Previous Article | Next Article 
Journal of Bacteriology, October 1999, p. 5948-5957, Vol. 181, No. 19
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Regulation of pelD and pelE,
Encoding Major Alkaline Pectate Lyases in Erwinia
chrysanthemi: Involvement of the Main Transcriptional
Factors
Carine
Rouanet,1
Kinya
Nomura,2
Shinji
Tsuyumu,2 and
William
Nasser1,*
Laboratoire de Génétique
Moléculaire des Microorganismes et des Interactions
Cellulaires, CNRS-UMR 5577, 69621 Villeurbanne Cedex,
France,1 and Faculty of Agriculture,
Shizuoka University, 836 Ohya, Shizuoka 422-8529, Japan2
Received 22 March 1999/Accepted 27 July 1999
 |
ABSTRACT |
The main virulence factors of the phytopathogenic bacterium
Erwinia chrysanthemi are pectinases which attack pectin,
the major constituent of the plant cell wall. Of these enzymes, the
alkaline isoenzyme named PelD in strain 3937 and PelE in strain EC16
has been described as being particularly important, based on virulence studies of plants. Expression of the pelD and
pelE genes is tightly modulated by various regulators,
including the KdgR repressor and the cyclic AMP-cyclic AMP receptor
protein (CRP) activator complex. The use of a lacZ reporter
gene allowed us to quantify the repression of E. chrysanthemi 3937 pelD expression exerted by PecS,
another repressor of pectinase synthesis. In vitro DNA-protein interaction experiments, centered on the pelD and
pelE wild-type or pelE mutated promoter
regions, allowed us to define precisely the sequences involved in the
binding of these three regulators and of RNA polymerase (RNAP). These
studies revealed an unusual binding of the KdgR repressor and suggested
the presence of a UP (upstream) element in the pelD and
pelE genes. Investigation of the simultaneous binding of
CRP, KdgR, PecS, and the RNAP to the regulatory region of the
pelD and pelE genes showed that (i) CRP and
RNAP bind cooperatively, (ii) PecS partially inhibits binding of the
CRP activator and of the CRP-RNAP complex, and (iii) KdgR stabilizes
the binding of PecS and prevents transcriptional initiation by RNAP.
Taken together, our data suggest that PecS attenuates pelD
and pelE expression rather than acting as a true repressor
like KdgR. Overall, control of the pelD and
pelE genes of E. chrysanthemi appears to be
both complex and novel.
| |
INTRODUCTION |
The phytopathogenicity of the
pectinolytic erwiniae is mainly due to their capacity to synthesize and
secrete depolymerizing enzymes which macerate the major component of
plant cell walls. Among these enzymes, pectate lyases (Pels) play a
major role since, when purified, they are able to mimic symptoms of the
bacterial infection (11).
Erwinia chrysanthemi 3937 produces five major pectate lyases
encoded by pelA, pelB, pelC,
pelD, and pelE (13). PelB and PelC
have moderately basic pIs (7.5 to 8.5), PelA is acidic (pI 4.5), and
PelD and PelE are strongly basic (pI 9.5 to 10.5) (13). In
the other well-studied E. chrysanthemi strain, EC16, only
four major Pel isoenzymes are present (29). DNA sequence
analysis in this latter strain revealed a deletion event that removed
most of the coding region for the gene corresponding to pelE
in strain 3937. Thus, the major basic isoenzyme in strain EC16, which
corresponds to that encoded by the 3937 pelD gene, was named
PelE (13).
Production of the Pels by E. chrysanthemi is tightly
regulated and responds to various physiological controls, including
growth phase-dependent induction, catabolic repression and variations in environmental conditions such as the presence of pectin or plant
extract, temperature, or nitrogen starvation (13). Several mechanisms modulating the expression of the pel genes in
E. chrysanthemi 3937 have been elucidated. It has been
demonstrated that the full synthesis of Pels requires the presence of
the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex
(23), CRP being proposed to act as the primary activator of
the pelB, pelC, pelD, and
pelE promoters (20). The KdgR repressor
essentially mediates the induction of pel gene expression by
pectic compounds (24), whereas two other loci involved in
the negative regulation of pel gene expression, pecS-pecM and pecT, have also been characterized,
but the signals to which these regulators respond remain unknown
(9, 25, 28). Although in vivo deletion and mutation analyses
conducted on the strain EC16 pelE regulatory region revealed
the existence of various regulatory sequences (12), only one
regulatory gene, pir (plant-inducible gene), was formally
identified (21). It was shown that this gene directs
induction of the pel genes by plant extracts.
In this study, we established that the specific regulators of
pectinolysis identified in strain 3937, PecS and KdgR, are also present
in strain EC16 and display DNA binding activity. Moreover, the elements
directing CRP, KdgR, and PecS binding were identified in the EC16
pelE regulatory region, and their occupancy by these three
proteins as well as by RNA polymerase (RNAP) was investigated in
parallel to the corresponding 3937 pelD promoter. Finally, we propose a mechanism that incorporates the new data and earlier observations to explain the regulation of these two allelic loci.
| |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and culture conditions.
Bacterial strains and plasmids are described in Table
1. E. chrysanthemi and
Escherichia coli cells were grown at 30 and 37°C,
respectively, in Luria-Bertani (LB) medium, synthetic M63 medium, or
2YT medium (18) supplemented, when required, with the
antibiotics ampicillin (100 µg/ml), kanamycin (50 µg/ml), and
chloramphenicol (50 µg/ml). Carbon source was added at 2 g/liter with
the exception of polygalacturonate (PGA) (grade II; Sigma Chemical
Co.), which was added at 4 g/liter.
Proteins.
The KdgR, CRP, and PecS of strain 3937 used in
this work were purified as described previously (19, 20,
22). Protein concentrations were determined by Bradford's method
(5). E. coli RNAP was purchased from TEBU
(distributor for Epicentre Technologies).
Preparation of operator fragments for binding studies.
