JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wei, Y.
Right arrow Articles by Miller, C. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wei, Y.
Right arrow Articles by Miller, C. G.

 Previous Article  |  Next Article 

Journal of Bacteriology, October 1999, p. 6092-6097, Vol. 181, No. 19
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Characterization of a Group of Anaerobically Induced, fnr-Dependent Genes of Salmonella typhimurium

Yan Weidagger and Charles G. Miller*

Department of Microbiology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801

Received 31 March 1999/Accepted 21 July 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

We have previously reported the isolation of a group of anaerobically regulated, fnr-dependent lac fusions in Salmonella typhimurium and have grouped these oxd genes into classes based on map position. In order to identify these genes, we have replaced the original Mud-lac fusion in a member of each oxd class with the much smaller Mud-cam element, cloned the fusion, and determined DNA sequence sufficient to define the oxd gene. Several of the fusions correspond to previously known genes from S. typhimurium or Escherichia coli: oxd-4 = cbiA and oxd-11 = cbiK, oxd-5 = hybB, oxd-7 = dcuB, oxd-8 = moaB, oxd-12 = dmsA, and oxd-14 = napB (aeg-46.5). Two other fusions correspond to previously unknown loci: oxd-2 encodes an acetate/propionate kinase, and oxd-6 encodes a putative ABC transporter present in S. typhimurium but not in E. coli.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Salmonella typhimurium is a facultative anaerobe. In the absence of oxygen, it can grow by anaerobic respiration with an electron acceptor other than oxygen (e.g., nitrate, trimethylamine oxide, dimethyl sulfoxide, or fumarate) or by fermentation (45). Previous studies in this laboratory identified an anaerobically induced aminotripeptidase, peptidase T (43). The pepT gene is transcribed approximately 20-fold more efficiently under anaerobic conditions than when grown in air. This elevated transcription requires Fnr, a positive regulator of many genes encoding anaerobic respiratory functions. Fnr senses the oxygen level inside the cell (22, 24), and it is required for the induction of many genes whose products function in anaerobic respiratory pathways. It also plays a role in repressing some aerobic genes under anaerobic conditions (41). The consensus Fnr binding site sequence is TTGATNNNNATCAA. This sequence is usually but not always located at position -41 relative to the start of transcription.

In an attempt to understand the physiological significance of the anaerobic induction of pepT, Strauch et al. (42) isolated a group of anaerobically induced, fnr-dependent lac fusions. These fusions were identified by screening populations containing random Mud-lac insertions for "fisheye" colonies (red center, white periphery) and testing these colonies for the effect of an fnr mutation on the fisheye phenotype. The genes defined by these insertions were called oxd (for oxygen dependent) (42), and these oxd mutations were grouped into 10 loci based on map position (23). Among these loci, only pepT has been extensively studied (25).

The purpose of the work described in this paper was to identify each of the oxd genes in the hope that the identities of some of these genes might help us to understand why pepT is a member of the Fnr family of anaerobically induced genes. To do this, we have replaced a representative oxd::MudJ element (11.3 kb) from each map position class with the much smaller Mud-cam element (2.9 kb) (12) to facilitate cloning. A genomic DNA library from each oxd::Mud-cam strain has been constructed, and several Camr clones from each library have been partially sequenced with primers reading out from the ends of Mud-cam and/or with two pBR322 primers reading from the plasmid into the genomic DNA insert. The sequences obtained have been analyzed by comparing them with known sequences in the GenBank database.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Bacterial strains and growth conditions. The bacterial strains used in this work are derivatives of S. typhimurium LT2 or Escherichia coli K-12 (Table 1). E minimal medium (46), NCE minimal medium (28), and NN medium (lacking a utilizable nitrogen source) (17) were supplemented with 0.4% glucose or other carbon sources as indicated. Nutrient broth (Difco) plus 0.5% NaCl or L broth (LB) (Gibco BRL) was used as rich medium as indicated. MacConkey agar base (Difco) was supplemented with 0.1% lactose (Difco). Antibiotics were used at the following concentrations (micrograms per milliliter): ampicillin, 50; chloramphenicol, 20; and kanamycin, 50. All incubations were at 37°C.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Strains and plasmids used in this work

Transduction. Generalized transduction was carried out by using bacteriophage P22 HT 12/4 int-3 (38).

