INTRODUCTION

Top Abstract Introduction Materials and Methods Results and Discussion References

Salmonella typhimurium is a facultative anaerobe. In the absence of oxygen, it can grow by anaerobic respiration with an electron acceptor other than oxygen (e.g., nitrate, trimethylamine oxide, dimethyl sulfoxide, or fumarate) or by fermentation (45). Previous studies in this laboratory identified an anaerobically induced aminotripeptidase, peptidase T (43). The pepT gene is transcribed approximately 20-fold more efficiently under anaerobic conditions than when grown in air. This elevated transcription requires Fnr, a positive regulator of many genes encoding anaerobic respiratory functions. Fnr senses the oxygen level inside the cell (22, 24), and it is required for the induction of many genes whose products function in anaerobic respiratory pathways. It also plays a role in repressing some aerobic genes under anaerobic conditions (41). The consensus Fnr binding site sequence is TTGATNNNNATCAA. This sequence is usually but not always located at position 41 relative to the start of transcription.

In an attempt to understand the physiological significance of the anaerobic induction of pepT, Strauch et al. (42) isolated a group of anaerobically induced, fnr-dependent lac fusions. These fusions were identified by screening populations containing random Mud-lac insertions for "fisheye" colonies (red center, white periphery) and testing these colonies for the effect of an fnr mutation on the fisheye phenotype. The genes defined by these insertions were called oxd (for oxygen dependent) (42), and these oxd mutations were grouped into 10 loci based on map position (23). Among these loci, only pepT has been extensively studied (25).

The purpose of the work described in this paper was to identify each of the oxd genes in the hope that the identities of some of these genes might help us to understand why pepT is a member of the Fnr family of anaerobically induced genes. To do this, we have replaced a representative oxd::MudJ element (11.3 kb) from each map position class with the much smaller Mud-cam element (2.9 kb) (12) to facilitate cloning. A genomic DNA library from each oxd::Mud-cam strain has been constructed, and several Cam^r clones from each library have been partially sequenced with primers reading out from the ends of Mud-cam and/or with two pBR322 primers reading from the plasmid into the genomic DNA insert. The sequences obtained have been analyzed by comparing them with known sequences in the GenBank database.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results and Discussion References

Bacterial strains and growth conditions. The bacterial strains used in this work are derivatives of S. typhimurium LT2 or Escherichia coli K-12 (Table 1). E minimal medium (46), NCE minimal medium (28), and NN medium (lacking a utilizable nitrogen source) (17) were supplemented with 0.4% glucose or other carbon sources as indicated. Nutrient broth (Difco) plus 0.5% NaCl or L broth (LB) (Gibco BRL) was used as rich medium as indicated. MacConkey agar base (Difco) was supplemented with 0.1% lactose (Difco). Antibiotics were used at the following concentrations (micrograms per milliliter): ampicillin, 50; chloramphenicol, 20; and kanamycin, 50. All incubations were at 37°C.

Transduction. Generalized transduction was carried out by using bacteriophage P22 HT 12/4 int-3 (38).

Replacement of MudJ with Mud-cam. In order to facilitate cloning, the 11.9-kb MudJ in the oxd::MudJ fusion strains was replaced by the 2.9-kb Mud-cam (12). First, each oxd::MudJ fusion (in strains TN2261, TN2405, TN2406, TN2407, TN2408, TN2409, TN2410, TN2411, and TN2602) was transduced into TN5547, which carries the put-521 mutation, a nontransducible deletion of the put operon (32). The resultant strains (TN4483, TN4490, TN4481, TN4484, TN4485, TN4486, TN4487, TN4488, and TN4489) were then transduced with a phage lysate made on TE2730 (putA1309::Mud-cam), and Cam^r transductants were selected on LB-chloramphenicol plates. The Mud-cam element cannot be inherited by recombination at the put locus because of the put-521 mutation in the recipient. The number of transductants obtained was very low, probably because of the very short stretch of homologous sequence at the attR ends of the two elements. The Cam^r transductants were screened on MacConkey agar-lactose plates with or without kanamycin, and the lac Kan^s colonies that resulted from the expected Mud exchange were saved. Finally, each oxd::Mud-cam strain (TN4492, TN4507, TN4502, TN4510, TN4503, TN4504, TN4505, TN4509, and TN4506) was used as a donor in a transduction cross with the original oxd::MudJ fusion as the recipient, selecting Cam^r on MacConkey-lactose medium with chloramphenicol. In each of the crosses, 100% of the transductants were white, indicating that Mud-cam had replaced the MudJ element.

