether the
leuV promoter open complexes
could be stabilized by the
presence of initiating nucleotide.
If this were so, it would be
possible that the nucleotide sensing
mechanism proposed for the
ribosomal promoter was operative for
leuVp as well. Figure
4 shows that the
leuV promoter
forms relatively
unstable promoter open complexes (half-life
[
t1/2], 5 min), but
it is substantially more
stable than those of
rrnBp1. The
t1/2 of
rrnBp1 was about
30 s under the same assay conditions. Preincubation
with the
initiating nucleotide, GTP, as well as both ATP and UTP
increased the
stability of the
leuV promoter open complex from
two- to
threefold (Fig.
4B). Interestingly, CTP caused the formation
of the
most stable complex which is based primarily on reiterative
transcription of
leuVp (
36a).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4.
Stability of leuV promoter open complexes
preincubated in the absence or presence of nucleotides. (A) Typical
experiment showing separation of transcripts derived from a single
round of transcription at various times after heparin addition at time
zero. The supercoiled plasmid template employed contained sequences
from the leuV operon from positions 50 to +136 inserted
into pLTC76 (see Materials and Methods). Transcripts terminated at the
trp attenuator derived from this construction were 194 nucleotides long. Experiments were performed in the absence (none) or
presence of 1 mM (each) GTP, ATP, and CTP in the preincubation mixture.
(B) Half-lives of leuV promoter open complexes formed in the
absence or presence of 1 mM of each nucleotide in the preincubation
mixture. Band counts derived from transcription of the above plasmid
template were plotted semilogarithmically as a function of time. Data
presented are the averages of at least three independent experiments.
|
|
In order to estimate the level of NTPs required for optimal activity of
the
leuV promoter, we performed multiple rounds of
transcription of the
leuV promoter and its mutants in vitro
as
a function of NTP concentrations. In addition, it was important
to
determine whether
Ks values for initiating
nucleotide are relevant
to the changes in GRDC for mutant
promoters.
First, we determined optimal salt concentrations for transcription of
the wild-type
leuV core promoter. This was particularly
important, given the strong effect salt had upon K
s values
reported
for
rrnBp1 (
18). We found a
significant difference in KCl optima
between single and multiple rounds
of transcription (Fig.
5).
In a single
round of transcription, the optimal KCl concentration
was about 70 mM,
with a substantial drop in promoter efficiency
at higher salt
concentrations. The D mutant was efficiently transcribed
over a wider
range of KCl concentrations up to 200 mM (Fig.
5A).
In multiple rounds
of transcription (Fig.
5B), both the wild type
and D mutant showed
similar KCl dependencies with broad optima
between 150 to 250 mM KCl.
Results obtained with the A7 and T45
mutant promoters were essentially
the same as that for the D mutant
(data not shown).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 5.
KCl dependence of the leuV promoter
transcription in vitro. (A) Single round of transcription. Supercoiled
plasmid templates containing either the wild-type leuV
promoter (filled circles) or the D mutant promoter (open circles) were
preincubated with RNA polymerase at different concentrations of KCl.
Reactions were initiated by the addition of all NTPs and heparin as
indicated in Materials and Methods. Templates employed for
transcription contained leuV operon sequences from positions
50 to +67 inserted into pLTC76 (see Materials and Methods), producing
132-nucleotide transcripts. (B) Multiple rounds of transcription.
Transcription was initiated by the addition of RNA polymerase to
supercoiled plasmid templates described above containing either the
wild type (filled circles) or the D mutant (open circles). The
activities of these templates at increasing concentrations of KCl are
indicated.
|
|
To visualize transcripts which differed in length by 1 nucleotide, we
used a supercoiled plasmid, which produced 86-base transcript
(see
Materials and Methods). Multiple initiation sites emanating
primarily
from positions C7 and G9 were observed. At low GTP concentrations,
initiation occurred primarily from position C7, while at low CTP
concentrations, transcription was predominately initiated at position
G9 (Fig.
6A). It was
important to quantitate transcripts initiated
only at G9 or C7,
independent of an alternative initiating nucleotide.
Results of in
vitro transcription as a function of nucleotide
concentration in the
presence of 200 mM KCl are presented in Fig.
6B. The apparent
K
s values for GTP determined in the
presence of
both 50 and 200 mM of KCl were about 50 µM. Essentially
the same
K
s value was shown for UTP; however, the
apparent
K
s for CTP at 240 µM was
significantly higher. The maximal
efficiency of RNA synthesis with
various ATP concentrations was
observed at a concentration of ATP as
low as 2.7 µM. The fact
that polymerase utilizes both CTP and GTP as
initiation nucleotides
is quite different from ribosomal promoters,
which have a single
initiation site. For example,
rrnBp1 is strongly dependent on
high levels of
ATP, whereas
rrnDp1 is dependent, but less so,
on levels of GTP for maximal activity in multiple rounds of
transcription
at high salt concentrations (
18). This might
reflect the levels
of these nucleotides in vivo. Given these
differences, we have
compared the apparent K
s
values for initiating nucleotides
for
leuVp with two other
promoters, including a derivative of
the
tac promoter, which
initiates the transcription with GTP,
and
rrnBp1, which initiates with ATP. Here it can be
seen that
the K
s values varied over almost 2 orders of magnitude
(Fig.