Replacement of MudJ with Mud-cam. In order to facilitate cloning, the 11.9-kb MudJ in the oxd::MudJ fusion strains was replaced by the 2.9-kb Mud-cam (12). First, each oxd::MudJ fusion (in strains TN2261, TN2405, TN2406, TN2407, TN2408, TN2409, TN2410, TN2411, and TN2602) was transduced into TN5547, which carries the put-521 mutation, a nontransducible deletion of the put operon (32). The resultant strains (TN4483, TN4490, TN4481, TN4484, TN4485, TN4486, TN4487, TN4488, and TN4489) were then transduced with a phage lysate made on TE2730 (putA1309::Mud-cam), and Camr transductants were selected on LB-chloramphenicol plates. The Mud-cam element cannot be inherited by recombination at the put locus because of the put-521 mutation in the recipient. The number of transductants obtained was very low, probably because of the very short stretch of homologous sequence at the attR ends of the two elements. The Camr transductants were screened on MacConkey agar-lactose plates with or without kanamycin, and the lac Kans colonies that resulted from the expected Mud exchange were saved. Finally, each oxd::Mud-cam strain (TN4492, TN4507, TN4502, TN4510, TN4503, TN4504, TN4505, TN4509, and TN4506) was used as a donor in a transduction cross with the original oxd::MudJ fusion as the recipient, selecting Camr on MacConkey-lactose medium with chloramphenicol. In each of the crosses, 100% of the transductants were white, indicating that Mud-cam had replaced the MudJ element.

Construction of genomic DNA libraries and cloning of the oxd genes. A genomic DNA library was constructed for each oxd::Mud-cam strain (TN4719, TN4712, TN4713, TN4714, TN4715, TN4716, TN4717, and TN4718). The genomic DNA was isolated by the method of Maurer et al. (26) and was partially digested with Sau3AI (Gibco BRL). Fragments of 9.4 to 23 kb were isolated from agarose, purified by using a GeneClean II kit (Bio 101), and ligated with T4 DNA ligase (Gibco BRL) into the BamHI site of pBR322. The ligation reaction products were transformed into E. coli DH5alpha , and Camr transformants were selected. Six or more clones from each oxd fusion were randomly picked and screened for the 1.35-kb BamHI fragment of Mud-cam by BamHI digestion. Several large clones from each oxd library were saved for further study.

DNA sequencing and sequence analysis. Three Camr clones of each oxd gene were sequenced by using the attR primer (5' TTATCGTGAAACGCTTTCGCG 3'), which anneals to the MuR end of Mud-cam and reads into the flanking promoter-proximal regions of the oxd fragments. DNA sequencing was carried out with Sequenase version 2.0 (U.S. Biochemicals). The sequences obtained were compared with the GenBank database by using the Blastn or Blastx program (4).

If it was necessary to obtain more sequence information, several clones with inserts of different sizes were further sequenced with two pBR322 primers, BamHIcw (5' CACTATCGACTACGCGATCA 3') and BamHIccw (5' ATGCGTCCGGCGTAGA 3'), reading into the genomic DNA insert from the plasmid, and the attL primer (5' CCCATCAGATCCCGAATAAT 3'), reading out from the MuL end of Mud-cam and into the adjacent oxd sequence. Walk-out primers for further sequencing were designed by using Oligo 4.0 (National Biosciences).

For oxd-6, genomic DNA on either side of Mud-cam from pCM316 was PCR amplified with Taq DNA polymerase (Gibco BRL). The two fragments were partially digested with Sau3AI and subcloned into the pBR322 BamHI site. Each subclone was sequenced by using the BamHIccw and BamHIcw primers. The Automated Sequencing Group, Genetic Engineering Facility, Biotechnology Center, University of Illinois at Urbana-Champaign carried out some of the sequencing work on oxd-6. The contigs were assembled by using the DNASTAR program.

Cloning of the wild-type oxd-6 operon. A lysate of TN3618/pCM316 (oxd-6::Mud-cam) was used to transduce TN3618, selecting Ampr. The Ampr transductants were replica plated to LB-chloramphenicol plates to identify colonies that were Ampr Cams. About 0.05% of the transductants had this phenotype and contained plasmids carrying the wild-type oxd-6 locus which had been generated by recombination in the donor between the wild-type oxd-6 locus in the chromosome and the oxd-6::Mud-cam carried by the plasmid. Plasmid pCM341 was obtained in this way.

Disk assay for sensitivity to nickel. Nickel sensitivity was tested by using filter paper disks saturated with NiCl2 (30). One hundred microliters of an overnight culture was mixed with 3 ml of 50°C molten soft agar and layered onto a minimal glucose agar plate for each assay. After solidification, filter paper disks containing NiCl2 (0.05 or 0.5 µmol) were placed on the surface of the plate. MgCl2 (0.16 mmol) was added with NiCl2 to saturate the Mg2+ uptake systems which have low affinity to Ni2+. The plates were incubated under anaerobic conditions overnight, and the diameters of the inhibition zones around the disks were measured.

Peptide uptake test. One hundred microliters of an overnight culture was mixed with 3 ml of 50°C molten N soft agar and layered on an N medium-glucose agar plate. On each plate, crystals of four tested peptides were placed at the four corners. The plates were incubated under anaerobic conditions in GasPak jars. The diameters of the growth zones around the peptides were compared.


