Previous Article | Next Article ![]()
Journal of Bacteriology, September 1999, p. 5885-5888, Vol. 181, No. 18
Institut für Allgemeine Mikrobiologie,
Christian-Albrechts-Universität Kiel, Am Botanischen Garten
1-9, D-24118 Kiel, Germany
Received 7 April 1999/Accepted 7 July 1999
Acetyl-coenzyme A (acetyl-CoA) synthetase (ADP forming) represents
a novel enzyme in archaea of acetate formation and energy conservation
(acetyl-CoA + ADP + Pi Acetyl-coenzyme A (acetyl-CoA)
synthetase (ADP forming) (acetyl-CoA + ADP + Pi
Recently, Glasemacher et al. (7) purified and characterized
acetyl-CoA synthetase (ADP forming) from P. furiosus. The
native enzyme is a heterotetramer ( Identification of the genes, acdAI and
acdBI, encoding acetyl-CoA synthetase (ADP forming) isoform
I.
The genes putatively encoding subunit Comparison of AcdAI and AcdBI sequences with those of other
proteins.
In a BLASTP search (1), the deduced amino
acid sequences of the
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Acetyl Coenzyme A Synthetase (ADP Forming) from the
Hyperthermophilic Archaeon Pyrococcus furiosus:
Identification, Cloning, Separate Expression of the Encoding Genes,
acdAI and acdBI, in Escherichia coli,
and In Vitro Reconstitution of the Active Heterotetrameric Enzyme
from Its Recombinant Subunits
![]()
ABSTRACT
Top
Abstract
Text
References
acetate + ATP + CoA). Two isoforms of the enzyme have been purified from the
hyperthermophile Pyrococcus furiosus. Isoform I is a
heterotetramer (
2
2) with an apparent
molecular mass of 145 kDa, composed of two subunits,
and
, with
apparent molecular masses of 47 and 25 kDa, respectively. By using
N-terminal amino acid sequences of both subunits, the encoding genes,
designated acdAI and acdBI, were identified in the genome of P. furiosus. The genes were separately
overexpressed in Escherichia coli, and the recombinant
subunits were reconstituted in vitro to the active heterotetrameric
enzyme. The purified recombinant enzyme showed molecular and
catalytical properties very similar to those shown by acetyl-CoA
synthetase (ADP forming) purified from P. furiosus.
![]()
TEXT
Top
Abstract
Text
References
acetate + ATP + CoA) has been detected in the domain
Eucarya, in the protists Entamoeba histolytica
and Giardia lamblia, where it is involved in acetate
formation and ATP production in the course of fermentative metabolism
(15, 16). In prokaryotes, this unusual synthetase was first
described in detail in the hyperthermophilic archaeon Pyrococcus
furiosus (17), where it represents the major
energy-conserving reaction during pyruvate and sugar conversion to
acetate (19). Later studies demonstrated the presence of
acetyl-CoA synthetase (ADP forming) in all acetate-forming
Archaea tested, including anaerobic hyperthermophiles and
mesophilic aerobic halophiles (18, 19). In contrast, all
acetate-forming Bacteria studied so far, including the
hyperthermophile Thermotoga maritima, utilize two almost
"classical" enzymes, phosphate acetyltransferase and acetate
kinase, for acetate formation and ATP synthesis (3, 19).
Thus, acetyl-CoA synthetase (ADP forming) represents a novel enzyme in
prokaryotes, restricted to the domain of Archaea, catalyzing
acetate formation and ATP synthesis via the mechanism of
substrate-level phosphorylation.
2
2)
with an apparent molecular mass of 145 kDa, composed of two subunits,
and
, with apparent molecular masses of 47 and 25 kDa,
respectively. The enzyme exhibits a high optimum temperature (90°C)
and thermostability in accordance with its physiological function under
hyperthermophilic conditions. Independently, Mai and Adams
(14) purified two distinct isoforms of acetyl-CoA synthetase
(ADP forming) from P. furiosus. The isoforms had similar
molecular properties but showed different N-terminal amino acid
sequences for the
and
subunits and different substrate specificities and kinetic properties. On the basis of substrate specificities and N-terminal amino acid sequences of the subunits, the
enzyme purified by Glasemacher et al. (7) corresponded to
isoform I isolated by Mai and Adams (14). In this
communication, we describe the identification of the genes encoding
acetyl-CoA synthetase (ADP forming) isoform I from P. furiosus via functional overexpression in Escherichia
coli. The recombinant enzyme was purified and characterized.