6C), and apparent
Ks
values for initiating nucleotide were
5, 50, and 330 µM for
tacp,
leuVp, and
rrnBp1,
respectively. In
addition, we found that the apparent
Ks for GTP for all mutant
versions of the
leuV promoter was approximately 80 µM, which was
slightly
higher than that for
leuVp (data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 6.
Multiple rounds of transcription in vitro of the
leuV( 50 +11) promoter as a function of NTP concentration
in the presence of 200 mM KCl. (A) Autoradiogram of 5% denaturing
polyacrylamide gel representing the separation of the transcription
products in the presence of a fixed concentration of GTP (200 µM) and
increasing concentrations of CTP. The concentrations of CTP are 3, 8, 24, 72, 216, 670, 2,000, and 6,000 µM (lanes 1 to 8, respectively).
The template employed contained leuV promoter sequences from
positions 50 to +31, which produced 86-nucleotide transcripts. (B)
Nucleotide dependence of the leuV promoter in multiple
rounds of transcription. Increasing concentrations of ATP (filled
triangles), CTP (open circles), GTP (filled circles) and UTP (open
triangles) are shown. In the case of ATP and UTP titrations, two bands
corresponding to initiation at C7 and G9 were seen at all
concentrations. In this case, values plotted are the sum of these two
transcripts. In the case of CTP, only counts corresponding to
initiation at C7 were quantitated and plotted. Similarly, in the case
of GTP titrations, only counts in G9 were quantitated and plotted. (C)
Initiating nucleotide dependence of promoters in multiple rounds of
transcription. Transcriptional activities as a function of initiating
nucleotide concentrations are presented for leuVp (circles),
tacp (squares), and rrnBp1
(triangles). Multiple rounds of transcription were performed in the
presence of 200 mM KCl as described in Materials and Methods. In the
case of leuV and tac promoters, various
concentrations of GTP were employed. For rrnBp1,
increasing ATP concentrations were used.
|
|
Taken together, the data from these experiments show that there are
distinct differences between the
leuV and
rrnBp1 promoters
with respect to their responses
to the concentration of the initiating
nucleotide and the effect of
salt on promoter efficiency. These
results impinge on the important
question of the role of initiating
nucleotide concentration on in vivo
promoter
activity.
Role of the promoter open complex stability on GRDC.
Recently
it was proposed that the stability of promoter open complexes is
directly related to the regulation of stringently controlled promoters
(49). That is, these promoters might invariably display
relatively unstable promoter open complexes. Another study has
suggested that this property may be important for GRDC of rRNA gene
expression as well (18). It has been further speculated that
the intrinsic instability of the complexes of these promoters correlates with the GC richness of the discriminator region located between positions
10 and +1 of the promoter (33) and that
the sequence of the discriminator region might determine the energy barrier for promoter open complex formation (36). In view of these reports, we wished to determine whether the leuV
promoter shares these properties with other promoters studied and, in
particular, whether promoter open complex instability is always a
property of promoter subject to GRDC and SC. Our initial approach was
to examine promoter open complex stability of leuVp
structural variants which differ in GRDC and SC.
As can be seen, all three mutants displayed higher stability of
promoter open complexes than that of the wild type (Fig.
7).
As discussed above, two derivatives,
T45 (
t1/2, 28 min) and D
(
t1/2, 40 min), displayed significantly altered
GRDC (Fig.
2A).
Importantly, GRDC of the third variant studied, A7
(
t1/2, 35 min)
was indistinguishable from that
of the wild-type promoter (Fig.
2A), but its SC was measurably affected
(Fig.
3). None of the
other mutations, which abolished GRDC affected
the stringent response
promoter. All mutations described here decreased
GC richness of
the discriminator, which might affect kinetics of
promoter open
complex formation. It is therefore not surprising that
all the
substitutions increased the half-life of the promoter open
complex,
what was accompanied by reduced KCl sensitivity of promoters
in
a single round of transcription (Fig.
5A and unpublished results).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7.
Stability of open complexes formed with mutants of
leuV promoter. Band counts derived from transcription of the
supercoiled plasmid templates were plotted semilogarithmically as a
function of time. Templates employed for these transcriptions contained
leuV operon sequences from positions 50 to +67 (see
Materials and Methods), producing 132-nucleotide transcripts. Data
presented are the averages of at least three independent experiments.
Transcription was performed with the wild-type leuV promoter
D mutant, T45, and 7A.
|
|
Effect of NTP concentration in vivo.