    RESULTS AND DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Properties of the oxd-lac fusions. The effects of anaerobiosis and of fnr mutations on beta -galactosidase levels in representatives of each class of oxd::MudJ fusion are summarized in Table 2. The oxd genes are all significantly induced by anaerobiosis (4- to 35-fold), and this anaerobic induction is reduced at least twofold in an fnr mutant strain.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   beta -Galactosidase levelsa

oxd-4 and oxd-11. A sequence of 200 nucleotides was obtained from pCM296 (oxd-4) by using the attR primer. This sequence was found to be identical to a region (positions 2467 to 2667) of the S. typhimurium cbiA gene, the first gene in the 14-kb cob (vitamin B12 biosynthesis) operon (GenBank accession no. L12006). A 157-nucleotide sequence was obtained from pCM327 (oxd-11) by using the attR primer and was found to correspond to a region of the cbiK gene (positions 10231 to 10388), the 10th gene of the cob operon (35).

S. typhimurium can synthesize cobalamin de novo only under anaerobic conditions. However, mutants with mutations in this operon grow well under either anaerobic respiratory or fermentation conditions (21). Regulation of the cob operon is complex. It has five promoters and is activated by global regulators, including Crp, ArcA, and integration host factor, and by a specific activator, PocR. There is a putative Fnr site in the P1 promoter region (8), and it has been suggested that the P1 promoter might be regulated by either Crp or Fnr (34). Our results indicate a significant fnr effect (fourfold) (Table 2) on cbi expression under the growth conditions that we have used.

oxd-5. Three regions of pCM311 have been sequenced. The 191-bp sequence from the attR primer (accession no. AF130861) could be aligned with hybB of the E. coli TG1 hyb operon (accession no. U09177 [27]) between bp 1759 and 1946. The 389-bp sequence (accession no. AF131226) combined with the overlapping sequences from the attL and BamHIcw primers could be aligned with the same E. coli target sequence between bp 2086 and 2422. The identity between the query and the target sequences is approximately 80%. (E. coli and S. typhimurium protein-coding regions show an average sequence identity of 84% [39].) oxd-5 is located at 64 min on the Salmonella chromosome (23), and hybB is located at 65 min on the E. coli chromosome. Thus, S. typhimurium oxd-5 corresponds to E. coli hybB, one of the genes in an operon required for the synthesis of the membrane-bound hydrogenase II. The operon contains seven genes, hybABCDEFG, and is required for growth on H2-fumarate (27). The operon is induced by growth on glycerol-fumarate anaerobically (37). It has been reported that fnr affects the level of hydrogenase II activity indirectly by transcriptionally regulating a locus required for Ni2+ transport (49). It has also been suggested that Fnr might directly regulate transcription of hybABCDEFG (36). Our results indicate a relatively small (fourfold) effect of loss of fnr, and there is no clear-cut Fnr binding site in the region immediately upstream from the E. coli hybABCDEFG coding sequence. It seems likely, therefore, that the fnr effect is indirect.

oxd-7. The 110-bp sequence (accession no. U84267) obtained from pCM319 is 85% identical to bp 671 to 775 of E. coli dcuB (accession no. X79886), which encodes an anaerobic dicarboxylate (fumarate) uptake protein (40). Expression of Dcu activity in E. coli requires anaerobiosis and is inhibited by nitrate; these effects are mediated by the Fnr and NarL proteins, respectively (13). dcuB is located immediately upstream of fumB, an Fnr-dependent gene encoding a class I fumarase (or fumarate hydratase) (6). The promoter region of E. coli dcuB contains two putative Fnr-sites, one at position -31.5 (GTGACtgtgATCTA) and the other at position -48.5 (TTCATacaaAACAG) (40).

oxd-8. The 77-bp sequence (accession no. AF130862) from the insert of the oxd-8 clone, pCM326, is 84% identical to nucleotides 1115 to 1190 of the E. coli moaB gene (accession no. X70420 [33]). moaB is part of an operon required for the synthesis of the molybdenum cofactor required for many reductases that function in anaerobic respiratory pathways. Mutants with mutations in the biosynthetic pathway for molybdenum cofactor are pleiotropically defective in molybdoenzyme activities and as a result cannot reduce chlorate to the toxic compound chlorite and are chlorate resistant. The previous finding that the oxd-8 mutant is chlorate resistant (42) is consistent with the fact that the gene is involved in molybdenum cofactor biosynthesis. The E. coli moa genes have been reported to be subject to more-than-20-fold anaerobic induction (5). In the upstream region of the E. coli moa operon, there is a putative -10 site (CATAAC) and a possible Fnr binding site (TGGATggtaAAAAA) at position -41.5. Our results, however, indicate a relatively weak anaerobic induction (fourfold) (Table 2) and a relatively small fnr effect (twofold).