Construction of genomic DNA libraries and cloning of the oxd genes. A genomic DNA library was constructed for each oxd::Mud-cam strain (TN4719, TN4712, TN4713, TN4714, TN4715, TN4716, TN4717, and TN4718). The genomic DNA was isolated by the method of Maurer et al. (26) and was partially digested with Sau3AI (Gibco BRL). Fragments of 9.4 to 23 kb were isolated from agarose, purified by using a GeneClean II kit (Bio 101), and ligated with T4 DNA ligase (Gibco BRL) into the BamHI site of pBR322. The ligation reaction products were transformed into E. coli DH5, and Cam^r transformants were selected. Six or more clones from each oxd fusion were randomly picked and screened for the 1.35-kb BamHI fragment of Mud-cam by BamHI digestion. Several large clones from each oxd library were saved for further study.

DNA sequencing and sequence analysis. Three Cam^r clones of each oxd gene were sequenced by using the attR primer (5' TTATCGTGAAACGCTTTCGCG 3'), which anneals to the MuR end of Mud-cam and reads into the flanking promoter-proximal regions of the oxd fragments. DNA sequencing was carried out with Sequenase version 2.0 (U.S. Biochemicals). The sequences obtained were compared with the GenBank database by using the Blastn or Blastx program (4).

Cloning of the wild-type oxd-6 operon. A lysate of TN3618/pCM316 (oxd-6::Mud-cam) was used to transduce TN3618, selecting Amp^r. The Amp^r transductants were replica plated to LB-chloramphenicol plates to identify colonies that were Amp^r Cam^s. About 0.05% of the transductants had this phenotype and contained plasmids carrying the wild-type oxd-6 locus which had been generated by recombination in the donor between the wild-type oxd-6 locus in the chromosome and the oxd-6::Mud-cam carried by the plasmid. Plasmid pCM341 was obtained in this way.

Disk assay for sensitivity to nickel. Nickel sensitivity was tested by using filter paper disks saturated with NiCl₂ (30). One hundred microliters of an overnight culture was mixed with 3 ml of 50°C molten soft agar and layered onto a minimal glucose agar plate for each assay. After solidification, filter paper disks containing NiCl₂ (0.05 or 0.5 µmol) were placed on the surface of the plate. MgCl₂ (0.16 mmol) was added with NiCl₂ to saturate the Mg²⁺ uptake systems which have low affinity to Ni²⁺. The plates were incubated under anaerobic conditions overnight, and the diameters of the inhibition zones around the disks were measured.

Peptide uptake test. One hundred microliters of an overnight culture was mixed with 3 ml of 50°C molten N soft agar and layered on an N medium-glucose agar plate. On each plate, crystals of four tested peptides were placed at the four corners. The plates were incubated under anaerobic conditions in GasPak jars. The diameters of the growth zones around the peptides were compared.

	RESULTS AND DISCUSSION

Top Abstract Introduction Materials and Methods Results and Discussion References

Properties of the oxd-lac fusions. The effects of anaerobiosis and of fnr mutations on -galactosidase levels in representatives of each class of oxd::MudJ fusion are summarized in Table 2. The oxd genes are all significantly induced by anaerobiosis (4- to 35-fold), and this anaerobic induction is reduced at least twofold in an fnr mutant strain.