Overall, the experiments
above indicate that the leuV promoter is less responsive at
least in vitro to NTP concentrations than
rrnBp1. Moreover, it appears that the apparent
Ks value for the major initiating nucleotide,
GTP, is relatively low compared to estimated in vivo purine levels at
any growth rate (34). If this is the case, we might predict
that the leuV promoter would be less responsive to changes
in the intracellular level of NTPs. Therefore, the following
experiments were done. We employed the approach recently used by others
for the study of rrnBp1 (18). Restriction of exogenous pyrimidines causes a marked reduction of the
intracellular concentration of UTP and CTP and of the growth rate for
the strain CLT246, which exhibits defective pyrimidine biosynthesis
(38). The lowered concentration of pyrimidine triphosphates limits RNA synthesis, and as a result, increases the concentration of
intracellular ATP and GTP. With this approach, it was previously reported that the efficiency of the rrnBp1
promoter was decreased almost 50% when the intracellular ATP level was
reduced around twofold (18). For the leuV
promoter, we detected an approximately 10% reduction in promoter
activity under the same growth conditions (Fig.
8), in contrast to an increase of
approximately 40% in promoter activity, which occurs in a control
strain not starved for pyrimidines at the growth rates tested. These
results are not inconsistent with the model that the leuV
promoter is sensitive to NTP concentration in vivo and that this
mechanism is involved in GRDC of leuVp. It is clear,
however, that leuVp is less sensitive to this control mechanism compared to recent results obtained for
rrnBp1.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 8.
GRDC of the leuV( 107 +55) promoter and D
mutant (residues 50 to +11) in CLT246
(car::Tn10) strain. The complete
leuV promoter and the D mutant, containing T substitutions
at positions 4, 5, and 7, are shown. -gal, -galactosidase.
|
|
Role of UAS in GRDC.
We previously observed that flanking
sequences affected GRDC of the leuV promoter. Deuster et al.
showed that promoter constructions containing sequences downstream of
the promoter displayed greater GRDC than one without these sequences
(15). Later, Bauer et al. showed that the core
leuV promoter is compromised in GRDC (8). We have
examined this question here in a relA+ strain
using comparable constructions. These experiments were particularly
interesting because it had been shown that the
rrnBp1 core promoter is necessary and sufficient
for GRDC (6). As can be seen in Fig.
9, optimal GRDC was strongly dependent on upstream sequences. Note that not all GRDC is eliminated when UAS are
deleted. The substitution of two T's for two G's at positions
71
and
72 completely abolished the effect of UAS. We have recently shown
that these sequences contain a functional FIS site (39).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 9.
Effects of upstream sequences on leuV GRDC.
-Galactosidase activities of the leuV( 107 +11)
promoter, the leuV( 50 +11) promoter, and the
leuV( 107 +11) promoter containing substitutions at
positions 71 and 72 of the fis site are shown.
|
|
Interaction of UAS and core promoter elements.
Above we have
shown that the wild-type leuV promoter requires upstream
sequences not only for maximal activity but also for a full response to
changes in growth rate. Moreover, a functional Fis binding site must be
present in UAS to mediate these activities. We have shown as well that
particular promoter mutations disrupt GRDC of leuVp when
introduced into the core promoter. What then will be observed when the
fis gene is disrupted, and what effects do UAS have on
mutations in the core promoter? The first question has been initially
addressed in other communications (35, 39). It was shown
that although purified FIS protein stimulates leuVp transcription about threefold in vitro, the activity of the
leuV promoter was greater in fis mutant background
(39). Nevertheless, elevated levels of
tRNA1Leu compared to 16S rRNA were reported in
fis+ cells (35). Therefore, FIS is
clearly involved in regulation of leuVp in vivo and in
vitro. However, it has not been determined yet whether inactivation of
the fis gene is reflected somehow on GRDC of the
leuV promoter. To determine directly whether FIS contributes
to GRDC of the leuV promoter, we measured
-galactosidase activities derived from chromosomal single copy of wild-type and T45
mutant leuVp-lacZ fusions as a function of growth rate in fis and fis+ strains (Fig.
10). First, Fig. 10 illustrates that
the presence of UAS not only optimized GRDC for wild-type
leuVp but restored GRDC for the T45 mutant, which displayed
completely disrupted GRDC as the core promoter. Second, it can be seen
that promoter activities were increased rather than decreased in a fis
mutant background and that GRDC of both promoters was increased at
least by 15% in fis mutant cells compared to wild-type cells. Similar results were obtained with the D mutant (data not shown), and the
absence of functional FIS protein did not affect the regulation of the
leuV core promoter (data not shown). Overall, these
experiments show that UAS can abolish the effects of core promoter
mutation and that these sequences are the dominant determinant for GRDC of the leuV promoter.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 10.
GRDC of the leuV and T45 mutant promoters
with upstream sequences in fis+ and
fis strains. -Galactosidase ( -gal) activities of
promoter-lacZ fusions are plotted against growth rate
expressed as doublings per hour. Each datum point represents the
average of at least three independent experiments.
|
|
 |
DISCUSSION |
We have shown here that the targets for SC and GRDC in the
leuV promoter are not identical, since mutations which
differentially affect these regulatory responses have been identified.