The
regulatory regions from the E. chrysanthemi EC16 and 3937 pel genes were cloned in pUC18 and pBluescript vectors,
respectively (Table 1). The EC16 pelE operator was labeled
at the top strand by incorporation of [
-32P]dCTP
(3,000 Ci/mmol
1; Amersham) with the Klenow fragment of
DNA polymerase at the MluI end of the
NdeI-MluI fragment (260 bp). For the bottom
strand, the region between 
259 to +139 was amplified by PCR using
pPEL743 as the template and two primers (5'
AGGGGCTTTCAAGCTTTAATAAGGCAC 3' and 5'
GTAAACTTTTAGTTCCTCGAGAACGTAC 3') overlapping the extremities of
this region and containing HindIII and XhoI
cutting sites, respectively. The bottom strand was labeled by
incorporating [-32P]dATP (3,000 Ci/mmol1; Amersham) with the Klenow fragment of DNA
polymerase at the HindIII end. For the 3937 pelD gene, plasmid pN1272 was digested by HpaI
and HindIII. The top strand was labeled at the
HindIII end by incubation in the presence of
[-32P]dCTP (3,000 Ci/mmol1) and Klenow
fragment of DNA polymerase. For labeling the bottom strand, the
HpaI-HindIII fragment was cloned into the
EcoRV-HindIII sites of pBluescript
KS+, (Apr) giving rise to plasmid pWN2481. This
recombinant plasmid was digested by HindII and
EcoRI and further labeled at the EcoRI end by
incorporation of [-32P]dATP (3,000 Ci/mmol1; Amersham) with the Klenow fragment of DNA
polymerase. These labeled fragments were further purified by the
DEAE-cellulose paper procedure (1) or with a Qiagen quick
extraction kit.
Gel retardation assay.
Band shift assays were conducted as
described by Nasser et al. (20) and Praillet et al.
(22). Cobinding studies were performed with a buffer
allowing correct fixation for each of the various regulatory proteins,
consisting of 10 mM Tris-HCl (pH 7.8 or 7), 75 mM KCl, 1 mM
dithiothreitol, 100 µM cAMP, 4 µg of acetylated bovine serum
albumin (BSA), and 1 µg of poly(dI-dC) · (dI-dC) (Pharmacia
LKB) as bulk carrier DNA. After addition of the DNA probe (50,000 cpm)
and of various amounts of the purified CRP, PecS, RNAP, or KdgR, the
reaction mixtures were incubated for 30 min at 30°C, then loaded onto
a 4% nondenaturing polyacrylamide gel, and electrophoresed in 10 mM
Tris-HCl (pH 7.8 or 7) containing 100 µM cAMP. Gels were then dried
and exposed to Amersham MP film.
The apparent dissociation constants (
Kd app)
were determined as described by Carey (
8), with minor
modifications.
Band shift assays were performed as described above,
with a large
dilution scale of the three different regulators (CRP,
PecS, and
KdgR). Autoradiograms were subjected to densitometric
analysis
using BIOPROFIL software (Vilber Loumat). For each dilution of
the regulatory proteins, the ratio of free probe to total DNA
was then
calculated and plotted. The
Kd app is the
regulatory
protein concentration for which half of the DNA probe is
complexed
to the
protein.
Interference experiments.
Base removal was achieved by using
formic acid as a depurinating reagent and hydrazine as a
depyrimidinating reagent (6). Interference experiments were
performed by incubating modified DNA (50,000 cpm) with KdgR (50 nM) as
described for the gel retardation assays. Reaction mixtures were
analyzed by a preparative gel retardation assay. Bands corresponding to
free and complexed DNA were visualized by autoradiography on the wet
gel after 3 h exposure to Amersham MP film at 4°C. Labeled DNA
was cut out of the gel, eluted for subsequent piperidine cleavage, and
analyzed in a sequencing gel.
Shift-Western blotting.
After the gel shift, Western
blotting was done by the semidry blotting method using a multiphor II
NovaBlot electrophoretic transfer unit (Pharmacia) at a fixed current
of 0.8 mA per square centimeter of gel surface area for 90 min. Tris
(48 mM)-glycine (39 mM) containing 0.0375% sodium dodecyl sulfate and
20% (vol/vol) methanol was used as the buffer, and a nitrocellulose
filter was used as the membrane. After electrotransfer, the membranes
were saturated for 2 h at 37°C with 30 g of BSA/liter in
Tris-buffered saline (TBS; 137 mM NaCl, 20 mM Tris-HCl [pH 7.5]),
rinsed extensively with TBS containing 0.1% (vol/vol) Tween 20 (T-TBS), and then incubated for at least 4 h at room temperature
with a 1/400 dilution of the primary antibodies in T-TBS containing
0.5% BSA. The primary antibodies used in this work were purified from
a rabbit antiserum as described by Sakakibara et al. (27).
Finally, enhanced chemiluminescence protein detection was carried out
as described by Amersham, with a goat anti-rabbit immunoglobulin G
conjugated to peroxidase.
Footprinting with DNase I.
DNase I footprinting was
performed as described by Nasser et al. (20), with minor
modifications. About 100,000 cpm of DNA probe, labeled at one end, was
incubated for 30 min at 30°C with the purified protein(s) in the
buffer used for mobility shift assay, and the reaction mixtures were
adjusted to 10 mM MgCl2 and 5 mM CaCl2 just
before the addition of DNase I. DNase I (5 × 103 U;
Boehringer Mannheim) was added, and the mixture was incubated at 30°C
for 1 min. Digestion was blocked by the addition of 25 µl of stop
solution (100 mM EDTA [pH 8.0], 0.4 mg of yeast tRNA/ml), and 50 µl
of ice-cold Tris-EDTA (pH 8.0) was added to increase the volume of the
mixture. After phenol-chloroform extraction, DNA fragments were ethanol
precipitated, resuspended in 10 µl of formamide-dye mixture
(1), and separated by electrophoresis on a 6%
polyacrylamide sequencing gel. Bands were detected by autoradiography.
| |
RESULTS AND DISCUSSION |
Occurrence of active KdgR and PecS proteins in E. chrysanthemi EC16.
The presence of EC16 proteins reacting
with anti-KdgR and anti-PecS in immunoblotting experiments was
previously reported. These results, as well as the observation of
increased expression of the pel genes in the presence of
pectic derivatives, suggested that homologues of KdgR and PecS are
present in E. chrysanthemi EC16 (12, 22, 29a).
However, no direct evidence supporting this hypothesis has been obtained.