(47 kDa) and subunit
(25 kDa) of acetyl-CoA synthetase (ADP forming) were identified by
using the N-terminal amino acid sequences of both subunits, as reported
by Glasemacher et al. (7). Based on the sequences, two open
reading frames were identified by a BLAST search in the complete
sequenced genome of P. furiosus (23). The open
reading frames were designated acdAI and acdBI,
where "acd" indicates the genes encoding acetyl-CoA
synthetase (ADP forming) to discriminate the acd genes and
the "acs" genes, encoding the widely distributed AMP-forming acetyl-CoA synthetases. "A" and "B" stand for the subunits
and
, respectively, and "I" stands for isoenzyme I. acdAI comprises 1,386 bp coding for a polypeptide of 462 amino acids (aa) with a calculated molecular mass of 49,964 Da;
acdBI consists of 696 bp coding for a protein of 232 aa with
a calculated molecular mass of 25,878 Da. The coding sequences of
acdAI and acdBI genes start with ATG and stop
with either TAA (acdAI) or TAG (acdBI).
Immediately upstream of the initiation codon of both genes, putative
ribosome-binding sites with the sequence GAGGT were present, as
reported for other Pyrococcus genes (e.g., see references
9 and 24). Archaeal promoter
regions, TATA boxes, and initiator elements (21) were not
found. Downstream from the acdBI gene, rather than from the
acdAI gene, a pyrimidine-rich region within 16 to 19 nucleotides with the consensus sequence TTTTTYT, indicating
a transcription termination site, was identified (22). The
G+C contents of the acdAI and acdBI genes are
43.3 and 40.3 mol%, respectively, and thus are slightly higher than the value of 38.5 mol% reported for the total genome of P. furiosus (6).
(AcdAI) and
(AcdBI) subunits from
P. furiosus were compared to those of proteins in the
database derived from genome sequences (2, 5, 10, 11).
Several proteins showing significant amino acid sequence identity were
identified (Fig. 1). The highest degrees
of identity (93 and 83%) were found with two proteins from
Pyrococcus horikoshii, which indicates the presence of
acdAI and acdBI homologous genes encoding an
acetyl-CoA synthetase (ADP forming) isoform I in this
Pyrococcus species. A lower degree of identity (about 50%)
for both the
and
subunits was found within proteins from both
P. furiosus and P. horikoshii. These proteins had
N-terminal amino acid sequences and deduced molecular masses almost
identical to those of the
and
subunits of acetyl-CoA synthetase
(ADP forming) isoform II purified from P. furiosus (14). Thus, the sequence data indicate the presence of
genes, acdAII and acdBII, encoding the acetyl-CoA
(ADP forming) isoform II (Acd II) in both Pyrococcus
species.

View larger version (23K):
[in a new window]
FIG. 1.
Comparison of deduced amino acid sequences of the
subunit (462 aa) and the
subunit (233 aa) of acetyl-CoA synthetase
(ADP forming) isoform I from P. furiosus with hypothetical
proteins of P. horikoshii (212 aa), M. jannaschii
(704 aa), A. fulgidus (685 aa), and E. coli (886 aa) deduced from genome sequences (2, 5, 10, 11). EMBL
accession numbers of the proteins are given in brackets. Amino acid
sequence identities given in white boxes are for the homologous
subunits of the Pyrococcus proteins and the N-terminal parts
(456 aa each) of proteins of M. jannaschii, A. fulgidus, and E. coli. Sequence identities given in
shaded boxes are for the homologous
subunits of
Pyrococcus proteins and the C-terminal parts of proteins of
M. jannaschii (248 aa), A. fulgidus (229 aa), and
E. coli (430 aa).
and
subunits of acetyl-CoA synthetase (ADP forming). The
subunit was found to align in the N-terminal part (456 aa) with a
sequence identity of 30 to 44%, whereas the
subunit aligns best
within the C-terminal part of the proteins (13 to 46% identity).
Whether these hypothetical proteins constitute functional acetyl-CoA
(or acyl-CoA) synthetases (ADP forming), in which the
and
subunits are fused, remains to be established. In the
and
subunits of the AcdI protein, several amino acid stretches which were
almost completely conserved in all proteins shown aligned in Fig. 1
were identified (e.g., the
subunit contained PKXVAVIGAS [aa 9 to
18], MRILGPNXXGVV [aa 128 to 139], GXLAXISQSGA [aa 157 to 167],
and IXIYMEGVXDGRRFM [aa 213 to 227]; the
subunit contained
IGYPVVMKIXSPQIXHKS [aa 56 to 73] and DFQFGXXVMFGXGGI [aa 130 to
144]); however, substrate binding domains, e.g., for nucleotides, CoA,
and Pi, have yet to be identified.