We have also demonstrated that GRDC but not SC of the leuV
promoter occurs in the absence of ppGpp. Similar findings have been
reported for the rrnBp1 promoter (19,
27). However, a body of evidence has been put forth suggesting
that ppGpp is involved in both SC and GRDC (25, 48). This
conclusion is based in part on the observation that ppGpp levels varied
inversely with the expression of stable RNA genes at various growth
rates (42). In addition, work with mutants of RNA polymerase
(4) and studies focused on tyrT operon regulation
(43) further support a role for ppGpp in both regulatory
mechanisms. Based on our results and that of others, we conclude that
GRDC and SC for leuVp and rrnBp1 must proceed at least in part via different mechanisms.
It is not surprising that similar regulatory strategies are used for
the expression of stable RNAs to ensure close regulation of protein
synthesis under various growth conditions. However, recent in vivo
studies strongly suggested that tRNA gene expression is heterogeneous
(17, 40). It was originally shown that some tRNA species
exhibited positive GRDC, whereas the level of others did not increase,
or even decreased, as growth rates were increased (16, 17).
Now it is generally accepted that the intracellular concentration of
all tRNA species is increased between growth rates of 0.4 and 2.5 doublings per h (14). The rate of increase is specific for
each tRNA and can vary as a function of input signals involved in
regulation. For example, one level of control of tRNA biosynthesis
involves FIS. When synthesis of tRNA species was compared in
fis+ and fis strains, the expression of some tRNAs as a
function of growth rate was strongly dependent upon the presence of
FIS, whereas others showed no requirement for FIS or even appeared to
be more abundant in the fis mutant at all growth rates tested
(35). It is therefore perplexing why leuVp
displays even better growth rate regulation in the absence of an active
fis gene. This suggests that even further complexities exist
for controlling the level of tRNA promoters in vivo. Recently, it has
been proposed that in the case of a rRNA promoter, FIS and another DNA
binding protein H-NS interact with DNA at overlapping sites, thereby
working in concert to orchestrate promoter activity as a function of
growth. It is conceivable that other factors such as supercoiling of
DNA or other DNA binding proteins may be involved as well in these interactions. Therefore, the interpretation of data derived for strains
lacking any of these factors becomes difficult. For example, in the
absence of FIS, other factors may operate independently and FIS might
then serve a negative role in the presence of particular combinations
of factors or conditions. It has been reported that FIS may act via
contacts with the alpha subunit of RNA polymerase, which in turn may
alter the actual site and kinetics of promoter-polymerase interactions.
Moreover, it has been shown that the concentration of FIS increases
with increasing growth rate. The simplest model in this case would be
that FIS simply increases in concentration and subsequently stimulates
promoter activity at higher concentrations. Whatever the case, it is
clear from these experiments that a simple model whereby FIS alone
modulates promoter activity as growth changes seems very unlikely.
We have previously shown that at least one tRNA core promoter
(leuXp) does not exhibit GRDC (40). This may not
be surprising, since this promoter contained no UAS, suggesting that
GRDC of leuXp might be solely mediated by UAS. It is
important to note that the argT, metT, and
leuV core promoters displayed moderate GRDC and consequently
must have the appropriate sequences for UAS-independent GRDC. It will
be interesting to determine whether tRNA promoters differ in the
relative contributions of core and flanking promoter sequences for
GRDC. We should point out, however, that other postinitiation
regulatory mechanisms might determine final levels of tRNA
isoacceptors. For example, transcription elongation rates, tRNA
processing, modification, and turnover all affect cellular levels of
tRNA at a given growth rate.
As we have outlined above, we also examined the differential effects of
mutations in the leuV core promoter on SC and GRDC. Selected
discriminator mutations in the core promoter (D and T45 mutants)
clearly disturbed GRDC, such that promoter activity varied inversely
with growth rate (Fig. 2A). Neither of these mutants displayed
measurable changes in SC. Conversely, the A7 mutation was modestly
affected in SC but still displayed normal GRDC. It is striking from our
experiments and those of others that many mutations can disrupt GRDC in
both rrnBp1 and leuV promoters
(7, 27, 36b) and with the exception of the A7 mutation
reported here, no single base substitution in the discriminator motif
of leuVp and rrnBp1 affecting SC has
been identified so far. However, multiple mutations in the
discriminator region of rrnBp1
rrnBp2 and tyrTp promoters have been
reported to significantly affect both SC and GRDC (27, 43,
48). It is possible, therefore, that the leuV promoter
may utilize different sequence requirements and regulatory strategies
than these systems. Our experiments suggest that whatever mechanisms
are employed for GRDC or SC, targets in the leuV promoter
responsible for regulation at steady-state growth and during amino acid
starvation are not necessarily the same. We wish to emphasize that all
these promoter variants lack UAS sequences, and effects seen must
therefore be UAS independent. We believe that more-extensive
mutagenesis of the leuV promoter may be required to fully
describe targets of the various forms of control.
The recent report of Gaal et al. has provided evidence for the role of
intracellular levels of initiating nucleotides in GRDC for ribosomal
promoters (18). These researchers showed that polymerase-rrnBp1 complexes are intrinsically
unstable, as judged by heparin challenge experiments, and that the
initiating nucleotide ATP stabilizes these complexes. Based on the
observations that both ribosome production and intracellular purine
levels are increased as a function of growth rate (10, 34),
the researchers proposed a model for the control of ribosome synthesis
by "NTP sensing." This model states that the high concentration of
initiating nucleotide stabilizes rrnp1 open
complexes in vivo and may account for the increased activities of the
promoters as a function of growth and increased intracellular purine concentrations.