To investigate the existence of active KdgR and PecS proteins in
E. chrysanthemi EC16, we performed band shift experiments
using protein extracts from
E. chrysanthemi EC16 cells grown
in
LB medium and the regulatory regions of pectinolysis genes from
strain EC16 (
pelE) or 3937 (
pelD and
pelA). The protein extracts
were enriched in KdgR or PecS by
fractional precipitation with
ammonium sulfate. Fractions containing
KdgR and PecS were identified
by Western blot analysis (fractions
corresponding to 20 to 40%
and 55 to 70% ammonium sulfate saturation,
respectively). Gel
retardation assays revealed in each case the
formation of DNA
protein complexes with both EC16
pelE and
3937
pelD or
pelA. The
complexes obtained with
the fraction containing KdgR and PecS
could be displaced by addition of
specific KdgR and PecS antibodies,
respectively (Fig.
1). Using shift-Western blotting
experiments
in the presence of the specific KdgR or PecS antibody, we
detected
a band in the major complexes obtained with the fraction
corresponding
to 20 to 40 or 55 to 70% ammonium sulfate saturation,
respectively
(data not shown). Thus,
E. chrysanthemi EC16
contains active PecS
and KdgR proteins. Moreover, binding of the EC16
PecS and KdgR
proteins on the 3937
pelA and
pelD
regulatory regions demonstrated
that the regulators PecS and KdgR from
E. chrysanthemi EC16 and
3937 are interchangeable.
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Detection of the E. chrysanthemi EC16 KdgR
and PecS proteins by electrophoresis mobility shift assays. The
E. chrysanthemi 3937 pelD promoter-operator
region (A) was incubated with 0, 2, 10, and 30 µg of E. chrysanthemi EC16 proteins contained in the 20 to 40% ammonium
sulfate-saturated fraction (lane 1 to 4) or with 30 µg of E. chrysanthemi EC16 proteins contained in the 20 to 40% ammonium
sulfate-saturated fraction followed by the addition of KdgR antibodies
(lane 5). The E. chrysanthemi EC16 pelE
promoter-operator region (B) was incubated with 0, 2, 10, and 30 µg
of E. chrysanthemi EC16 proteins contained in the 55 to 70%
ammonium sulfate-saturated fraction (lane 1 to 4) or with 30 µg
followed by the addition of PecS antibodies (lane 5).
|
|
Interaction of KdgR and CRP with the EC16 pelE
regulatory region.
Previous deletion and mutation analyses of the
E. chrysanthemi EC16 pelE gene allowed
identification of two putative negative regulatory sequences, named
operator 1 (OP1) and operator 2 (OP2), and a putative positive operator
which was proposed as being a CRP binding site centered at position
43.5 (12) (Fig. 2). Further in vitro DNA-protein interaction studies conducted with the E. chrysanthemi 3937 pelD promoter, which is similar in
organization of regulatory sequences to the EC16 pelE gene
(13) (Fig. 2), and the purified KdgR or CRP established that
the positive operator corresponds to a CRP binding site. Moreover, the
region protected by KdgR, as revealed by DNase I footprinting,
encompassed OP1 as well as OP2 (20). Noticeable was the fact
that only OP1 contained the consensus sequence recognized by KdgR,
called a KdgR box (19) (Fig. 2). Therefore, it was of
interest to confirm the involvement of the different operators
identified in the EC16 pelE gene in the binding of CRP and
KdgR. For this purpose, the modified promoters previously used for in
vivo analyses (12) were submitted to band shift and
footprinting experiments in the presence of the purified regulatory
proteins.
View larger version (47K):
[in this window]
[in a new window]
|
FIG. 2.
Organization of the promoter-operator region of the
E. chrysanthemi EC16 pelE (A) and 3937 pelD (B) genes. The sequences are numbered from the
transcription start site (+1, G base). The regions protected by the
various regulatory proteins are delineated based on the examination of
both DNA strands. Regions corresponding to the 10/35 promoter sites
and the AT-rich region protected by RNAP, and which include the
sequence showing homology with the consensus
(AAA[A/T][A/T]T[A/T]TTTT--AAAA) proposed by Ross et
al. (26) (putative UP elements), are underlined; arrowheads
indicate the ends of the region protected by PecS in DNase I
footprinting experiments; the sequences boxed with bold and solid lines
indicate the binding sites for cAMP-CRP and KdgR, as defined by DNase I
footprinting experiments, respectively; the nucleotides in bold,
located in the boxed regions, correspond to the sequences that show
homology with the consensus binding site for cAMP-CRP
(AATGTGAN6TCACATT [15]) and KdgR
([AATAGAAATC]N[NCATGTTTTCA]
[19]), respectively; the regions corresponding to the
previously proposed OP1 and OP2 by Gold et al. (12) are
overlined by dashed lines; the ATG translation initiation codons are
indicated in bold; on the EC16 pelE operator, asterisks
indicate the nucleotides contacting the KdgR repressor, as deduced from
base removal experiments.
|
|
In vitro analysis of the CRP binding on the EC16
pelE
promoter revealed that there are in fact two distinct binding sites
of
different affinities. The major one, centered at position
43.5,
corresponds to that identified in the in vivo experiments. The
second
one, displaying a high degree of degeneration with regard
to the
consensus proposed for the binding site of the
E. coli CRP
(
15), is centered at position
74.5 (Fig.
2). Binding
experiments
performed with the
pelE promoter modified in the
CRP high-affinity
site (i.e., deleted of the TGA residues at position
43) showed
that CRP is able to bind to the upstream site, but with an
eightfold-decreased
affinity (Fig.
3A and
B). Moreover, DNase I footprinting
experiments
using this mutated OP1 revealed that protection of the
low-affinity
CRP binding site requires a concentration of CRP higher
than that
necessary with the wild-type promoter (400 nM versus 100 nM)
(data
not shown). Based on these two observations and taking into
account
the proximity of the two protected regions (Fig.
2) gradually
occupied by CRP (Fig.
3C), it is reasonable to assume a cooperative
binding of CRP at these two adjacent sites. This cooperativity
could
compensate for the relatively high degenerency of the two
CRP binding
sites and thus explain why
pelD expression is more
highly
CRP regulated in vivo than expression of the other pectinolysis
genes
(
23).