oxd-12. The 184-bp attR-primed sequence (GenBank accession no. U84266) obtained from pCM329 was 85% identical to bp 3036 to 3220 of E. coli dmsA (accession no. J03412 [7]), the first gene in the well-characterized fnr-dependent dms operon. This operon encodes a dimethyl sulfoxide reductase, a membrane-bound molybdoenzyme which functions as a terminal reductase during anaerobic growth with various sulfoxide and N-oxide compounds as electron acceptors (47). Anaerobic induction of E. coli dmsA-lacZ was defective in an fnr mutant (11). There is a putative -10 site (AATACT) and a possible Fnr binding site (TTGATaccgCTCAA) at position -42.5, in the regulatory region of the E. coli dms operon.

oxd-14. The oxd-14::Mud-cam clone pCM293 has a 1.4-kb attR-side insert as determined by PCR with primers BamHIcw and attR. It has an approximately 0.7-kb attL-side insert as determined by PCR with primers BamHIccw and attL. Three regions of sequence have been obtained: 234 bp (BamHIcw) (accession no. AF132133), 320 bp (attR) (accession no. AF132131), and 278 bp (attL) (accession no. AF132132). These sequences could be aligned with blocks of sequence from the centisome 49 region of E. coli K-12 (accession no. U00008) as follows: BamHIcw-primed sequence with bp 26623 to 26858, attR-primed sequence with bp 25733 to 25914, and attL-primed sequence with bp 25434 to 25715 of this sequence. An enterobacterial repetitive intergenic consensus sequence was found in the attR-primed sequence between the two nucleotides corresponding to nucleotides 25791 and 25792 of the U00008 sequence where yejZ overlaps with yejY in E. coli. Enterobacterial repetitive intergenic consensus sequences are highly conserved, approximately 126-bp repetitive sequences. They appear to be restricted to transcribed regions of the genome, either in intergenic regions of polycistronic operons or in untranslated regions upstream or downstream of open reading frames (19). yejY is the E. coli homolog of oxd-14. It presumably encodes a c-type cytochrome, based on sequence similarity (10). According to Iobbi-Nivol et al. (20), yojC-yejYX appear to be napABC, encoding a periplasmic nitrate reductase. The genes also appear to correspond to the aeg-46.5 locus, which was identified as an anaerobically expressed lac fusion which requires nitrate for full expression (9, 10). The napABC operon has been reported to be regulated by both Fnr and the NarLP system (15). An Fnr binding site (TTGATcctgCTCAG) has been identified in the promoter of this operon (10).

oxd-2. A 2,543-nucleotide continuous sequence (accession no. U89718) from both strands has been obtained by using oxd-2 clones pCM309 and pCM310. oxd-2 encodes a 402-amino-acid protein. It has strong similarity to E. coli orfX, an open reading frame downstream from the tdc operon. orfX encodes an acetate kinase-like enzyme. The open reading frame yhaS, immediately downstream from oxd-2, is similar to the E. coli pyruvate formate lyase gene (pfl). A 310-bp sequence obtained from pCM309 by use of primer BamHIcw could be aligned with E. coli rnpB (encoding the M1 RNA component of RNase P; accession no. AE000394), which is the third gene upstream to the tdc operon. A 262-bp sequence obtained from pCM310 by use of primer BamHIccw could be aligned with bp 10046 to 10309 of E. coli yhaP (accession no. AE00392; similar to the serine deaminase gene, sdaA), which is the fourth gene downstream from oxd-2. oxd-2 is unusual because it is induced only in amino acid-rich medium. Further characterization of this locus will be reported elsewhere.

oxd-6. Analysis of a partial sequence of oxd-6 suggested that it encodes a previously uncharacterized substrate-binding protein related to those of ABC transporters. The sequence of the entire oxd-6 gene and the surrounding region containing four other open reading frames that appear to comprise an operon encoding a transport system was determined (accession no. U94729). oxd-6 is the second gene in this putative five-gene operon. There is a possible Fnr-dependent sigma-70 promoter for this operon, with a -10 site (CATAAT) at nucleotides 515 to 520 and a possible Fnr site (CTCTTctgcGTCAA) at nucleotides 479 to 492.

The significance of these open reading frames as protein-coding sequences was investigated by a comparison of their sequences with the translated nucleotide database by using tBlastx. The translation of the first open reading frame (oxd-6a) had strong similarity to a large group of substrate-binding proteins, with highest similarity to the deduced amino acid sequence of an unidentified open reading frame, orf-1, following the ureR gene (accession no. L12007), which is found on a 160-kb plasmid of a urease-positive E. coli strain, strain 1440. Both Orf-1 and Oxd-6a are related to a nickel-binding protein of a nickel transport system in E. coli and to a group of dipeptide-, tripeptide-, or oligopeptide-binding proteins of the corresponding transport systems, subgroup 5 of the ABC transporters categorized by Tam and Saier (44). Subgroup 5 substrate-binding proteins are much larger than those in any other class of binding proteins, with more than 500 amino acid residues. The consensus signature sequence for subgroup 5 as proposed by Tam and Saier (44) aligns well with the corresponding region of Oxd-6a. We believe that the size of Oxd-6a and the similarity to the signature consensus makes it likely that this protein is a member of this subclass. The deduced amino acid sequences from oxd-6b and the third open reading frame (oxd-6c) could be aligned with the second and third components of typical ABC transport systems, which are usually transmembrane proteins. The remaining two open reading frames of the oxd-6 operon (oxd-6d and oxd-6e) are similar to the fourth and fifth proteins (both ATPases) of many ABC transporter systems.