Expression of acdAI and acdBI genes in
E. coli.
The identity of putative acdAI and
acdBI genes as coding genes for the
and
subunits of
acetyl-CoA synthetase (ADP forming) isoform I was proved by functional
overexpression in E. coli. pET-14b and pET-17b protein
expression vectors as well as E. coli JM109 and BL21(DE3)
were purchased from Novagen. P. furiosus (DSM 3638)
(6) was grown at 90°C with starch as a carbon and energy source, as described previously (8). The acdAI
and acdBI genes were amplified by PCR with genomic DNA of
P. furiosus as the template. The PCR product of
acdAI was cloned in pET-17b by using the forward oligonucleotide primer
5'AATTTGACATATGAGTTTGGAGGCTCTTTTTAATC'3 extended
by an NdeI restriction site and the reverse complement oligonucleotide primer
5'CCGCTCGAGTTACTTTTCTTTGTGTTTTGCTTTC'3 containing an XhoI site (restriction sites
underlined). The PCR product of acdBI was cloned in pET-14b
by using the restriction sites NcoI and XhoI and
the primers 5'GATGCCATGGACAGGGTTGCTAAG'3 and
5'CGCCTCGAGCTAAAGAATCATCCTAGC'3. The recombinant
plasmids were named pET-17b(acdAI) and
pET-14b(acdBI). The inserted gene sequence was confirmed on
each strand by the Sanger method. The two expression vectors
pET-17b(acdAI) and pET-14b(acdBI) were transformed separately into E. coli BL21(DE3). Cells were
grown in 400 ml of Luria-Bertani medium at 37°C to an optical density at 600 nm of 1.0, and expression was initiated by the addition of 0.4 mM IPTG (isopropyl-
-D-thiogalactopyranoside). After
3 h of further growth, the cells were harvested by centrifugation at 4°C. The pellet was frozen at
20°C. Cell extracts were
prepared by passing cell suspensions in buffer (150 mM NaCl, 20 mM Tris HCl [pH 8.0]) through a French pressure cell at 150 MPa. After centrifugation at 40,000 × g for 1 h, the
resulting supernatant (cell extract, 3 to 4 mg of protein/ml) was
analyzed for overexpressed
and
subunits and used for
reconstitution experiments.
subunit [AcdAI]) and 25 kDa (
subunit [AcdBI])
were overexpressed as revealed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of cell extracts. Heat treatment (15 min at 80°C) of the extracts resulted in a significant enrichment (>80%) of the recombinant
or
subunit as judged by
SDS-PAGE (data not shown). The oligomeric state of the recombinant subunits obtained after heat treatment was analyzed by gel filtration chromatography on a Superdex 200 HiLoad 26/60 column, equilibrated with
20 mM Tris HCl buffer, pH 8.0, containing 0.15 M NaCl. For the
respective subunits more than 80% of the protein applied (1.2 mg each)
was eluted at an apparent molecular mass of about 90 kDa (
subunit)
or about 55 kDa (
subunit), indicating that the recombinant subunits
were present predominantly as dimers.
Reconstitution and purification of recombinant acetyl-CoA
synthetase (ADP forming).
Equal amounts of E. coli
extracts (3 mg/ml) containing recombinant
and
subunits (AcdAI
and AcdBI) were mixed and incubated on ice (1 h). The combined extracts
exhibited acetyl-CoA synthetase (ADP forming) activity of about 1 U/mg
at 55°C (for direction of acetate formation, see reference
7), indicating that the subunits had been
reconstituted to an active enzyme. The enzyme was purified about
10-fold by heat treatment (15 min at 80°C) and subsequent
anion-exchange chromatography, as follows. Heat-precipitated host cell
proteins were removed by centrifugation. The resulting supernatant was
applied to a 6-ml Resource Q column equilibrated with 20 mM Tris HCl
buffer, pH 8.0, containing 10 mM MgCl2. Protein was eluted
with a linear gradient from 0 to 0.4 M NaCl in buffer (150 ml). Highest
activity of acetyl-CoA synthetase (ADP forming) was eluted at 0.14 M
NaCl. Protein purity was assessed by SDS-PAGE analysis. This two-step
purification yielded a homogeneous preparation of recombinant
holoenzyme, as indicated by two bands in SDS-PAGE (Fig.
2), which showed the same apparent
molecular masses as the enzyme purified from P. furiosus
(7).
|
Biochemical characterization of recombinant acetyl-CoA synthetase
(ADP forming).