View this table: [in this window] [in a new window]   TABLE 2.   -Galactosidase levelsa

oxd-4 and oxd-11. A sequence of 200 nucleotides was obtained from pCM296 (oxd-4) by using the attR primer. This sequence was found to be identical to a region (positions 2467 to 2667) of the S. typhimurium cbiA gene, the first gene in the 14-kb cob (vitamin B₁₂ biosynthesis) operon (GenBank accession no. L12006). A 157-nucleotide sequence was obtained from pCM327 (oxd-11) by using the attR primer and was found to correspond to a region of the cbiK gene (positions 10231 to 10388), the 10th gene of the cob operon (35).

oxd-5. Three regions of pCM311 have been sequenced. The 191-bp sequence from the attR primer (accession no. AF130861) could be aligned with hybB of the E. coli TG1 hyb operon (accession no. U09177 [27]) between bp 1759 and 1946. The 389-bp sequence (accession no. AF131226) combined with the overlapping sequences from the attL and BamHIcw primers could be aligned with the same E. coli target sequence between bp 2086 and 2422. The identity between the query and the target sequences is approximately 80%. (E. coli and S. typhimurium protein-coding regions show an average sequence identity of 84% [39].) oxd-5 is located at 64 min on the Salmonella chromosome (23), and hybB is located at 65 min on the E. coli chromosome. Thus, S. typhimurium oxd-5 corresponds to E. coli hybB, one of the genes in an operon required for the synthesis of the membrane-bound hydrogenase II. The operon contains seven genes, hybABCDEFG, and is required for growth on H₂-fumarate (27). The operon is induced by growth on glycerol-fumarate anaerobically (37). It has been reported that fnr affects the level of hydrogenase II activity indirectly by transcriptionally regulating a locus required for Ni²⁺ transport (49). It has also been suggested that Fnr might directly regulate transcription of hybABCDEFG (36). Our results indicate a relatively small (fourfold) effect of loss of fnr, and there is no clear-cut Fnr binding site in the region immediately upstream from the E. coli hybABCDEFG coding sequence. It seems likely, therefore, that the fnr effect is indirect.

oxd-7. The 110-bp sequence (accession no. U84267) obtained from pCM319 is 85% identical to bp 671 to 775 of E. coli dcuB (accession no. X79886), which encodes an anaerobic dicarboxylate (fumarate) uptake protein (40). Expression of Dcu activity in E. coli requires anaerobiosis and is inhibited by nitrate; these effects are mediated by the Fnr and NarL proteins, respectively (13). dcuB is located immediately upstream of fumB, an Fnr-dependent gene encoding a class I fumarase (or fumarate hydratase) (6). The promoter region of E. coli dcuB contains two putative Fnr-sites, one at position 31.5 (GTGACtgtgATCTA) and the other at position 48.5 (TTCATacaaAACAG) (40).

oxd-8. The 77-bp sequence (accession no. AF130862) from the insert of the oxd-8 clone, pCM326, is 84% identical to nucleotides 1115 to 1190 of the E. coli moaB gene (accession no. X70420 [33]). moaB is part of an operon required for the synthesis of the molybdenum cofactor required for many reductases that function in anaerobic respiratory pathways. Mutants with mutations in the biosynthetic pathway for molybdenum cofactor are pleiotropically defective in molybdoenzyme activities and as a result cannot reduce chlorate to the toxic compound chlorite and are chlorate resistant. The previous finding that the oxd-8 mutant is chlorate resistant (42) is consistent with the fact that the gene is involved in molybdenum cofactor biosynthesis. The E. coli moa genes have been reported to be subject to more-than-20-fold anaerobic induction (5). In the upstream region of the E. coli moa operon, there is a putative 10 site (CATAAC) and a possible Fnr binding site (TGGATggtaAAAAA) at position 41.5. Our results, however, indicate a relatively weak anaerobic induction (fourfold) (Table 2) and a relatively small fnr effect (twofold).

oxd-12. The 184-bp attR-primed sequence (GenBank accession no. U84266) obtained from pCM329 was 85% identical to bp 3036 to 3220 of E. coli dmsA (accession no. J03412 [7]), the first gene in the well-characterized fnr-dependent dms operon. This operon encodes a dimethyl sulfoxide reductase, a membrane-bound molybdoenzyme which functions as a terminal reductase during anaerobic growth with various sulfoxide and N-oxide compounds as electron acceptors (47). Anaerobic induction of E. coli dmsA-lacZ was defective in an fnr mutant (11). There is a putative 10 site (AATACT) and a possible Fnr binding site (TTGATaccgCTCAA) at position 42.5, in the regulatory region of the E. coli dms operon.