View larger version (92K):
[in this window]
[in a new window]
|
FIG. 3.
Binding of CRP, RNAP, and KdgR on the EC16
pelE promoter-operator region. (A) Band shift assays on the
parental operator. Lanes 1 to 5, incubation with 0, 10, 20, 50, and 200 nM purified CRP, respectively; lane 6, incubation with 20 nM CRP and 70 nM RNAP; lane 7, incubation with 200 nM CRP and 250 nM RNAP; lane 8, incubation with 250 nM RNAP; lane 9, incubation with 250 nM RNAP and 50 nM KdgR; lane 10, incubation with 250 nM RNAP and 200 nM KdgR; lanes 11 to 14, incubation with 200, 100, 50 and 10 nM purified KdgR,
respectively. (B) Band shift assays for the binding of CRP and RNAP on
the operator modified in the CRP high-affinity site (i.e., deleted of
the ATG residue at position 43). Lanes 1 to 5, incubation with 0, 10, 20, 50, and 200 nM purified CRP, respectively; lane 6, incubation with
20 nM CRP and 70 nM RNAP; lane 7, incubation with 200 nM CRP and 250 nM
RNAP; lane 8, incubation with 250 nM RNAP. (C) DNase I footprinting
digestions on the parental operator. Lanes 1 and 16, control
digestions; lanes 2 to 4, digestion in the presence of 10, 50, and 200 nM purified CRP, respectively; lane 5, digestion in the presence of 10 nM CRP and 70 nM RNAP; lane 6, digestion in the presence of 50 nM CRP
and 70 nM RNAP; lane 7, digestion in the presence of 200 nM CRP and
RNAP; lane 8, reaction in the presence of 200 nM CRP and 70 nM RNAP;
lanes 9 and 10, reaction in the presence of 70 or 250 nM RNAP,
respectively; lane 11, digestion in the presence of 250 nM RNAP, 50 nM
CRP, and 50 nM KdgR; lane 12, reaction in the presence of 250 nM RNAP,
100 nM CRP, and 100 nM KdgR; lane 13, digestion in the presence of 250 nM RNAP and 50 nM KdgR; lanes 14 and 15, reaction in the presence of 10 and 50 nM KdgR, respectively. The asterisks indicate the DNase
I-hypersensitive sites induced by CRP binding, the CRP1 and CRP2 sites
are indicated on the left.
|
|
A unique KdgR complex, displaying an affinity
(
Kd = 0.9 nM) similar to that obtained for the
3937
pelD gene (
20), was observed
with the native
pelE promoter. However, at a high KdgR concentration
(200 nM), an overshift of the KdgR-DNA complex was obtained (Fig.
4A). This overshift could result from the
binding on this DNA
fragment of an additional KdgR dimer. The KdgR
binding capacity
was strongly decreased when OP1, containing the KdgR
consensus,
was partially deleted, clearly demonstrating the recognition
of
this site by KdgR (Fig.
4A). In contrast, a mutation within OP2
did
not seem to significantly affect KdgR binding. A double mutation
in
both operators resulted in the absence of complex formation
(Fig.
4A).
Accordingly, DNase I footprinting analysis revealed
that KdgR protects
the region spanning
4 to +52 in the parental
operator and in the
OP2-modified operator, whereas no protected
region could be observed
with the operator modified in both OP2
and OP1 sequences. A more
limited region (+11 to +47) was protected
on the OP1-modified operator
when high KdgR concentrations were
used (200 nM versus 20 nM for the
parental operator) (Fig.
4B).
These results suggest that although OP2
is not essential for the
efficient binding of KdgR on the
pelE promoter, it could favor
the binding of this repressor
in particular conditions, for example,
during the elongation step when
the transcriptional machinery
overlaps a part of the KdgR box.
View larger version (73K):
[in this window]
[in a new window]
|
FIG. 4.
Interactions between the KdgR repressor and the
wild-type E. chrysanthemi EC16 pelE operator (WT)
or its derivatives modified in OP1 (op1), in
OP2 (op2), or in both
(op1 + op2). (A)
Band shift assay. The DNA fragment (about 10 fmol), isolated and
labeled as described in Materials and Methods, was incubated with 0, 1, 5, 10, 15, 20, or 200 nM purified KdgR (lane 1, 2, 3, 4, 5, 6, or 7, respectively). (B) DNase I footprinting experiments. The purified KdgR
protein was added to a final concentration of 20, 75, or 200 nM (lane
2, 3, or 4, respectively). Lanes 1, control digestion. The sequences
are numbered with respect to the transcription start site (+1).
|
|
To assess if the KdgR protein indeed interacts with nucleotides of OP2,
we used the missing-contact chemical approach, whereby
individual bases
within the DNA helix can be removed by treatment
with formic acid or
hydrazine (
6). The corresponding electrophoresis
patterns
are shown in Fig.
5A. By comparing the
intensity of bands
corresponding to complexed DNA (lanes C) and free
DNA (lanes F),
significant alterations affecting 43 bases essentially
distributed
in OP1 and OP2 were observed. Quantitative analysis of the
involvement
of all of these nucleotides in KdgR binding (Fig.
5B)
revealed
that most of the bases belonging to OP1, particularly those
which
constitute the AAAA (+11 to +14) and ATTT (+19 to +22) motifs
previously proposed as key elements in the KdgR box (
19),
strongly
interact with the KdgR repressor. In addition to the
nucleotides
of OP1, the motif TTT (+42 to +44), probably belonging to
the
right half-site of OP2, also strongly interacts with KdgR. In
contrast, only a slight interaction could be detected between
KdgR and
the bases of the OP2 left half-site (+34 to +37). This
result, which
differs from the model proposed for KdgR binding
consisting of a
symmetrical interaction with the two half-sites
of a KdgR box
(
19), as observed with OP1, could explain the
preferential
binding of KdgR on OP1 versus OP2 revealed by band
shift and DNase I
footprinting experiments. Finally, as previously
mentioned for the 3937
pelE operator (
19), removal of the thymines
(+25
to +30) juxtaposing the OP1 right half-site interfered with
KdgR
binding. Furthermore, of particular interest was the detection
of
increased KdgR affinity for the EC16 operator when the guanine
bases at
position +6, +7, and +16 were modified (Fig.