We have examined this issue for the leuV promoter, and it
appears that this mechanism could be operative for the leuV
promoter as well. However, its relative contribution to GRDC is much
less than that for rrnBp1. We showed that the
leuV promoter is less sensitive to salt than
rrnBp1 in single and multiple rounds of transcription. These results reflect the effect of salt concentration on promoter opening. Extreme salt sensitivity of
rrnBp1 may have been in part responsible for the
high Ks value of ATP reported for
rrnBp1. In this case, ATP presumably operated as a ligand, increasing the half-life of promoter open complexes and
thereby increasing the number of subsequent productive elongation events. The binding of ATP stimulated the initiation of
rrnBp1 transcription in vitro, facilitating the
formation of promoter open complexes under conditions where the KCl
concentration was still optimal for polymerase functioning but was high
enough for efficient polymerase-rrnBp1 open
complex formation. In the case of leuVp, which forms
more-stable open promoter complexes than rrnBp1,
all NTPs increased the stability of promoter open complex in vitro
(Fig. 4). Therefore, we conclude that the concentration of all
nucleotides could play a role in increasing leuVp open complex stability and promoter efficiency in vivo. This is consistent with the finding of multiple initiating sites for the leuV
promoter in vivo and in vitro, which could make it responsive to the
level of more than one nucleotide. Our results are not inconsistent with the idea of a special role of initiating NTPs in transcription, but our experiments suggest that the level of GTP alone may not account
for all changes in promoter activity seen as a function of growth.
In accordance with our results, GRDC of the leuV promoter
was less affected in
'
215-220 mutant of RNA polymerase than were rrnBp1 and rrnDp1
(5). It was found that the
'
215-220 mutant polymerase
forms less-stable complexes with both rrnBp1 and
PR, and therefore requires higher
concentrations of initiating nucleotides than for wild-type polymerase.
This mutant has been shown to reduce the increase in promoter
activities compared to wild-type strain for
rrnBp1 and rrnDp1 from
5.8 to 1.8 and from 4.4 to 2, respectively, between the growth rates of
0.7 and 1.4. The leuV promoter displayed a twofold increase
in promoter activity in the wild type and a 1.4-fold increase was
observed in the
'
215-220 mutant under the same growth
conditions. In agreement with our conclusions, it was suggested that
the leuV promoter was less responsive to the NTP sensing
(5).
All described mutants of leuVp formed more-stable open
complexes of promoters (Fig. 7), but only two (T45 and D mutants) had disturbed GRDC. We interpret this to mean that the stability of promoter open complexes alone does not determine the GRDC of the leuV promoter. How then can we account for GRDC of the
leuV promoter if NTP levels and stability of promoter open
complexes are only partially involved in regulation if at all?
We propose the following summary for how the leuV promoter
might be regulated. First, it is clear that ppGpp is required for the
SC of the leuV operon and functions via interaction directly with RNA polymerase. Second, ppGpp is not essential for GRDC as we have
shown here and may not be involved in changes in promoter activity
under the conditions tested. Intracellular concentrations of NTP may
not be a major factor for GRDC of promoter activity. Finally, UAS
sequences are required for optimal GRDC. It will be interesting to
determine the nature of other factors involved in regulation of
leuVp. It will be important to understand in detail the
interactions between FIS-mediated control and core promoter mechanisms
such as the effects of NTP concentrations. It is conceivable that these
two mechanisms are interactive. For, example, could binding of factors
to UAS affect either the kinetics of promoter open complex formation or
modulate the parameters of NTP sensing? Overall, it is clear that no
single model which explains GRDC can be proposed for all stable RNA genes.
Given these points, it becomes important to know how other tRNA
promoters may have evolved to respond to differences in growth rate. It
has been reported that tRNA genes appear to be heterogeneous with
respect to responses to growth rate and requirements for FIS
(35). Taken together, the work presented here and elsewhere suggests that tRNA genes may in fact have evolved a variety of strategies for GRDC. This idea is supported by the observation that
primary sequences in tRNA promoters show considerable heterogeneity. Finally, it will be interesting to determine whether similar diversity of tRNA gene expression is seen with regard to mechanisms of the stringent response.
 |
ACKNOWLEDGMENTS |
This work was supported in part by grants GM50747 from the
National Institute of Health to W.M.H. and GM29466 to C.L.T.
We thank Wilma Ross, Rick Gourse, Michael Bartlett, and Cathy Squires
for very important and useful discussions, and we thank Tamas Gaal and
Wilma Ross for lysogens.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: ISBDD, Suite
212, 800 East Leigh St., Richmond, VA 23219. Phone: (804) 828-2327. Fax: (804) 828-9946. E-mail: HOLMES{at}hsc.vcu.edu.