The purified recombinant acetyl-CoA synthetase (ADP
forming) was biochemically analyzed with respect to molecular and
catalytical properties and compared with the native enzyme purified
from P. furiosus (7). Enzyme activity
(acetyl-CoA + ADP + P
acetate + ATP + CoA) was
measured in both directions as described previously (7).
Optimum temperature and thermostability (between 80 and 110°C) of the
enzyme were determined as described previously (7). The
apparent molecular masses of the enzyme (determined by gel filtration)
and of its subunits (determined by SDS-PAGE) and the apparent
Km values of all substrates were almost
identical, as reported for the enzyme isolated from P. furiosus; however, the apparent Vmax values
were about 40 to 50% lower (Table 1).
The recombinant enzyme showed almost identical thermostability and pattern of heat inactivation, i.e., it did not lose activity upon incubation for 3 h at 90°C, but it lost about 60% of its
activity after 2 h at 100°C (see Fig. 3 in reference
7).
|
and
subunits yielded a recombinant heterotetrameric acetyl-CoA
synthetase (ADP forming) with properties very similar to those of the
native enzyme isoform I isolated from P. furiosus (7). So far, only three heterooligomeric enzymes from
hyperthermophiles have been functionally overexpressed in E. coli by processes involving reconstitution of separately expressed
subunits: heterodimeric reverse gyrase from Methanopyrus
kandleri (12) and heterotetrameric DNA topoisomerase VI
from Sulfolobus shibatae (4) and indolepyruvate ferredoxin oxidoreductase from Pyrococcus kadokaraensis
(20). In conclusion, the successful heterologous expression
of acetyl-CoA synthetase (ADP forming) isoform I will allow detailed
biochemical analyses of this unusual enzyme in the future, e.g.,
studies of structure-function relationships following crystallization
and mechanistical studies involving site-directed mutagenesis.
Nucleotide sequence accession numbers. The nucleotide sequences reported in this paper have been submitted to the EMBL nucleotide sequence database with the accession no. AJ240061 (acdAI) and AJ240062 (acdBI).
| |
ACKNOWLEDGMENTS |
|---|
We thank K. Lutter-Mohr for skillful technical assistance.
This work was supported by a grant from the European Union ("Extremophiles as cell factories") and the Fonds der Chemischen Industrie.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Institut für Allgemeine Mikrobiologie, Christian-Albrechts-Universität Kiel, Am Botanischen Garten 1-9, D-24118 Kiel, Germany. Phone: 49-431-880-4328. Fax: 49-431-880-2194. E-mail: peter.schoenheit{at}ifam.uni-kiel.de.
Dedicated to Rolf Thauer on the occasion of his 60th birthday.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Altschul, S. F., W. Gish, W. Miller, W. Meyers, and D. L. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline]. |
| 2. |
Blattner, F. R.,
G. Plunkett III,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1462 |
| 3. |
Bock, A.-K.,
J. Glasemacher,
R. Schmidt, and P. Schönheit.
1999.
Purification and characterization of two extremely thermostable enzymes, phosphate acetyltransferase and acetate kinase, from the hyperthermophilic eubacterium Thermotoga maritima.
J. Bacteriol.
181:1861-1867 |
| 4. |
Buhler, C.,
D. Gadelle,
P. Forterre,
J. C. Wang, and A. Bergerat.
1998.
Reconstitution of DNA topoisomerase VI of the thermophilic archaeon Sulfolobus shibatae from subunits separately overexpressed in Escherichia coli.
Nucleic Acids Res.
26:5157-5162 |
| 5. | Bult, C., O. White, G. J. Olsen, L. Zhou, R. D. Fleischmann, G. G. Sutton, J. A. Blake, L. M. FitzGerald, R. A. Clayton, J. D. Gocayne, A. R. Kerlavage, B. A. Dougherty, J. F. Tomb, M. D. Adams, C. I. Reich, R. Overbeek, E. F. Kirkness, K. G. Weinstock, J. M. Merrick, A. Glodek, J. L. Scott, N. S. M. Geoghagen, and J. C. Ventner. 1996. Complete genome sequence of the methanogenic archaeon Methanococcus jannaschii. Science 273:1058-1073[Abstract]. |
| 6. | Fiala, G., and K. O. Stetter. 1986. Pyrococcus furiosus sp. nov. represents a novel genus of marine heterotrophic archaebacteria growing optimally at 100°C. Arch. Microbiol. 145:56-61. |
| 7. | Glasemacher, J., A.-K. Bock, R. Schmid, and P. Schönheit. 1997. Purification and properties of acetyl-CoA synthetase (ADP-forming), an archaeal enzyme of acetate formation and ATP synthesis, from the hyperthermophile Pyrococcus furiosus. Eur. J. Biochem. 244:561-567[Medline]. |
| 8. |
Hethke, C.,
A. C. M. Geerling,
W. Hausner,
W. de Vos, and M. Thomm.
1996.