5). This
could result from
a higher flexibility of the operator. This finding
suggests that KdgR
affinity for a DNA fragment depends not only
on the homology of its
sequence with the KdgR box but also on
its relative AT content, which
is crucial for flexibility.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
Analysis of base removal on the coding strand of the
E. chrysanthemi EC16 pelE promoter-operator
region. (A) DNA molecules were treated with either formic acid to
remove G+A or hydrazine to remove C+T and then incubated with KdgR
before electrophoresis. DNA isolated from repressor-DNA complexes
(lanes C) and DNA that was free of complexes (lanes F) were cleaved by
piperidine, electrophoresed, and autoradiographed. (B) Summary of the
data obtained by the interference method for the EC16 pelE
gene. The magnitude of the effect observed upon removal of a given base
is indicated by the size of the bar above (binding interference) or
below (enhanced binding) this base; the regions deleted in the modified
operators, OP1 and OP2, are underlined.
|
|
Based on in vitro DNA-protein interactions, it appears that (i) signals
required for the binding of KdgR are contained in
the
pelE
OP1 identified by Gold et al. (
12), which perfectly
matches
the consensus previously determined for the KdgR binding
site
(
19), and (ii) the efficient binding of KdgR on OP2
(
12)
probably requires prebinding of the KdgR dimer on OP1.
This new
insight into the KdgR binding on the
pelD/E
promoter correlates
with in vivo observations (
12),
especially the fact that a double
OP1-OP2 mutation displays the same
phenotype as a single OP1
mutation.
Two hypotheses could explain the partial constitutivity resulting from
a single OP2 mutation. (i) At high KdgR concentrations,
OP2 allows for
the efficient binding of an additional dimer, giving
rise to a
high-order KdgR complex responsible for improved repression.
Similar
examples have been reported for various repressors, including
E. coli TyrR and ArgR (
10). (ii) Alternatively, OP2 could
allow
the binding of an unidentified regulator protein acting
synergically
with KdgR and whose action would strictly depend on the
simultaneous
presence of KdgR. This isorepressor may be the regulator
found
by Tsuyumu et al. (
30) in
E. chrysanthemi
extracts and able
to bind to the OP2
operator.
Overall, the particular organization of the KdgR binding sites revealed
by this work and the possible involvement of a corepressor
offer the
first explanation for the fact that
pelD is more tightly
regulated by the KdgR repressor than any other of the genes encoding
pectinases in
E. chrysanthemi 3937 (
20,
24).
The CRP and PecS high-affinity binding sites are superimposed on
the pelD/pelE promoter.
Although gel retardation
experiments showed that PecS is able to specifically interact with the
regulatory region of some virulence genes (i.e., genes encoding pectate
lyases, the EGZ cellulase, or OutC, belonging to the specific machinery
responsible for pectinase and cellulase secretion), no clear mechanism
for PecS activity has yet been proposed (22). Indeed, in
most cases (pelA, pelB, pelC,
pelE, and pelL of strain 3937), it was impossible to footprint the precise location of the PecS binding site on target
genes. In other cases (celZ and outC genes), the
transcriptional starts of the regulated genes were not available. To
provide further information on PecS control of the pel
genes, in vitro interaction experiments were performed with the
regulatory regions of the 3937 pelD and EC16 pelE genes.
The PecS protein displayed similar affinities
(
Kd of about 200 nM) for the 3937
pelD and EC16
pelE genes. In cobinding
experiments
using the concentration determined as saturating for the
CRP activator
and the PecS repressor, only a slight overshift
corresponding
to the binding of both proteins was observed (Fig.
6). Most of
the probe gives a band
migrating at the position of the PecS-DNA
complex, suggesting a
preferential binding of PecS (Fig.
6A).
When the EC16
pelE
operator was modified in its high-affinity
CRP binding site, its
affinity for PecS decreased about fivefold
(Fig.
6B). On the contrary,
modifications in the regulatory sequences
OP1 and OP2 had no
significant effect on PecS binding (data not
shown). Thus, it appears
that the high-affinity binding sites
for PecS and CRP are either
superimposed or at least overlapping.
Moreover, DNase I footprinting
analysis revealed a single highly
protected region by PecS (
70 to
20) which entirely encompasses
the CRP high-affinity binding site
(CRP1) (Fig.
7). The partial
formation of
a ternary complex (CRP-PecS-DNA), detected in the
band shift assays
(Fig.
6A), could then result from the binding
of the PecS and CRP to
the sites corresponding to CRP1 and CRP2,
respectively. The repressor
activity of PecS could then essentially
result from its capacity to
inhibit the binding of the CRP activator
at its high-affinity site,
CRP1.
View larger version (66K):
[in this window]
[in a new window]
|
FIG. 6.
Cobinding of PecS and CRP on the EC16 pelE
promoter-operator region. (A) Gel shift assays with the wild-type EC16
regulatory region. The concentration of the proteins used are indicated
at the top. In lanes 6 and 8, the two proteins were added
simultaneously; in lane 5, CRP was incubated 30 min before addition of
PecS; in lane 7, PecS was incubated 30 min before addition of CRP. (B)
Analysis of the effect of the modification in the CRP binding site 1 (CRP1) on the PecS binding capacity by electrophoresis
gel shift assays. WT, wild type.
|
|
View larger version (48K):
[in this window]
[in a new window]
|
FIG. 7.
Analysis of the cobinding of KdgR and PecS on the
E. chrysanthemi 3937 pelD promoter-operator
region by DNase I footprinting. Lanes 1 and 9, control digestions;
lanes 2 and 3, reaction in the presence of 50 and 200 nM purified PecS,
respectively; lane 4, digestion in the presence of 25 nM PecS and 20 nM
KdgR; lane 5, reaction in the presence of 50 nM PecS and 20 nM KdgR;
lanes 6 and 7, digestion in the presence of 20 and 200 nM KdgR,
respectively; lane 8, reaction in the presence of PecS 200 nM and 100 nM KdgR.
|
|
The E. chrysanthemi EC16 pelE and 3937 pelD genes contain a putative UP element.