Present address: Whitehead Institute/MIT, Cambridge, MA 02142.
 |
REFERENCES |
| 1.
|
Alper, M. D., and B. N. Ames.
1978.
Transport of antibiotics and metabolite analogs by systems under cyclic AMP control: positive selection of Salmonella typhimurium cya and crp mutants.
J. Bacteriol.
133:149-157[Abstract/Free Full Text].
|
| 2.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1987.
Current protocols in molecular biology, p. 4.8.1.-4.8.4..
John Wiley and Sons, Inc., New York, N.Y.
|
| 3.
|
Baracchini, E., and H. Bremer.
1991.
Control of rRNA synthesis in Escherichia coli at increased rrn gene dosage. Role of guanosine tetraphosphate and ribosome feedback.
J. Biol. Chem.
266:11753-11760[Abstract/Free Full Text].
|
| 4.
|
Baracchini, E.,
R. Glass, and H. Bremer.
1988.
Studies in vivo on Escherichia coli RNA polymerase mutants altered in the stringent response.
Mol. Gen. Genet.
213:379-387[Medline].
|
| 5.
|
Bartlett, M. S.,
T. Gaal,
W. Ross, and R. L. Gourse.
1998.
RNA polymerase mutants that destabilize RNA polymerase-promoter complexes alter NTP-sensing by rrn P1 promoters.
J. Mol. Biol.
279:331-345[Medline].
|
| 6.
|
Bartlett, M. S., and R. L. Gourse.
1994.
Growth rate-dependent control of the rrnB P1 core promoter in Escherichia coli.
J. Bacteriol.
176:5560-5564[Abstract/Free Full Text].
|
| 7.
|
Bauer, B. F.,
R. M. Elford, and W. M. Holmes.
1993.
Mutagenesis and functional analysis of the Escherichia coli tRNA(1Leu) promoter.
Mol. Microbiol.
7:265-273[Medline].
|
| 8.
|
Bauer, B. F.,
E. G. Kar,
R. M. Elford, and W. M. Holmes.
1988.
Sequence determinants for promoter strength in the leuV operon of Escherichia coli.
Gene
63:123-134[Medline].
|
| 9.
|
Blattner, F. R.,
G. Plunkett,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474[Abstract/Free Full Text]. [Comment.]
|
| 10.
|
Bremer, H., and P. P. Dennis.
1996.
Modulation of chemical composition and other parameters of the cell by growth rate, p. 1553-1569.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology. American Society for Microbiology, Washington, D.C.
|
| 11.
|
Brosius, J.
1984.
Plasmid vectors for the selection of promoters.
Gene
27:151-160[Medline].
|
| 12.
|
Cashel, M.
1969.
The control of ribonucleic acid synthesis in Escherichia coli. IV. Relevance of unusual phosphorylated compounds from amino acid-starved stringent strains.
J. Biol. Chem.
244:3133-3141[Abstract/Free Full Text].
|
| 13.
|
Cashel, M., and J. Gallant.
1969.
Two compounds implicated in the function of the RC gene of Escherichia coli.
Nature
221:838-841[Medline].
|
| 14.
|
Dong, H.,
L. Nilsson, and C. G. Kurland.
1996.
Co-variation of tRNA abundance and codon usage in Escherichia coli at different growth rates.
J. Mol. Biol.
260:649-663[Medline].
|
| 15.
|
Duester, G.,
R. M. Elford, and W. M. Holmes.
1982.
Fusion of the Escherichia coli tRNALeu1 promoter to the galK gene: analysis of sequences necessary for growth-rate-dependent regulation.
Cell
30:855-864[Medline].
|
| 16.
|
Emilsson, V., and C. G. Kurland.
1990.
Growth rate dependence of transfer RNA abundance in Escherichia coli.
EMBO J.
9:4359-4366[Medline].
|
| 17.
|
Emilsson, V.,
A. K. Naslund, and C. G. Kurland.
1993.
Growth-rate-dependent accumulation of twelve tRNA species in Escherichia coli.
J. Mol. Biol.
230:483-491[Medline].
|
| 18.
|
Gaal, T.,
M. S. Bartlett,
W. Ross,
C. L. Turnbough, Jr., and R. L. Gourse.
1997.
Transcription regulation by initiating NTP concentration: rRNA synthesis in bacteria.
Science
278:2092-2097[Abstract/Free Full Text].
|
| 19.
|
Gaal, T., and R. L. Gourse.
1990.
Guanosine 3'-diphosphate 5'-diphosphate is not required for growth rate-dependent control of rRNA synthesis in Escherichia coli.
Proc. Natl. Acad. Sci. USA
87:5533-5537[Abstract/Free Full Text].
|
| 20.
|
Gourse, R. L.,
H. A. de Boer, and M. Nomura.
1986.
DNA determinants of rRNA synthesis in E. coli: growth rate dependent regulation, feedback inhibition, upstream activation, antitermination.
Cell
44:197-205[Medline].
|
| 21.
|
Gourse, R. L.,
Y. Takebe,
R. A. Sharrock, and M. Nomura.
1985.