oxd-14. The oxd-14::Mud-cam clone pCM293 has a 1.4-kb attR-side insert as determined by PCR with primers BamHIcw and attR. It has an approximately 0.7-kb attL-side insert as determined by PCR with primers BamHIccw and attL. Three regions of sequence have been obtained: 234 bp (BamHIcw) (accession no. AF132133), 320 bp (attR) (accession no. AF132131), and 278 bp (attL) (accession no. AF132132). These sequences could be aligned with blocks of sequence from the centisome 49 region of E. coli K-12 (accession no. U00008) as follows: BamHIcw-primed sequence with bp 26623 to 26858, attR-primed sequence with bp 25733 to 25914, and attL-primed sequence with bp 25434 to 25715 of this sequence. An enterobacterial repetitive intergenic consensus sequence was found in the attR-primed sequence between the two nucleotides corresponding to nucleotides 25791 and 25792 of the U00008 sequence where yejZ overlaps with yejY in E. coli. Enterobacterial repetitive intergenic consensus sequences are highly conserved, approximately 126-bp repetitive sequences. They appear to be restricted to transcribed regions of the genome, either in intergenic regions of polycistronic operons or in untranslated regions upstream or downstream of open reading frames (19). yejY is the E. coli homolog of oxd-14. It presumably encodes a c-type cytochrome, based on sequence similarity (10). According to Iobbi-Nivol et al. (20), yojC-yejYX appear to be napABC, encoding a periplasmic nitrate reductase. The genes also appear to correspond to the aeg-46.5 locus, which was identified as an anaerobically expressed lac fusion which requires nitrate for full expression (9, 10). The napABC operon has been reported to be regulated by both Fnr and the NarLP system (15). An Fnr binding site (TTGATcctgCTCAG) has been identified in the promoter of this operon (10).

oxd-2. A 2,543-nucleotide continuous sequence (accession no. U89718) from both strands has been obtained by using oxd-2 clones pCM309 and pCM310. oxd-2 encodes a 402-amino-acid protein. It has strong similarity to E. coli orfX, an open reading frame downstream from the tdc operon. orfX encodes an acetate kinase-like enzyme. The open reading frame yhaS, immediately downstream from oxd-2, is similar to the E. coli pyruvate formate lyase gene (pfl). A 310-bp sequence obtained from pCM309 by use of primer BamHIcw could be aligned with E. coli rnpB (encoding the M1 RNA component of RNase P; accession no. AE000394), which is the third gene upstream to the tdc operon. A 262-bp sequence obtained from pCM310 by use of primer BamHIccw could be aligned with bp 10046 to 10309 of E. coli yhaP (accession no. AE00392; similar to the serine deaminase gene, sdaA), which is the fourth gene downstream from oxd-2. oxd-2 is unusual because it is induced only in amino acid-rich medium. Further characterization of this locus will be reported elsewhere.

oxd-6. Analysis of a partial sequence of oxd-6 suggested that it encodes a previously uncharacterized substrate-binding protein related to those of ABC transporters. The sequence of the entire oxd-6 gene and the surrounding region containing four other open reading frames that appear to comprise an operon encoding a transport system was determined (accession no. U94729). oxd-6 is the second gene in this putative five-gene operon. There is a possible Fnr-dependent sigma-70 promoter for this operon, with a 10 site (CATAAT) at nucleotides 515 to 520 and a possible Fnr site (CTCTTctgcGTCAA) at nucleotides 479 to 492.

Identification of oxygen-regulated genes. Several other groups have used lac fusion techniques to identify anaerobically regulated genes (3, 9, 42, 48). With the exception of oxd-14, which belongs to the aeg-46.5 locus identified by the Reznikoff group (9), all of the oxd genes identified in this work appear to be different from those isolated by the other groups. The oxd insertions were isolated by screening pools of random lac fusions on MacConkey agar for fisheye colonies, i.e., colonies with dark red centers and white peripheries. This colony appearance presumably reflects the anaerobic induction of lac expression in the center of the colony. Clearly, this screen is an effective one for isolating anaerobically induced genes. In a secondary screen, the strains isolated as fisheyes were tested for the effect of an fnr mutation on the colony appearance, and only those strains which showed loss of the fisheye phenotype upon introduction of the fnr mutation were saved. Although this secondary screen yields fusions whose expression is affected by fnr, in several cases the effects are indirect and not all of the oxd genes are directly regulated by fnr.