The
synergistic binding of CRP and RNAP has already been described
(7). We therefore conducted band shift and DNase I
protection assays with the 3937 pelD and the EC16
pelE genes with RNAP in the presence or absence of CRP.
Similar results were obtained for both genes. Thus, only data for the
EC16 pelE gene are presented (Fig. 3). In the presence of 70 nM RNAP, which corresponds to a subsaturating concentration based on
band shift experiments, only the protected region spanning 142 to
104 was detectable. At a saturating concentration of RNAP (250 nM), a
second, weaker protected region spanning 50 to +15 appeared (Fig.
3C). This second protected region, which encompasses the predicted
70 RNAP consensus, became clearer in the presence of
both CRP and RNAP, parallel to the protection of the two CRP binding
sites (Fig. 3C), thus confirming the synergistic binding of these two proteins. Similar experiments carried out with the EC16 pelE
operator containing a mutation in the CRP high-affinity binding site
showed that the synergistic binding of CRP and RNAP is conserved but a
higher CRP concentration is needed (200 nM versus 20 nM for the
parental operator) (Fig. 3A and B). Of particular interest is the
detection of the RNAP-protected region spanning 142 to 104. This
area, which is particularly rich in A+T residues (up to 80%), could
act as a UP (upstream) element. Because of the very low level of
pelD/E expression obtained in the absence of the activator
protein CRP (12, 23), the involvement of this sequence in
pelD/E transcription could not be supported by in vitro
evidence. However, the protection of this region by RNAP observed in
DNase I footprinting experiments and the remarkable homology of the
middle part of the sequence (positions 132 to 116,
AAAATTCAATTCAACAT for EC16 pelE and
AAAATTAATTCAACATT for 3937 pelD) (Fig. 2) with
the consensus (AAA[A/T][A/T]T[A/T]TTTT--AAAA) proposed by
Ross et al. (26) argue in favor of the existence of an UP
element. Accordingly, previous in vivo deletion studies have shown that
the removal of the EC16 pelE region located upstream of
position 90 decreased EC16 pelE gene expression by about
30-fold (12). This is comparable to the variation reported
when the UP element identified in the E. coli rrnBP1
promoter was deleted (26). Remarkable is the presence of
similar AT-rich sequences in the distal promoter regions of the three
other major pectinase genes whose transcription is also strictly CRP
dependent (E. chrysanthemi 3937 pelB,
pelC, and pelE). The UP element could thus be a
new feature common to the major pel genes.
Simultaneous binding of the transcriptional machinery with the PecS
or KdgR repressor on the EC16 pelE and 3937 pelD genes.
Although the mechanism of action of the
KdgR and PecS repressors on pel gene expression was
individually investigated in vivo, no detailed description of the
simultaneous action of these two regulatory proteins on pel
gene expression has been provided. To assess this question, we used a
double in vivo and in vitro approach. Quantification of
pelD-lacZ transcriptional fusion expression in the parental
strain and in kdgR, pecS, and
kdgR-pecS mutants revealed that the derepression ratio
observed in the two single mutants was slightly lower than that
obtained in the double pecS-kdgR mutant (Table
2). This result suggests that the effects
of the kdgR and pecS mutations on pelD
gene expression are cumulative.
In vitro band shift assays revealed that both KdgR and PecS could
simultaneously interact with the EC16
pelE and 3937
pelD genes (data not shown). To analyze whether PecS and
KdgR can interact
in a cooperative, independent, or antagonistic way,
we performed
band shift assays in the presence of these two regulators.
The
mutual influence of PecS and KdgR on their binding ability was
estimated by using control reactions containing only one of the
two
proteins. Addition of a subsaturating quantity of KdgR and
PecS to a
solution containing the 3937
pelD or EC16
pelE
promoter
fragment resulted in three protein-DNA complexes: two
corresponding
to the KdgR-DNA and PecS-DNA individual complexes and one
corresponding
to the KdgR-PecS-DNA complex. At a saturating
concentration of
PecS and KdgR proteins, only a ternary complex was
observed (data
not shown). Simultaneous binding of both regulators did
not modify
their respective affinities for 3937
pelD and
EC16
pelE promoters.
Thus, these results suggest that there
is neither cooperativity
nor competition in the binding of the two
repressors. Besides,
DNase I footprinting experiments showed that the
protected area
observed after the simultaneous incubation of PecS and
KdgR roughly
corresponds to the addition of the areas protected by PecS
and
KdgR proteins alone (Fig.
7). However, in the presence of KdgR,
the
region corresponding to PecS binding is more strongly protected
(Fig.
7). This could reflect stabilization of the PecS-DNA interaction
by the
KdgR regulator and could explain the low basal level of
pelD
expression due to more effective repression by the KdgR-PecS
complex.
Furthermore, the dependency between these two repressors
which respond
to different signals could allow for a gradual but
coordinate
derepression of
pelD/E expression.
As previously shown for the 3937
pelD gene (
20),
CRP and KdgR are able to bind simultaneously and independently to the
EC16
pelE regulatory region. To elucidate the mechanism
directing the
repression of transcription of these two genes by KdgR
and PecS,
we performed cobinding experiments involving the proteins of
the
transcription initiation machinery, CRP and RNAP, and each of
the
two
repressors.
Band shift assays clearly showed that KdgR and RNAP are able to bind
simultaneously to the regulatory regions of EC16
pelE (Fig.
3) and 3937
pelD (data not shown). DNase I footprinting
experiments revealed that the presence of KdgR does not prevent
occupancy of the putative UP region by the RNAP or occupancy of
the
142 to
24 region (encompassing the putative UP region and
the two
CRP binding sites) by the RNAP-CRP complex. However, in
the presence of
KdgR, the
24 to
5 region encompassing the
10
promoter sequence of
the EC16
pelE and 3937
pelD genes is no longer
protected (Fig.
3). Thus, KdgR function could prevent positioning
of
the RNAP on the
10 sequence rather than inhibit binding of
transcription complex initiation. This particular role of KdgR
would
allow for a rapid transcription initiation when derepression
occurs
since the CRP-RNAP complex already correctly contacts the
promoter. In
the promoter regions of other
pel genes of strain
3937, the
region protected by KdgR encompasses the whole RNAP
binding sites,
i.e., the
10 and
35 boxes (
20). In these cases,
the
function of KdgR seems to be a classical prevention of RNAP
binding.