Feedback regulation of rRNA and tRNA synthesis and accumulation of free ribosomes after conditional expression of rRNA genes.
Proc. Natl. Acad. Sci. USA
82:1069-1073[Abstract/Free Full Text].
|
| 22.
|
Hamming, J.,
G. Ab, and M. Gruber.
1980.
E. coli RNA polymerase-rRNA promoter interaction and the effect of ppGpp.
Nucleic Acids Res.
8:3947-3963[Abstract/Free Full Text].
|
| 23.
|
Haseltine, W. A., and R. Block.
1973.
Synthesis of guanosine tetra- and pentaphosphate requires the presence of a codon-specific, uncharged transfer ribonucleic acid in the acceptor site of ribosomes.
Proc. Natl. Acad. Sci. USA
70:1564-1568[Abstract/Free Full Text].
|
| 24.
|
Haseltine, W. A.,
R. Block,
W. Gilbert, and K. Weber.
1972.
MSI and MSII made on ribosome in idling step of protein synthesis.
Nature
238:381-384[Medline].
|
| 25.
|
Hernandez, V. J., and H. Bremer.
1990.
Guanosine tetraphosphate (ppGpp) dependence of the growth rate control of rrnB P1 promoter activity in Escherichia coli.
J. Biol. Chem.
265:11605-11614[Abstract/Free Full Text].
|
| 26.
|
Ikemura, T., and J. E. Dahlberg.
1973.
Small ribonucleic acids of Escherichia coli. II. Noncoordinate accumulation during stringent control.
J. Biol. Chem.
248:5033-5041[Abstract/Free Full Text].
|
| 27.
|
Josaitis, C. A.,
T. Gaal, and R. L. Gourse.
1995.
Stringent control and growth-rate-dependent control have nonidentical promoter sequence requirements.
Proc. Natl. Acad. Sci. USA
92:1117-1121[Abstract/Free Full Text].
|
| 28.
|
Kingston, R. E.,
W. C. Nierman, and M. J. Chamberlin.
1981.
A direct effect of guanosine tetraphosphate on pausing of Escherichia coli RNA polymerase during RNA chain elongation.
J. Biol. Chem.
256:2787-2797[Abstract/Free Full Text].
|
| 29.
|
Krohn, M., and R. Wagner.
1996.
Transcriptional pausing of RNA polymerase in the presence of guanosine tetraphosphate depends on the promoter and gene sequence.
J. Biol. Chem.
271:23884-23894[Abstract/Free Full Text].
|
| 30.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 31.
|
Miller, J. H.
1972.
Experiments in molecular genetics, p. 352-355.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 32.
|
Miura, A.,
J. H. Krueger,
S. Itoh,
H. A. de Boer, and M. Nomura.
1981.
Growth-rate-dependent regulation of ribosome synthesis in E. coli: expression of the lacZ and galK genes fused to ribosomal promoters.
Cell
25:773-782[Medline].
|
| 33.
|
Mizushima-Sugano, J., and Y. Kaziro.
1985.
Regulation of the expression of the tufB operon: DNA sequences directly involved in the stringent control.
EMBO J.
4:1053-1058[Medline].
|
| 34.
|
Neuhard, J., and P. Nygaard.
1987.
Purines and pyrimidines, p. 445-473.
In
F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, D.C.
|
| 35.
|
Nilsson, L., and V. Emilsson.
1994.
Factor for inversion stimulation-dependent growth rate regulation of individual tRNA species in Escherichia coli.
J. Biol. Chem.
269:9460-9465[Abstract/Free Full Text].
|
| 36.
|
Ohlsen, K. L., and J. D. Gralla.
1992.
Interrelated effects of DNA supercoiling, ppGpp, and low salt on melting within the Escherichia coli ribosomal RNA rrnB P1 promoter.
Mol. Microbiol.
6:2243-2251[Medline].
|
| 36a.
| Pokholok, D. K., and W. M. Holmes.
Unpublished results.
|
| 36b.
| Pokholok, D. K., et al. Unpublished results.
|
| 37.
|
Powell, B. S.,
M. P. Rivas,
D. L. Court,
Y. Nakamura, and C. L. Turnbough, Jr.
1994.
Rapid confirmation of single copy lambda prophage integration by PCR.
Nucleic Acids Res.
22:5765-5766[Free Full Text].
|
| 38.
|
Qi, F., and C. L. Turnbough, Jr.
1995.
Regulation of codBA operon expression in Escherichia coli by UTP-dependent reiterative transcription and UTP-sensitive transcriptional start site switching.
J. Mol. Biol.
254:552-565[Medline].
|
| 39.
|
Ross, W.,
J. Salomon,
W. M. Holmes, and R. L. Gourse.
1999.
Activation of Escherichia coli leuV transcription by FIS.
J. Bacteriol.
181:3864-3868[Abstract/Free Full Text].
|
| 40.
|
Rowley, K. B.,
R. M. Elford,
I. Roberts, and W. M. Holmes.
1993.
In vivo regulatory responses of four Escherichia coli operons which encode leucyl-tRNAs.