Based on the Blastn search results, the E. coli chromosome does not have a counterpart of the oxd-6 operon. A 281-bp sequence obtained from the oxd-6 clone, pCM317, is identical to nucleotides 1564 to 1845 of GenBank entry M55546, of which nucleotides 729 to 1295 comprise the pagC gene. pagC and msgA, which is linked to pagC, encode macrophage survival factors and do not have E. coli homologs (29, 31). oxd-6, pagC, and msgA all appear to be part of a region of the Salmonella genome that does not have a homolog in E. coli (16). The presence of pagC and msgA, encoding macrophage survival factors, in this region defines it as a pathogenicity island.

The sequence suggests the possibility that the operon containing oxd-6 encodes either a peptide or nickel transport system. An fnr-dependent nickel transport system had been identified in E. coli (30), but the locus (nikABCDE) is at 77 min on the chromosome, while oxd-6 is at 25 min on the S. typhimurium chromosome. In an attempt to define the physiological function of the operon, we determined the effect of the absence of oxd-6 or its overexpression on nickel and peptide uptake. Since Ni2+ is toxic, it is possible that, if the operon containing oxd-6 encodes an Ni2+ transport system, mutants defective in oxd-6 might be less sensitive to Ni2+ than the oxd-6+ strains. Disk sensitivity assays were used to compare the sensitivity of an oxd-6 strain with that of an isogenic strain carrying the wild-type oxd-6 allele under both aerobic and anaerobic growth conditions. These assays revealed no differences in the sizes of the inhibition zones between the wild-type strain, the oxd-6 mutant, and the wild-type strain with the entire oxd-6 operon present on plasmid pBR322. Thus, these experiments provide no support for the idea that the oxd-6 operon encodes a nickel transporter, although they do not rule it out.

Since several S. typhimurium peptide transport systems (encoded by dpp, tpp, and opp [1, 14, 18]) have been previously characterized, the available mutants TN3336 (Delta oppBC250 tppB dpp-101::Tn5 metA15), TN3337 (Delta oppBC250 tppB dpp-101::Tn5 trp zde::Tn10), and TN5066 (Delta oppBC250 tppB dpp-101::Tn5 leu-1151::Tn10) were used in the peptide uptake tests. These mutants are deficient in the uptake of many peptides but can still utilize some peptide substrates. oxd-6::Mud-cam was introduced into these mutants to disrupt the oxd-6 gene in order to see if the resultant strains (TN5073, TN5074, and TN5075, respectively) lose the ability to use some of these peptides. In addition, pBR322 carrying the entire wild-type oxd-6 operon (pCM341) was introduced into each of the three mutants in order to see if it could restore the ability to use peptides. Only peptides potentially able to complement the auxotrophies of these strains (Met, Trp, and Leu) were used.

Comparison of the sizes of the growth zones showed that the oxd-6::Mud-cam mutation had little effect on peptide utilization in the dpp tpp opp background, and pCM341 did not complement the triple mutants for the use of any peptide tested. Thus, these experiments provide no support for the idea that the oxd-6 operon encodes a peptide transport system. Since only a few peptides were tested, however, it is possible that we have not found the specific peptide substrates for this transport system.

The sequence of a gene (orfZ) immediately downstream from the oxd-6 operon was also obtained (accession no. U94729). It appears to be transcribed divergently from this operon. Over the 858-bp sequence, the deduced amino acid sequence from a stretch of 407 bp showed 30% identity and 56% similarity to that of an unidentified open reading frame linked to the E. coli fda locus (accession no. X14436 [2]). fda (encodes fructose-1,6-diphosphate aldolase) is mapped to 63 min on the E. coli chromosome, while orfZ is mapped to 25 min on the S. typhimurium chromosome.

Identification of oxygen-regulated genes. Several other groups have used lac fusion techniques to identify anaerobically regulated genes (3, 9, 42, 48). With the exception of oxd-14, which belongs to the aeg-46.5 locus identified by the Reznikoff group (9), all of the oxd genes identified in this work appear to be different from those isolated by the other groups. The oxd insertions were isolated by screening pools of random lac fusions on MacConkey agar for fisheye colonies, i.e., colonies with dark red centers and white peripheries. This colony appearance presumably reflects the anaerobic induction of lac expression in the center of the colony. Clearly, this screen is an effective one for isolating anaerobically induced genes. In a secondary screen, the strains isolated as fisheyes were tested for the effect of an fnr mutation on the colony appearance, and only those strains which showed loss of the fisheye phenotype upon introduction of the fnr mutation were saved. Although this secondary screen yields fusions whose expression is affected by fnr, in several cases the effects are indirect and not all of the oxd genes are directly regulated by fnr.