This hypothesis is supported by previously reported results
(
16,
17) which showed that among the
E. chrysanthemi 3937
pel genes,
pelD is the gene first expressed
during plant infection.
This particular effect of KdgR on the
pelD promoter could contribute
to the observed dominance of
the PelD isoenzyme in
E. chrysanthemi pathogenicity (
3,
4).
Results of band shift experiments suggest that PecS and the RNAP can
bind simultaneously to the promoter-operator region of
the EC16
pelE and 3937
pelD genes, respectively (data not
shown).
DNase I footprinting assays have revealed that the presence of
PecS results in a partial inhibition of CRP-RNAP complex binding
to the
two CRP binding sites and the RNAP
10/
35 promoter sequences
(data
not shown). This inhibition could in fact result from the
inhibition by
PecS of CRP binding, mentioned above. The PecS protein
could then act
as a moderator of 3937
pelD and EC16
pelE
transcription
rather than as a strong repressor like KdgR. This
hypothesis is
supported by the slight effect of a
pecS
mutation on 3937
pelD expression (3-fold increase) observed
in vivo in comparison with
that obtained in a
kdgR mutant
(50-fold increase) (Table
2).
In accordance with its major role in
E. chrysanthemi
pathogenicity, the
pelD-pelE gene was shown to be the most
tightly regulated
by environmental conditions (
14) and the
most highly and quickly
expressed during plant infection (
16,
17). However, the first
in vitro data obtained with KdgR and CRP
(
20) could not be integrated
in a coherent model explaining
the high-level regulation of
pelD.
The results of this study
with respect to the involvement of KdgR,
CRP, PecS, and the RNAP reveal
multicomponent control of
pelD-pelE transcription. Into this
complex model should be further integrated
the Pir activator
(
21), possibly the PecT repressor (
9),
and
putative additional
regulators.
| |
ACKNOWLEDGMENTS |
This work was supported by grants from the CNRS, the DRED, and
the Actions Concertées Coordonnées-Sciences du Vivant 6 from the Ministère de l'Education Nationale, de l'Enseignement
Supérieur, de la Recherche et de la Formation Professionnelle,
and the Japan Society for Promotion of Sciences.
We are indebted to N. Hugouvieux-Cotte-Pattat, G. Condemine, and A. Buchet for their critical opinions and V. James for reading the
manuscript. We thank Y. Rhabé for photograph printing. We also
thank J. Robert-Baudouy for her interest and support during this work.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire de
Génétique Moléculaire des Microorganismes et des
Interactions Cellulaires, CNRS-UMR 5577, INSA Bât. 406, 20 Ave.
Albert Einstein, 69621 Villeurbanne Cedex, France. Phone: (33) 4 72 43 80 88. Fax: (33) 4 72 43 87 14. E-mail:
nasser{at}insa.insa-lyon.fr.
| |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1987.
Current protocols in molecular biology.
Wiley-Interscience, New York, N.Y.
|
| 2.
|
Bachmann, B. S.
1990.
Linkage map of Escherichia coli K-12, edition 8.
Microbiol. Rev.
54:130-197[Abstract/Free Full Text].
|
| 3.
|
Beaulieu, C.,
M. Boccara, and F. Van Gijsegem.
1993.
Pathogenic behavior of pectinase-defective Erwinia chrysanthemi mutants on different plants.
Mol. Plant-Microbe Interact.
6:197-202.
|
| 4.
|
Boccara, M.,
A. Diolez,
M. Rouve, and A. Kotoujansky.
1988.
The role of individual pectate lyases of Erwinia chrysanthemi strain 3937 in pathogenicity on Saintpaulia plants.
Physiol. Mol. Plant Pathol.
33:95-104.
|
| 5.
|
Bradford, M.
1976.
A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[Medline].
|
| 6.
|
Brunelle, A., and R. M. Schleif.
1987.
Missing contact probing of DNA-protein interactions.
Proc. Natl. Acad. Sci. USA
84:6673-6676[Abstract/Free Full Text].
|
| 7.
|
Busby, S., and R. H. Ebright.
1997.
Transcription activation at class II CAP-dependent promoters.
Mol. Microbiol.
23:853-859[Medline].
|
| 8.
|
Carey, J.
1988.
Gel retardation at low pH resolves trp repressor-DNA complexes for quantitative study.
Proc. Natl. Acad. Sci. USA
85:975-979[Abstract/Free Full Text].
|
| 9.
|
Castillo, A.,
W. Nasser,
G. Condemine, and S. Reverchon.
1998.
The PecT repressor interacts with regulatory regions of pectate lyase genes in Erwinia chrysanthemi.
Biochim. Biophys. Acta
1442:148-160[Medline].
|
| 10.
|
Collado-Vides, J.,
B. Magasanik, and J. D. Gralla.
1991.
Control site location and transcriptional regulation in Escherichia coli.
Microbiol. Rev.
55:371-394[Abstract/Free Full Text].
|
| 11.
|
Collmer, A., and N. T. Keen.
1986.
The role of pectic enzymes in plant pathogenesis.
Annu. Rev. Phytopathol.
24:383-409.
|
| 12.
|
Gold, S.,
S. Nishio,
S. Tsuyumu, and N. T. Keen.
1992.
Analysis of the pelE promoter in Erwinia chrysanthemi EC16.
Mol. Plant-Microbe Interact.
5:170-178[Medline].
|
| 13.
|
Hugouvieux-Cotte-Pattat, N.,
G. Condemine,
W. Nasser, and S. Reverchon.
1996.
Regulation of pectinolysis in Erwinia chrysanthemi.
Annu. Rev. Microbiol.
50:213-257[Medline].
|
| 14.
|
Hugouvieux-Cotte-Pattat, N.,
H. Dominguez, and J. Robert-Baudouy.
1992.
Environmental conditions affect the transcription of the pectinase genes of Erwinia chrysanthemi 3937.
J. Bacteriol.
174:7807-7818[Abstract/Free Full Text].
|
| 15.
|
Kolb, A.,
S. Busby,
H. Buc,
S. Garges, and S. Adhya.
1993.
Transcriptional regulation by cAMP and its receptor protein.