J. Bacteriol.
175:1309-1315[Abstract/Free Full Text].
|
| 41.
|
Sarmientos, P.,
J. E. Sylvester,
S. Contente, and M. Cashel.
1983.
Differential stringent control of the tandem E. coli ribosomal RNA promoters from the rrnA operon expressed in vivo in multicopy plasmids.
Cell
32:1337-1346[Medline].
|
| 42.
|
Sarubbi, E.,
K. E. Rudd, and M. Cashel.
1988.
Basal ppGpp level adjustment shown by new spoT mutants affect steady state growth rates and rrnA ribosomal promoter regulation in Escherichia coli.
Mol. Gen. Genet.
213:214-222[Medline].
|
| 43.
|
Travers, A. A.,
A. I. Lamond, and J. R. Weeks.
1986.
Alteration of the growth-rate-dependent regulation of Escherichia coli tyrT expression by promoter mutations.
J. Mol. Biol.
189:251-255[Medline].
|
| 44.
|
Vogel, U.,
S. Pedersen, and K. F. Jensen.
1991.
An unusual correlation between ppGpp pool size and rate of ribosome synthesis during partial pyrimidine starvation of Escherichia coli.
J. Bacteriol.
173:1168-1174[Abstract/Free Full Text].
|
| 45.
|
Vogel, U., and K. F. Jensen.
1994.
Effects of guanosine 3',5'-bisdiphosphate (ppGpp) on rate of transcription elongation in isoleucine-starved Escherichia coli.
J. Biol. Chem.
269:16236-16241[Abstract/Free Full Text].
|
| 46.
|
Vogel, U., and K. F. Jensen.
1995.
Effects of the antiterminator BoxA on transcription elongation kinetics and ppGpp inhibition of transcription elongation in Escherichia coli.
J. Biol. Chem.
270:18335-18340[Abstract/Free Full Text].
|
| 47.
|
Xiao, H.,
M. Kalman,
K. Ikehara,
S. Zemel,
G. Glaser, and M. Cashel.
1991.
Residual guanosine 3',5'-bispyrophosphate synthetic activity of relA null mutants can be eliminated by spoT null mutations.
J. Biol. Chem.
266:5980-5990[Abstract/Free Full Text].
|
| 48.
|
Zacharias, M.,
H. U. Goringer, and R. Wagner.
1989.
Influence of the GCGC discriminator motif introduced into the ribosomal RNA P2- and tac promoter on growth rate control and stringent sensitivity.
EMBO J.
8:3357-3363[Medline].
|
| 49.
|
Zhou, Y. N., and D. J. Jin.
1998.
The rpoB mutants destabilizing initiation complexes at stringently controlled promoters behave like "stringent" RNA polymerases in Escherichia coli.
Proc. Natl. Acad. Sci. USA
95:2908-2913[Abstract/Free Full Text].
|
Journal of Bacteriology, September 1999, p. 5771-5782, Vol. 181, No. 18
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Husnain, S. I., Thomas, M. S.
(2008). The UP Element Is Necessary but Not Sufficient for Growth Rate-Dependent Control of the Escherichia coli guaB Promoter. J. Bacteriol.
190: 2450-2457
[Abstract]
[Full Text]
-
Mallik, P., Paul, B. J., Rutherford, S. T., Gourse, R. L., Osuna, R.
(2006). DksA Is Required for Growth Phase-Dependent Regulation, Growth Rate-Dependent Control, and Stringent Control of fis Expression in Escherichia coli.. J. Bacteriol.
188: 5775-5782
[Abstract]
[Full Text]
-
Mallik, P., Pratt, T. S., Beach, M. B., Bradley, M. D., Undamatla, J., Osuna, R.
(2004). Growth Phase-Dependent Regulation and Stringent Control of fis Are Conserved Processes in Enteric Bacteria and Involve a Single Promoter (fis P) in Escherichia coli. J. Bacteriol.
186: 122-135
[Abstract]
[Full Text]
-
Murray, H. D., Appleman, J. A., Gourse, R. L.
(2003). Regulation of the Escherichia coli rrnB P2 Promoter. J. Bacteriol.
185: 28-34
[Abstract]
[Full Text]
-
Barker, M. M., Gourse, R. L.
(2001). Regulation of rRNA Transcription Correlates with Nucleoside Triphosphate Sensing. J. Bacteriol.
183: 6315-6323
[Abstract]
[Full Text]
-
Cabrera, J. E., Jin, D. J.
(2001). Growth Phase and Growth Rate Regulation of the rapA Gene, Encoding the RNA Polymerase-Associated Protein RapA in Escherichia coli. J. Bacteriol.
183: 6126-6134
[Abstract]
[Full Text]
-
Bartlett, M. S., Gaal, T., Ross, W., Gourse, R. L.
(2000). Regulation of rRNA Transcription Is Remarkably Robust: FIS Compensates for Altered Nucleoside Triphosphate Sensing by Mutant RNA Polymerases at Escherichia coli rrn P1 Promoters. J. Bacteriol.
182: 1969-1977
[Abstract]
[Full Text]