Nine oxd genes were characterized in this work, seven of which correspond to previously known genes and two of which are new genes (Table 3). Among the oxd genes, oxd-5 (hybB), -7 (dcuB), -8 (moaB), -12 (dmsA), and -14 (napB) are clearly involved in anaerobic respiration. oxd-4 and -11 have no obvious role in anaerobic respiration, although it has been proposed that vitamin B12 may support anaerobic growth on compounds such as ethanolamine, propanediol, and glycerol by catalyzing molecular rearrangements that generate redox pairs (34). pepT and oxd-2 appear to be involved in anaerobic peptide breakdown and anaerobic amino acid metabolism, respectively, and it is possible that oxd-6 may function as an anaerobically induced peptide transport system, although there is no evidence other than sequence similarity to support this possibility.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   oxd genes


    ACKNOWLEDGMENTS

We acknowledge the contributions of Mike Banks and Elaine Zack, who carried out the beta -galactosidase assays reported in Table 2, and Tom Elliot for providing strains. We are grateful to Tina Knox for her help in preparing the manuscript.

This work was supported by a grant (AI10333) from the National Institute of Allergy and Infectious Diseases.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Microbiology, University of Illinois at Urbana-Champaign, B103 Chemical & Life Sciences Laboratory, 601 South Goodwin Ave., Urbana, IL 61801. Phone: (217) 244-8418. Fax: (217) 244-6697. E-mail: charlesm{at}uiuc.edu.

dagger Present address: Roche Vitamins Inc., Nutley, NJ 07110.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