Annu. Rev. Biochem.
62:749-795[Medline].
|
| 16.
|
Lojkowska, E.,
C. Dorel,
P. Reignault,
N. Hugouvieux-Cotte-Pattat, and J. Robert-Baudouy.
1993.
Use of GUS fusions to study the expression of Erwinia chrysanthemi pectinase genes during infection of potato tubers.
Mol. Plant-Microbe Interact.
6:488-494.
|
| 17.
|
Masclaux, C.,
N. Hugouvieux-Cotte-Pattat, and D. Expert.
1996.
Iron is a triggering factor for differential expression of Erwinia chrysanthemi strain 3937 pectate lyases in pathogenesis of African violets.
Mol. Plant-Microbe Interact.
9:198-205.
|
| 18.
|
Miller, J. H.
1972.
Experiment in molecular genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 19.
|
Nasser, W.,
S. Reverchon,
G. Condemine, and J. Robert-Baudouy.
1994.
Specific interactions of Erwinia chrysanthemi KdgR repressor with different operators of genes involved in pectinolysis.
J. Mol. Biol.
236:427-440[Medline].
|
| 20.
|
Nasser, W.,
J. Robert-Baudouy, and S. Reverchon.
1997.
Antagonistic effect of CRP and KdgR in the transcription control of the Erwinia chrysanthemi pectinolysis genes.
Mol. Microbiol.
26:1071-1082[Medline].
|
| 21.
|
Nomura, K.,
W. Nasser,
H. Kawagishi, and S. Tsuyumu.
1998.
The pir gene of Erwinia chrysanthemi EC16 regulates hyperinduction of pectate lyase virulence genes in response to plant signals.
Proc. Natl. Acad. Sci. USA
95:14034-14039[Abstract/Free Full Text].
|
| 22.
|
Praillet, T.,
W. Nasser,
J. Robert-Baudouy, and S. Reverchon.
1996.
Purification and functional characterization of PecS: a regulator of virulence factor synthesis in Erwinia chrysanthemi.
Mol. Microbiol.
20:391-402[Medline].
|
| 23.
|
Reverchon, S.,
D. Expert,
J. Robert-Baudouy, and W. Nasser.
1997.
The cyclic AMP receptor protein is the main activator of the pectinolysis genes in Erwinia chrysanthemi.
J. Bacteriol.
179:3500-3508[Abstract/Free Full Text].
|
| 24.
|
Reverchon, S.,
W. Nasser, and J. Robert-Baudouy.
1991.
Characterization of kdgR, a gene of Erwinia chrysanthemi that regulates pectin degradation.
Mol. Microbiol.
5:2203-2216[Medline].
|
| 25.
|
Reverchon, S.,
W. Nasser, and J. Robert-Baudouy.
1994.
pecS: a locus controlling pectinase, cellulase and blue pigment production in Erwinia chrysanthemi.
Mol. Microbiol.
11:1127-1139[Medline].
|
| 26.
|
Ross, W.,
S. E. Aiyar,
J. Salomon, and R. L. Gourse.
1998.
Escherichia coli promoters with UP elements of different strengths: modular structure of bacterial promoters.
J. Bacteriol.
180:5375-5383[Abstract/Free Full Text].
|
| 27.
|
Sakakibara, H.,
M. Watanabe,
T. Hase, and T. Sugiyama.
1991.
Molecular cloning and characterization of complementary DNA encoding for ferrodoxin-dependent glutamate synthetase in maize leaf.
J. Biol. Chem.
226:2028-2035.
|
| 28.
|
Surgey, N.,
J. Robert-Baudouy, and G. Condemine.
1996.
The Erwinia chrysanthemi pecT gene regulates pectinase gene expression.
J. Bacteriol.
178:1593-1599[Abstract/Free Full Text].
|
| 29.
|
Tamaki, S. J.,
S. Gold,
M. Robeson,
S. Manulis, and N. T. Keen.
1988.
Structure and organization of the pel genes from Erwinia chrysanthemi EC16.
J. Bacteriol.
170:3468-3478[Abstract/Free Full Text].
|
| 29a.
| Thomson, N., et al. Unpublished results.
|
| 30.
|
Tsuyumu, S.,
M. Miura, and S. Nishio.
1991.
Distinct induction of pectinases as a factor determining host specificity of soft-rotting Erwinia, p. 31-43.
In
S. Patil, S. Ouchi, D. Mills, and C. Vance (ed.), Molecular strategies of pathogens and host plants. Springer-Verlag, New York, N.Y.
|
| 31.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[Medline].
|
Journal of Bacteriology, October 1999, p. 5948-5957, Vol. 181, No. 19
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Brencic, A., Winans, S. C.
(2005). Detection of and Response to Signals Involved in Host-Microbe Interactions by Plant-Associated Bacteria. Microbiol. Mol. Biol. Rev.
69: 155-194
[Abstract]
[Full Text]
-
Wilkinson, S. P., Grove, A.
(2004). HucR, a Novel Uric Acid-responsive Member of the MarR Family of Transcriptional Regulators from Deinococcus radiodurans. J. Biol. Chem.
279: 51442-51450
[Abstract]
[Full Text]
-
Rouanet, C., Reverchon, S., Rodionov, D. A., Nasser, W.
(2004). Definition of a Consensus DNA-binding Site for PecS, a Global Regulator of Virulence Gene Expression in Erwinia chrysanthemi and Identification of New Members of the PecS Regulon. J. Biol. Chem.
279: 30158-30167
[Abstract]
[Full Text]
-
Hugouvieux-Cotte-Pattat, N., Shevchik, V. E., Nasser, W.
(2002). PehN, a Polygalacturonase Homologue with a Low Hydrolase Activity, Is Coregulated with the Other Erwinia chrysanthemi Polygalacturonases. J. Bacteriol.
184: 2664-2673
[Abstract]
[Full Text]
-
Providenti, M. A., Wyndham, R. C.
(2001). Identification and Functional Characterization of CbaR, a MarR-Like Modulator of the cbaABC-Encoded Chlorobenzoate Catabolism Pathway. Appl. Environ. Microbiol.
67: 3530-3541
[Abstract]
[Full Text]
Top
Abstract
Introduction