A cell-free transcription system for the hyperthermophilic archaeon Pyrococcus furiosus.
Nucleic Acids Res.
24:2369-2376 |
| 9. |
Jorgensen, S.,
C. E. Vorgias, and G. Antranikian.
1997.
Cloning, sequencing, characterization, and expression of an extracellular -amylase from the hyperthermophilic archaeon Pyrococcus furiosus in Escherichia coli and Bacillus subtilis.
J. Biol. Chem.
272:16335-16342 |
| 10. | Kawarabayasi, Y., et al. 1998. Complete sequence and gene organization of the genome of a hyperthermophilic archaebacterium, Pyrococcus horikoshii OT3. DNA Res. 30:55-76. |
| 11. | Klenk, H. P., R. A. Clayton, J. F. Tomb, O. White, K. E. Nelson, K. A. Ketchum, R. J. Dodson, M. Gwinn, E. K. Hickey, J. D. Peterson, D. L. Richardson, A. R. Kerlavage, D. E. Graham, N. C. Kyrpides, R. D. Fleischmann, J. Quackenbush, N. H. Lee, G. G. Sutton, S. Gill, E. F. Kirkness, B. A. Dougherty, K. McKenney, M. D. Adams, B. Loftus, J. C. Ventner, et al. 1997. The complete genome sequence of the hyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus. Nature 390:364-370[Medline]. |
| 12. |
Krah, R.,
M. H. O'Dea, and M. Gellert.
1997.
Reverse gyrase from Methanopyrus kandleri. Reconstitution of an active extremozyme from its two recombinant subunits.
J. Biol. Chem.
272:13986-13990 |
| 13. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline]. |
| 14. |
Mai, X., and M. W. W. Adams.
1996.
Purification and characterization of two reversible and ADP-dependent acetyl coenzyme A synthetases from the hyperthermophilic archaeon Pyrococcus furiosus.
J. Bacteriol.
178:5897-5903 |
| 15. |
Reeves, R. E.,
L. G. Warren,
B. Susskind, and H. Loh.
1977.
An energy-conserving pyruvate-to-acetate pathway in Entamoeba histolytica.
J. Biol. Chem.
252:726-731 |
| 16. | Sanchez, L. B., and M. Müller. 1996. Purification and characterization of the acetate forming enzyme, acetyl-CoA synthetase (ADP-forming) from the amitochondriate protist, Giardia lamblia. FEBS Lett. 378:240-244[Medline]. |
| 17. | Schäfer, T., and P. Schönheit. 1991. Pyruvate metabolism of the hyperthermophilic archaebacterium Pyrococcus furiosus. Acetate formation from acetyl-CoA and ATP synthesis are catalyzed by an acetyl-CoA synthetase (ADP-forming). Arch. Microbiol. 155:366-377. |
| 18. | Schäfer, T., M. Selig, and P. Schönheit. 1993. Acetyl-CoA synthetase (ADP-forming) in archaea, a novel enzyme involved in acetate formation and ATP synthesis. Arch. Microbiol. 159:354-363. |
| 19. | Schönheit, P., and T. Schäfer. 1995. Metabolism of hyperthermophiles. World J. Microbiol. Biotechnol. 11:26-57. |
| 20. | Siddiqui, M. A., S. Fujiwara, M. Takagi, and T. Imanaka. 1998. In vitro heat effect on heterooligomeric subunit assembly of thermostable indolepyruvate ferredoxin oxidoreductase. FEBS Lett. 434:372-376[Medline]. |
| 21. | Thomm, M. 1996. Archaeal transcription factors and their role in transcription initiation. FEMS Microbiol. Rev. 18:159-171[Medline]. |
| 22. | Thomm, M., W. Hausner, and C. Hethke. 1994. Transcription factors and termination of transcription in Methanococcus. Syst. Appl. Microbiol. 16:648-655. |
| 23. | Utah Genome Center Website. [Online.] Sequences. Department of Human Genetics, University of Utah. http://www.genome.utah.edu. [11 May 1999, last date accessed.] |
| 24. |
Zwickel, P.,
S. Fabry,
C. Bogedain,
A. Haas, and R. Hensel.
1990.
Glyceraldehyde-3-phosphate dehydrogenase from the hyperthermophilic archaebacterium Pyrococcus woesei: characterization of the enzyme, cloning and sequencing of the gene, and expression in Escherichia coli.
J. Bacteriol.
172:4329-4338 |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»