1. Abouhamad, W. N., M. Manson, M. M. Gibson, and C. F. Higgins. 1991. Peptide transport and chemotaxis in Escherichia coli and Salmonella typhimurium: characterization of the dipeptide permease (Dpp) and the dipeptide-binding protein. Mol. Microbiol. 5:1035-1047[Medline].
2. Alefounder, P. R., and R. N. Perham. 1989. Identification, molecular cloning and sequence analysis of a gene cluster encoding the class II fructose 1,6-bisphosphate aldolase, 3-phosphoglycerate kinase and a putative second glyceraldehyde 3-phosphate dehydrogenase of Escherichia coli. Mol. Microbiol. 3:723-732[Medline].
3. Aliabadi, Z., F. Warren, S. Mya, and J. W. Foster. 1986. Oxygen-regulated stimulons of Salmonella typhimurium identified by Mud(Ap lac) operon fusions. J. Bacteriol. 165:780-786[Abstract/Free Full Text].
4. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment tool. J. Mol. Biol. 215:403-410[Medline].
5. Baker, K. P., and D. H. Boxer. 1991. Regulation of the chlA locus of Escherichia coli K12: involvement of molybdenum cofactor. Mol. Microbiol. 5:901-907[Medline].
6. Bell, P. J., S. C. Andrews, M. N. Sivak, and J. R. Guest. 1989. Nucleotide sequence of the FNR-regulated fumarase gene (fumB) of Escherichia coli K-12. J. Bacteriol. 171:3494-3503[Abstract/Free Full Text].
7. Bilous, P. T., S. T. Cole, W. F. Anderson, and J. H. Weiner. 1988. Nucleotide sequence of the dmsABC operon encoding the anaerobic dimethylsulphoxide reductase of Escherichia coli. Mol. Microbiol. 2:785-795[Medline].
8. Chen, P., M. Ailion, T. Bobik, G. Storomo, and J. Roth. 1995. Five promoters integrate control of the cob/pdu regulon in Salmonella typhimurium. J. Bacteriol. 177:5401-5410[Abstract/Free Full Text].
9. Choe, M., and W. S. Reznikoff. 1991. Anaerobically expressed Escherichia coli genes identified by operon fusion techniques. J. Bacteriol. 173:6139-6146[Abstract/Free Full Text].
10. Choe, M., and W. S. Reznikoff. 1993. Identification of the regulatory sequence of anaerobically expressed locus aeg-46.5. J. Bacteriol. 175:1165-1172[Abstract/Free Full Text].
11. Cotter, P. A., and R. P. Gunsalus. 1989. Oxygen, nitrate, and molybdenum regulation of dmsABC gene expression in Escherichia coli. J. Bacteriol. 171:3817-3823[Abstract/Free Full Text].
12. Elliott, T. 1993. Transport of 5-aminolevulinic acid by the dipeptide permease in Salmonella typhimurium. J. Bacteriol. 175:325-331[Abstract/Free Full Text].
13. Engel, P., R. Kramer, and G. Unden. 1992. Anaerobic fumarate transport in Escherichia coli by an fnr-dependent dicarboxylate uptake system which is different from the aerobic dicarboxylate uptake system. J. Bacteriol. 174:5533-5539[Abstract/Free Full Text].
14. Gibson, M. M., M. Price, and C. F. Higgins. 1984. Genetic characterization and molecular cloning of the tripeptide permease (tpp) genes of Salmonella typhimurium. J. Bacteriol. 160:122-130[Abstract/Free Full Text].
15. Grove, J., S. Tanapongpipat, G. Thomas, L. Griffiths, H. Crooke, and J. Cole. 1996. Escherichia coli K-12 genes essential for the synthesis of c-type cytochromes and a third nitrate reductase located in the periplasm. Mol. Microbiol. 19:467-481[Medline].
16. Gunn, J. S., C. M. Alpuche-Aranda, W. P. Loomis, W. J. Belden, and S. I. Miller. 1995. Characterization of the Salmonella typhimurium pagC/pagD chromosomal region. J. Bacteriol. 177:5040-5047[Abstract/Free Full Text].
17. Gutnick, D., J. M. Calvo, T. Klopotowski, and B. N. Ames. 1969. Compounds which serve as sole source of carbon or nitrogen for Salmonella typhimurium LT2. J. Bacteriol. 100:215-219[Abstract/Free Full Text].
18. Higgins, C. F., and M. M. Hardie. 1983. Periplasmic protein associated with the oligopeptide permeases of Salmonella typhimurium and Escherichia coli. J. Bacteriol. 155:1434-1438[Abstract/Free Full Text].
19. Hulton, C. S., C. F. Higgins, and P. M. Sharp. 1991. ERIC sequences: a novel family of repetitive elements in the genomes of Escherichia coli, Salmonella typhimurium and other enterobacteria. Mol. Microbiol. 5:825-834[Medline].
20. Iobbi-Nivol, C., H. Crooke, L. Griffiths, J. Grove, H. Hussain, J. Pommier, V. Mejean, and J. A. Cole. 1994. A reassessment of the range of c-type cytochromes synthesized by Escherichia coli K-12. FEMS Microbiol. Lett. 119:89-94[Medline].
21. Jeter, R. M., B. M. Olivera, and J. R. Roth. 1984. Salmonella typhimurium synthesizes cobalamin (vitamin B12) de novo under anaerobic growth conditions. J. Bacteriol. 159:206-213[Abstract/Free Full Text].
22. Jordan, P. A., A. J. Thomson, E. T. Ralph, J. R. Guest, and J. Green. 1997. FNR is a direct oxygen sensor having a biphasic response curve. FEBS Lett. 416:349-352[Medline].
23. Kukral, A. M., K. L. Strauch, R. A. Maurer, and C. G. Miller. 1987. Genetic analysis in Salmonella typhimurium with a small collection of randomly spaced insertions of transposon Tn10Delta 16Delta 17. J. Bacteriol. 169:1787-1793[Abstract/Free Full Text].
24. Lazazzera, B. A., H. Beinert, N. Khoroshilova, M. C. Kennedy, and P. J. Kiley. 1996. DNA binding and dimerization of the Fe-S-containing FNR protein from Escherichia coli are regulated by oxygen. J. Biol. Chem. 271:2762-2768[Abstract/Free Full Text].
25. Lombardo, M.-J., A. A. Lee, T. M. Knox, and C. G. Miller. 1997. Regulation of the Salmonella typhimurium pepT gene by cyclic AMP receptor protein (CRP) and FNR acting at a hybrid CRP-FNR site. J. Bacteriol. 179:1909-1917[Abstract/Free Full Text].
26. Maurer, R., B. C. Osmond, E. Shekhtman, A. Wong, and D. Botstein. 1984. Functional interchangeability of DNA replication genes in Salmonella typhimurium and Escherichia coli demonstrated by a general complementation procedure. Genetics 108:1-23[Abstract/Free Full Text].
27. Menon, N. K., C. Y. Chatelus, M. Dervartanian, J. C. Wendt, K. T. Shanmugam, H. D. Peck, Jr., and A. E. Przybyla. 1994. Cloning, sequencing, and mutational analysis of the hyb operon encoding Escherichia coli hydrogenase 2. J. Bacteriol. 176:4416-4423[Abstract/Free Full Text].
28. Miller, J. H. 1992. A laboratory manual and handbook for E. coli and related bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
29. Miller, S. I., A. M. Kukral, and J. J. Mekalanos. 1989. A two-component regulatory system (phoP phoQ) controls Salmonella typhimurium virulence. Proc. Natl. Acad. Sci. USA 86:5054-5058[Abstract/Free Full Text].
30. Navarro, C., L. F. Wu, and M. A. Mandrand-Berthelot. 1993. The nik operon of Escherichia coli encodes a periplasmic binding-protein-dependent transport system for nickel. Mol. Microbiol. 9:1181-1191[Medline].
31. Pulkkinen, W. S., and S. I. Miller. 1991. A Salmonella typhimurium virulence protein is similar to a Yersinia enterocolitica invasion protein and a bacteriophage lambda outer membrane protein. J. Bacteriol. 173:86-93[Abstract/Free Full Text].
32. Ratzkin, B., and J. Roth. 1978. Cluster of genes controlling proline degradation in Salmonella typhimurium. J. Bacteriol. 133:744-754[Abstract/Free Full Text].
33. Rivers, S. L., E. McNairn, F. Blasco, G. Giordano, and D. H. Boxer. 1993. Molecular genetic analysis of the moa operon of Escherichia coli K-12 required for molybdenum cofactor biosynthesis. Mol. Microbiol. 8:1071-1081[Medline].
34. Roth, J. R., J. G. Lawrence, and T. A. Bobik. 1996. Cobalamin (coenzyme B12): synthesis and biological significance. Annu. Rev. Microbiol. 50:137-181[Medline].
35. Roth, J. R., J. G. Lawrence, M. Rubenfield, S. Kieffer-Higgins, and G. M. Church. 1993. Characterization of the cobalamin (vitamin B12) biosynthetic genes of Salmonella typhimurium. J. Bacteriol. 175:3303-3316[Abstract/Free Full Text].
36. Sawers, G. 1994. The hydrogenases and formate dehydrogenases of Escherichia coli. Antonie Van Leeuwenhoek 66:57-88[Medline].
37. Sawers, R. G., D. J. Jamieson, C. F. Higgins, and D. H. Boxer. 1986. Characterization and physiological roles of membrane-bound hydrogenase isoenzymes from Salmonella typhimurium. J. Bacteriol. 168:398-404[Abstract/Free Full Text].
38. Schmieger, H. 1972. Phage P22 mutants with increased or decreased transduction abilities. Mol. Gen. Genet. 119:75-88[Medline].
39. Sharp, P. M. 1991. Determinants of DNA sequence divergence between Escherichia coli and Salmonella typhimurium: codon usage, map position, and concerted evolution. J. Mol. Evol. 33:23-33[Medline].
40. Six, S., S. C. Andrews, G. Unden, and J. R. Guest. 1994. Escherichia coli possesses two homologous anaerobic C4-dicarboxylate membrane transporters (DcuA and DcuB) distinct from the aerobic dicarboxylate transport system (Dct). J. Bacteriol. 176:6470-6478[Abstract/Free Full Text].
41. Spiro, S., and J. R. Guest. 1990. FNR and its role in oxygen-regulated gene expression in Escherichia coli. FEMS Microbiol. Rev. 6:399-428[Medline].
42. Strauch, K. L., J. B. Lenk, B. L. Gamble, and C. G. Miller. 1985. Oxygen regulation in Salmonella typhimurium. J. Bacteriol. 161:673-680[Abstract/Free Full Text].
43. Strauch, K. L., and C. G. Miller. 1983. Isolation and characterization Salmonella typhimurium mutants lacking a tripeptidase (peptidase T). J. Bacteriol. 154:763-771[Abstract/Free Full Text].
44. Tam, R., and M. H. Saier, Jr. 1993. Structural, functional, and evolutionary relationships among extracellular solute-binding receptors of bacteria. Microbiol. Rev. 57:320-346[Abstract/Free Full Text].
45. Unden, G., and J. Bongaerts. 1997. Alternative respiratory pathways of Escherichia coli: energetics and transcriptional regulation in response to electron acceptors. Biochim. Biophys. Acta 1320:217-234[Medline].
46. Vogel, H. J., and D. M. Bonner. 1956. Acetylornithase of E. coli: partial purification and some properties. J. Biol. Chem. 218:97-106[Free Full Text].
47. Weiner, J. H., D. P. MacIsaac, R. E. Bishop, and P. T. Bilous. 1988. Purification and properties of Escherichia coli dimethyl sulfoxide reductase, an iron-sulfur molybdoenzyme with broad substrate specificity. J. Bacteriol. 170:1505-1510[Abstract/Free Full Text].
48. Winkelman, J. W., and D. P. Clark. 1986. Anaerobically induced genes of Escherichia coli. J. Bacteriol. 167:362-367[Abstract/Free Full Text].
49. Wu, L. F., M. A. Mandrand-Berthelot, R. Waugh, C. J. Edmonds, S. E. Holt, and D. H. Boxer. 1989. Nickel deficiency gives rise to the defective hydrogenase phenotype of hydC and fnr mutants in Escherichia coli. Mol. Microbiol. 3:1709-1718[Medline].


Journal of Bacteriology, October 1999, p. 6092-6097, Vol. 181, No. 19
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wei, Y.
Right arrow Articles by Miller, C. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wei, Y.
Right arrow Articles by Miller, C. G.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Appl. Environ. Microbiol. Infect. Immun. Eukaryot. Cell
Mol. Cell. Biol. J. Virol. Microbiol. Mol. Biol. Rev.
ALL ASM JOURNALS